PMID-sentid	Pub_year	Sent_text	compound_name	comp_offset	prot_official_name	organism	prot_offset
2583113-8	1989	Exposing cells to reduced temperature or weak bases such as NH4Cl, chloroquine and primaquine decreases the steady-state concentration of LAP at the cell surface.	Chloroquine	67-78	acid phosphatase 2, lysosomal	Homo sapiens	138-141
2515970-6	1989	The time delay of re-extrusion was increased at starting concentrations of VIP exceeding 1 nmol l-1 and in the presence of the lysosomal inhibitor chloroquine.	Chloroquine	147-158	vasoactive intestinal peptide	Rattus norvegicus	75-78
2510347-8	1989	Degradation products of 125I-t-PA were found in the supernatant after a short lag phase and then increased linearly for at least 5 hours at 37 degrees C. Degradation could be inhibited by chloroquine, NH4Cl and NaN3.	Chloroquine	188-199	plasminogen activator, tissue type	Homo sapiens	29-33
2692404-14	1989	Receptor-bound insulin is internalized and degraded by a chloroquine-sensitive, energy-requiring reaction.	Chloroquine	57-68	insulin	Homo sapiens	15-22
2556942-5	1989	However, oral administration of chloroquine resulted in a transient increase in the intestinal concentration of Cbl in both adult and suckling rats and in total inhibition of Cbl released from IF in adults rats.	Chloroquine	32-43	cobalamin binding intrinsic factor	Rattus norvegicus	193-195
2556942-6	1989	Chloroquine prevented completely the transfer of Cbl to TC-II in adult rats and inhibited the transfer by 50% in suckling rats.	Chloroquine	0-11	transcobalamin 2	Rattus norvegicus	56-61
2695506-2	1989	This LHRH-A-induced T secretion was completely blocked by quinacrine and chloroquine, inhibitors of phospholipase A2.	Chloroquine	73-84	gonadotropin releasing hormone 1	Rattus norvegicus	5-9
2695506-2	1989	This LHRH-A-induced T secretion was completely blocked by quinacrine and chloroquine, inhibitors of phospholipase A2.	Chloroquine	73-84	phospholipase A2 group IB	Rattus norvegicus	100-116
2762297-6	1989	This stimulation was blocked by chloroquine, suggesting that such stimulation resulted from receptor-mediated uptake and lysosomal hydrolysis of the cholesteryl esters in apo E-enriched beta-VLDL.	Chloroquine	32-43	apolipoprotein E	Homo sapiens	171-176
2760215-7	1989	To determine the role of receptor cycling on AII-induced surface receptor loss, cells were incubated with the endosomal inhibitor chloroquine during exposure to AII at 21 degrees C. Incubation with AII plus chloroquine resulted in a 70% greater loss of surface binding than after incubation with AII alone.	Chloroquine	130-141	angiotensinogen	Rattus norvegicus	45-48
2760215-7	1989	To determine the role of receptor cycling on AII-induced surface receptor loss, cells were incubated with the endosomal inhibitor chloroquine during exposure to AII at 21 degrees C. Incubation with AII plus chloroquine resulted in a 70% greater loss of surface binding than after incubation with AII alone.	Chloroquine	130-141	angiotensinogen	Rattus norvegicus	161-164
2760215-7	1989	To determine the role of receptor cycling on AII-induced surface receptor loss, cells were incubated with the endosomal inhibitor chloroquine during exposure to AII at 21 degrees C. Incubation with AII plus chloroquine resulted in a 70% greater loss of surface binding than after incubation with AII alone.	Chloroquine	130-141	angiotensinogen	Rattus norvegicus	161-164
2760215-7	1989	To determine the role of receptor cycling on AII-induced surface receptor loss, cells were incubated with the endosomal inhibitor chloroquine during exposure to AII at 21 degrees C. Incubation with AII plus chloroquine resulted in a 70% greater loss of surface binding than after incubation with AII alone.	Chloroquine	130-141	angiotensinogen	Rattus norvegicus	161-164
2760215-7	1989	To determine the role of receptor cycling on AII-induced surface receptor loss, cells were incubated with the endosomal inhibitor chloroquine during exposure to AII at 21 degrees C. Incubation with AII plus chloroquine resulted in a 70% greater loss of surface binding than after incubation with AII alone.	Chloroquine	207-218	angiotensinogen	Rattus norvegicus	45-48
2760215-7	1989	To determine the role of receptor cycling on AII-induced surface receptor loss, cells were incubated with the endosomal inhibitor chloroquine during exposure to AII at 21 degrees C. Incubation with AII plus chloroquine resulted in a 70% greater loss of surface binding than after incubation with AII alone.	Chloroquine	207-218	angiotensinogen	Rattus norvegicus	161-164
2760215-7	1989	To determine the role of receptor cycling on AII-induced surface receptor loss, cells were incubated with the endosomal inhibitor chloroquine during exposure to AII at 21 degrees C. Incubation with AII plus chloroquine resulted in a 70% greater loss of surface binding than after incubation with AII alone.	Chloroquine	207-218	angiotensinogen	Rattus norvegicus	161-164
2760215-7	1989	To determine the role of receptor cycling on AII-induced surface receptor loss, cells were incubated with the endosomal inhibitor chloroquine during exposure to AII at 21 degrees C. Incubation with AII plus chloroquine resulted in a 70% greater loss of surface binding than after incubation with AII alone.	Chloroquine	207-218	angiotensinogen	Rattus norvegicus	161-164
2526121-5	1989	Preincubation of the cells with ammonium chloride or chloroquine resulted in a significant increase in the intracellular accumulation of radiolabel, indicative of endocytosis and rapid delivery of 125I-hANF to an acidic intracellular compartment (endosome and/or lysosome).	Chloroquine	53-64	HESX homeobox 1	Homo sapiens	202-206
2669324-8	1989	In the presence of 20 microM chloroquine, a lysosomal inhibitor, undegraded gp70 was seen to slowly accumulate in these intracellular organelles.	Chloroquine	29-40	embigin	Mus musculus	76-80
2779545-2	1989	Several recent reports indicate that inhibitors of phospholipase A, such as mepacrine, chloroquine and chlorpromazine, can prevent heart phosphoglyceride breakdown in vivo.	Chloroquine	87-98	phospholipase A and acyltransferase 1	Rattus norvegicus	51-66
2677679-9	1989	Treatment of the transfected CHO cells with weak bases (NH4Cl and chloroquine), or a monovalent ionophore (monensin), prevented proteolytic processing of the TGF-beta 1 precursor indicating that cleavage occurs by proteases in an acidic cellular compartment.	Chloroquine	66-77	transforming growth factor beta-1 proprotein	Cricetulus griseus	158-168
2759144-6	1989	The significant increases in lysosomal (cathepsin B & L, B and D) proteases and thiol protease inhibitor occurred in the earlier stages of CQ-induced myopathy, when hardly any autophagic vacuoles or dense bodies were observable by light microscopy.	Chloroquine	143-145	cathepsin B	Rattus norvegicus	40-51
2542108-4	1989	At 37 degrees C, chloroquine produced an increase in cell-associated 125I-IGF-I, suggesting that IGF-I is internalized and degraded in a manner analogous to insulin.	Chloroquine	17-28	insulin like growth factor 1	Homo sapiens	74-79
2542108-4	1989	At 37 degrees C, chloroquine produced an increase in cell-associated 125I-IGF-I, suggesting that IGF-I is internalized and degraded in a manner analogous to insulin.	Chloroquine	17-28	insulin like growth factor 1	Homo sapiens	97-102
2495825-6	1989	In chloroquine-treated open follicles, we observed the appearance of a definite fraction of [125I]thyroglobulin in a lysosome subpopulation having the expected properties of phagolysosomes or secondary lysosomes.	Chloroquine	3-14	thyroglobulin	Sus scrofa	98-111
2535943-5	1989	Chloroquine (greater than or equal to 100 mumol/L) was able to abrogate the TNF effect on the total TM pool but not the effect on surface-expressed TM activity.	Chloroquine	0-11	tumor necrosis factor	Bos taurus	76-79
2535943-5	1989	Chloroquine (greater than or equal to 100 mumol/L) was able to abrogate the TNF effect on the total TM pool but not the effect on surface-expressed TM activity.	Chloroquine	0-11	thrombomodulin	Bos taurus	100-102
2473854-5	1989	These indications of a classical receptor-mediated uptake and breakdown pathway were confirmed in experiments in which the acidotrophic agent chloroquine was added to the maternal circuit prior to the alpha 2M-T.	Chloroquine	142-153	alpha-2-macroglobulin	Homo sapiens	201-209
2473854-6	1989	In the presence of chloroquine, tissue uptake was inhibited and the subsequent release of radioactive degradation products into the fetal circuit was similar to the levels seen with alpha 2M.	Chloroquine	19-30	alpha-2-macroglobulin	Homo sapiens	182-190
2653825-13	1989	Chloroquine and dansyl cadaverine but not methylamine or ammonium chloride showed specific inhibition of insulin degradation in isolated endocytic vesicles.	Chloroquine	0-11	insulin	Homo sapiens	105-112
2557800-2	1989	The efficacy of a single dose of CQ (10 mg base kg-1, C10) was tested with assessment of subjects on Days 2 and 7 after treatment; 108 (99%) of 109 children were aparasitaemic on Day 7.	Chloroquine	33-35	homeobox C10	Homo sapiens	54-57
2744008-1	1989	The effect of pH on the secretion of the gp 80 glycoprotein complex and lysozyme from MDCK cells was examined by treatment of the cells with either NH4Cl, chloroquine or monensin.	Chloroquine	155-166	clusterin	Canis lupus familiaris	41-46
2591638-2	1989	The Km for ammonia of carbamyl phosphate synthetase was determined by preincubating isolated liver cells for 30 min in the absence of ammonia and bicarbonate and in the presence of ornithine, chloroquine, which blocks lysosomal proteolysis, and aminoxy acetic acid, which inhibits transaminases.	Chloroquine	192-203	carbamoyl-phosphate synthase 1	Rattus norvegicus	22-51
2744637-3	1989	Initial identification of the platelet-specific antibodies was achieved by using chloroquine-treated PlA1(+) and PlA1(-) platelets.	Chloroquine	81-92	POU class 2 homeobox 3	Homo sapiens	101-105
2779979-4	1989	It is shown that chloroquine inhibits rhodopsin synthesis and the renewal of rod outer segment membranes.	Chloroquine	17-28	rhodopsin	Oryctolagus cuniculus	38-47
2554438-8	1989	Incubation in the presence of 0.2 mM chloroquine, an inhibitor of intracellular hormone degradation, resulted in intracellular accumulation of 125I-GLP-1(7-36)amide.	Chloroquine	37-48	glucagon	Rattus norvegicus	148-153
2554438-10	1989	Chloroquine caused a 5-fold increase of the peak representing intact 125I-GLP-1(7-36)amide thus demonstrating inhibition of degradation of labelled peptide.	Chloroquine	0-11	glucagon	Rattus norvegicus	74-79
2554438-12	1989	It was excluded that chloroquine is able to interfere with GLP-1(7-36)amide-binding to its receptor.	Chloroquine	21-32	glucagon	Rattus norvegicus	59-64
2849510-3	1988	For example, trans-activation can be detected at tat concentrations as low as 1 nM in the presence of chloroquine.	Chloroquine	102-113	tyrosine aminotransferase	Homo sapiens	49-52
2763504-6	1989	We suggest that the action of chloroquine is to remove beta 2m alone, which prevents normal class I expression and also results in conformational changes to the class I heavy chain, but that it is not capable of removing the membrane-bound heavy chain.	Chloroquine	30-41	beta-2-microglobulin	Homo sapiens	55-62
2849510-4	1988	Experiments using radioactive protein show that tat becomes localized to the nucleus after uptake and suggest that chloroquine protects tat from proteolytic degradation.	Chloroquine	115-126	tyrosine aminotransferase	Homo sapiens	48-51
2849510-4	1988	Experiments using radioactive protein show that tat becomes localized to the nucleus after uptake and suggest that chloroquine protects tat from proteolytic degradation.	Chloroquine	115-126	tyrosine aminotransferase	Homo sapiens	136-139
3137115-5	1988	Both chloroquine and glucagon immediately caused a marked and parallel decrease in biliary excretion of three lysosomal enzymes, N-acetyl-beta-glucosaminidase, beta-glucuronidase, and beta-galactosidase, to 25%-30% of baseline values (p less than 0.01).	Chloroquine	5-16	O-GlcNAcase	Rattus norvegicus	129-158
3198604-10	1988	Chloroquine treatment for 2 days led to a 270% increase in cathepsin B and a 160% increase in lysosomal ATPase activities, but only a 30% increase in neutral proteinase activities.	Chloroquine	0-11	cathepsin B	Homo sapiens	59-70
2460529-5	1988	The response to native insulin, peptides, and A chain dimers was sensitive to chloroquine suggesting that none of these moieties is the terminal processed peptide recognized by insulin immune T cells.	Chloroquine	78-89	insulin	Homo sapiens	23-30
3137115-5	1988	Both chloroquine and glucagon immediately caused a marked and parallel decrease in biliary excretion of three lysosomal enzymes, N-acetyl-beta-glucosaminidase, beta-glucuronidase, and beta-galactosidase, to 25%-30% of baseline values (p less than 0.01).	Chloroquine	5-16	glucuronidase, beta	Rattus norvegicus	160-178
3137115-5	1988	Both chloroquine and glucagon immediately caused a marked and parallel decrease in biliary excretion of three lysosomal enzymes, N-acetyl-beta-glucosaminidase, beta-glucuronidase, and beta-galactosidase, to 25%-30% of baseline values (p less than 0.01).	Chloroquine	5-16	galactosidase, beta 1	Rattus norvegicus	184-202
3137115-8	1988	Changes in biliary excretion of lysosomal enzymes accompanying chloroquine and glucagon administration were associated with morphologic evidence of autophagy as assessed by electron microscopy and by increased fragility of hepatic lysosomes as assessed by latency of N-acetyl-beta-glucosaminidase.	Chloroquine	63-74	O-GlcNAcase	Rattus norvegicus	267-296
2843546-9	1988	The 16-kD form was more slowly degraded with a half-life of approximately 8 h. Degradation of internalized 125I-bFGF was inhibited by chloroquine, suggesting that the digestion occurred in a lysosomal compartment.	Chloroquine	134-145	fibroblast growth factor 2	Bos taurus	112-116
3207554-2	1988	Chloroquine was found to be excreted into semen with a slow transfer rate constant of 0.0002 min-1, and the semen/plasma ratio based on regression analysis was 0.40 +/- 0.06 (mean +/- s.d.).	Chloroquine	0-11	CD59 molecule (CD59 blood group)	Homo sapiens	93-98
3283119-7	1988	The dissociation of insulin from internalized insulin-receptor complexes was markedly inhibited by monensin and chloroquine.	Chloroquine	112-123	insulin	Homo sapiens	20-27
2850244-9	1988	As chloroquine prevents recycling, we conclude that after binding of CT the receptors are internalized, transferred to a lysosomal compartment, and degraded intracellularly without recycling.	Chloroquine	3-14	calcitonin related polypeptide alpha	Homo sapiens	69-71
2838354-10	1988	The lysosomotropic drugs monensin and chloroquine caused intracellular accumulation of insulin and its receptors internalized at low concentrations of insulin but had a relatively smaller effect on receptors internalized at high concentrations of insulin.	Chloroquine	38-49	insulin	Homo sapiens	87-94
2838354-10	1988	The lysosomotropic drugs monensin and chloroquine caused intracellular accumulation of insulin and its receptors internalized at low concentrations of insulin but had a relatively smaller effect on receptors internalized at high concentrations of insulin.	Chloroquine	38-49	insulin	Homo sapiens	151-158
2838354-10	1988	The lysosomotropic drugs monensin and chloroquine caused intracellular accumulation of insulin and its receptors internalized at low concentrations of insulin but had a relatively smaller effect on receptors internalized at high concentrations of insulin.	Chloroquine	38-49	insulin	Homo sapiens	151-158
2839482-3	1988	During cell incubation with TNF receptor degradation suppressed by chloroquine, the number of surface TNF receptors remained approximately constant, but the total number of surface and internal TNF receptors increased gradually, at 3 h reaching 1.5 times the initial number, thus suggesting continuous synthesis, externalization, internalization, and degradation of the TNF receptor in the absence of cycloheximide.	Chloroquine	67-78	tumor necrosis factor	Homo sapiens	28-31
2839482-3	1988	During cell incubation with TNF receptor degradation suppressed by chloroquine, the number of surface TNF receptors remained approximately constant, but the total number of surface and internal TNF receptors increased gradually, at 3 h reaching 1.5 times the initial number, thus suggesting continuous synthesis, externalization, internalization, and degradation of the TNF receptor in the absence of cycloheximide.	Chloroquine	67-78	tumor necrosis factor	Homo sapiens	102-105
2839482-3	1988	During cell incubation with TNF receptor degradation suppressed by chloroquine, the number of surface TNF receptors remained approximately constant, but the total number of surface and internal TNF receptors increased gradually, at 3 h reaching 1.5 times the initial number, thus suggesting continuous synthesis, externalization, internalization, and degradation of the TNF receptor in the absence of cycloheximide.	Chloroquine	67-78	tumor necrosis factor	Homo sapiens	102-105
2839482-3	1988	During cell incubation with TNF receptor degradation suppressed by chloroquine, the number of surface TNF receptors remained approximately constant, but the total number of surface and internal TNF receptors increased gradually, at 3 h reaching 1.5 times the initial number, thus suggesting continuous synthesis, externalization, internalization, and degradation of the TNF receptor in the absence of cycloheximide.	Chloroquine	67-78	tumor necrosis factor	Homo sapiens	102-105
3283119-7	1988	The dissociation of insulin from internalized insulin-receptor complexes was markedly inhibited by monensin and chloroquine.	Chloroquine	112-123	insulin	Homo sapiens	46-53
3283119-8	1988	Furthermore, chloroquine markedly increased the number of cross-linkable intracellular insulin-receptor complexes, as analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis autoradiography.	Chloroquine	13-24	insulin	Homo sapiens	87-94
3260875-5	1988	Nordihydroguaiaretic acid and chloroquine suppressed the stimulatory effect of EGF in a dose-dependent manner.	Chloroquine	30-41	epidermal growth factor like 1	Rattus norvegicus	79-82
3284910-6	1988	Chloroquine led to an increase in cell-associated radioactivity of approximately 1.4-fold in cells incubated with insulin or proinsulin, but inhibited the appearance of degraded insulin by 54% and degraded proinsulin by only 10%.	Chloroquine	0-11	insulin	Homo sapiens	114-121
3284910-6	1988	Chloroquine led to an increase in cell-associated radioactivity of approximately 1.4-fold in cells incubated with insulin or proinsulin, but inhibited the appearance of degraded insulin by 54% and degraded proinsulin by only 10%.	Chloroquine	0-11	insulin	Homo sapiens	125-135
3284910-6	1988	Chloroquine led to an increase in cell-associated radioactivity of approximately 1.4-fold in cells incubated with insulin or proinsulin, but inhibited the appearance of degraded insulin by 54% and degraded proinsulin by only 10%.	Chloroquine	0-11	insulin	Homo sapiens	128-135
3284910-6	1988	Chloroquine led to an increase in cell-associated radioactivity of approximately 1.4-fold in cells incubated with insulin or proinsulin, but inhibited the appearance of degraded insulin by 54% and degraded proinsulin by only 10%.	Chloroquine	0-11	insulin	Homo sapiens	206-216
3176170-6	1988	The chloroquine and DNR accumulation in lysosomes inhibited activities of some lysosomal hydrolases tested: cathepsins B and D, N-acetyl-beta, D-glucosaminidase and acid phosphatase.	Chloroquine	4-15	O-GlcNAcase	Homo sapiens	128-160
3281950-0	1988	Internalized insulin-receptor complexes are unidirectionally translocated to chloroquine-sensitive degradative sites.	Chloroquine	77-88	insulin receptor	Rattus norvegicus	13-29
2456779-12	1988	Receptor turnover and degradation of alpha 2M-thrombin complexes were blocked in monocytes treated with chloroquine, an inhibitor of lysosomal function.	Chloroquine	104-115	alpha-2-macroglobulin	Homo sapiens	37-45
3259239-10	1988	Addition of chloroquine to either cell line inhibited processing of EGF beyond removal of the carboxyl terminal arginine residue.	Chloroquine	12-23	epidermal growth factor	Homo sapiens	68-71
2456779-12	1988	Receptor turnover and degradation of alpha 2M-thrombin complexes were blocked in monocytes treated with chloroquine, an inhibitor of lysosomal function.	Chloroquine	104-115	coagulation factor II, thrombin	Homo sapiens	46-54
2965148-7	1988	(c) Label and chase experiments with and without chloroquine showed that virtually all of the free heparan sulfate glycosaminoglycan chains derived from endocytosis and lysosomal degradation of the plasma membrane-associated HSPG.	Chloroquine	49-60	syndecan 2	Mus musculus	225-229
3259239-11	1988	Both intact 125I-EGF, and 125I-EGF lacking the carboxyl terminal arginine were released from chloroquine-treated cells in a ratio equal to that present in the intact cells.	Chloroquine	93-104	epidermal growth factor	Homo sapiens	31-34
3227859-1	1988	The cardiac effects of the phospholipase A2 inhibiting agent chloroquine were studied in dogs, rats and cats.	Chloroquine	61-72	phospholipase A2 group IB	Canis lupus familiaris	27-43
3258563-5	1988	Presentation of endogenously synthesized IgG2a by this population of dendritic cells, macrophages, and/or activated B cells was chloroquine sensitive.	Chloroquine	128-139	immunoglobulin heavy variable V1-9	Mus musculus	41-46
3258563-10	1988	The response directed towards endogenous IgG2a expressed in M12.C3.A2 lymphoma cells is chloroquine resistant and considerably more efficient than that stimulated by IgG2a added as exogenous soluble antigen.	Chloroquine	88-99	immunoglobulin heavy variable V1-9	Mus musculus	41-46
3163172-4	1988	Mortality was 100% within 30 h. Pretreatment with chloroquine, a phospholipase A2 inhibitor, led to a inhibition of TXB2 production, whereas 6-keto-PGF1 alpha and PGE2 levels showed a surprising slight elevation in the first 6 h. Pretreatment with chloroquine decreased mortality by 30%.	Chloroquine	50-61	phospholipase A2 group IB	Rattus norvegicus	65-81
2829746-3	1988	During cell incubation with suppression of TNF receptor degradation by chloroquine, the number of surface TNF receptors remained approximately constants, but the total number of surface and internal TNF receptors increased gradually, at 3h reaching 1.5 times of the initial number, thus suggesting continuous synthesis, externalization, internalization, and degradation of the TNF receptor in the absence of cycloheximide.	Chloroquine	71-82	tumor necrosis factor	Homo sapiens	43-46
2829746-3	1988	During cell incubation with suppression of TNF receptor degradation by chloroquine, the number of surface TNF receptors remained approximately constants, but the total number of surface and internal TNF receptors increased gradually, at 3h reaching 1.5 times of the initial number, thus suggesting continuous synthesis, externalization, internalization, and degradation of the TNF receptor in the absence of cycloheximide.	Chloroquine	71-82	tumor necrosis factor	Homo sapiens	106-109
2829746-3	1988	During cell incubation with suppression of TNF receptor degradation by chloroquine, the number of surface TNF receptors remained approximately constants, but the total number of surface and internal TNF receptors increased gradually, at 3h reaching 1.5 times of the initial number, thus suggesting continuous synthesis, externalization, internalization, and degradation of the TNF receptor in the absence of cycloheximide.	Chloroquine	71-82	tumor necrosis factor	Homo sapiens	106-109
2829746-3	1988	During cell incubation with suppression of TNF receptor degradation by chloroquine, the number of surface TNF receptors remained approximately constants, but the total number of surface and internal TNF receptors increased gradually, at 3h reaching 1.5 times of the initial number, thus suggesting continuous synthesis, externalization, internalization, and degradation of the TNF receptor in the absence of cycloheximide.	Chloroquine	71-82	tumor necrosis factor	Homo sapiens	106-109
3258311-1	1988	Lysosomotropic amines, such as chloroquine and methylamine, increase the intracellular accumulation of 125I-EGF by inhibiting lysosomal degradation.	Chloroquine	31-42	epidermal growth factor	Mus musculus	108-111
3258311-2	1988	It has been shown previously that BALB/c-3T3 cells, prelabeled at 4 degrees C with 125I-EGF for 3 h and subsequently chased at 37 degrees C in the presence of chloroquine, internalized the surface bound 125I-EGF which was subsequently released into the extracellular medium in a high molecular weight form which co-migrated with native 125I-EGF.	Chloroquine	159-170	epidermal growth factor	Mus musculus	208-211
3258311-2	1988	It has been shown previously that BALB/c-3T3 cells, prelabeled at 4 degrees C with 125I-EGF for 3 h and subsequently chased at 37 degrees C in the presence of chloroquine, internalized the surface bound 125I-EGF which was subsequently released into the extracellular medium in a high molecular weight form which co-migrated with native 125I-EGF.	Chloroquine	159-170	epidermal growth factor	Mus musculus	208-211
3258311-4	1988	We now show that when the BALB/c-3T3 cells were prelabeled at 37 degrees C for 2 h in the presence of chloroquine, the internalized 125I-EGF released into the medium was in a high molecular weight form which co-migrated with native 125I-EGF and did not rebind anymore efficiently than did peptide in the extracellular media.	Chloroquine	102-113	epidermal growth factor	Mus musculus	137-140
3258311-6	1988	The inhibition of rebinding was observed only when the cells were treated with EGF in the presence of chloroquine, and was not due to a general down-regulation of membrane receptors.	Chloroquine	102-113	epidermal growth factor	Mus musculus	79-82
2449493-3	1988	In contrast to most protein Ag, fibrinogen (Mr 340,000) did not need to be processed by an APC, inasmuch as intact fibrinogen was presented by both pre-fixed and chloroquine-treated macrophages.	Chloroquine	162-173	fibrinogen beta chain	Homo sapiens	115-125
3291555-1	1988	Dinitrophenol (DNP), an inhibitor of endocytosis of hormone receptors, Tris, an inhibitor of recycling and chloroquine, an inhibitor of lysosomal degradation, all decreased the binding of insulin and inhibited the development of hormonal imprinting in Tetrahymena.	Chloroquine	107-118	insulin	Homo sapiens	188-195
3291555-3	1988	The effect of chloroquine proved to be somewhat different, it appeared later, was more pronounced after 24 hours and more marked when insulin was also administered.	Chloroquine	14-25	insulin	Homo sapiens	134-141
2845878-2	1988	Out of the 11 glycolytic enzymes assayed, phosphoglycerate kinase and pyruvate decarboxylase have been found to be most sensitive to chloroquine.	Chloroquine	133-144	phosphoglycerate kinase	Saccharomyces cerevisiae S288C	42-65
2845878-4	1988	Kinetic studies with the three kinases studied revealed competitive inhibition of chloroquine with ATP (hexokinase, phosphoglycerate kinase) or ADP (pyruvate kinase).	Chloroquine	82-93	hexokinase	Saccharomyces cerevisiae S288C	104-114
2845878-4	1988	Kinetic studies with the three kinases studied revealed competitive inhibition of chloroquine with ATP (hexokinase, phosphoglycerate kinase) or ADP (pyruvate kinase).	Chloroquine	82-93	phosphoglycerate kinase	Saccharomyces cerevisiae S288C	116-139
3277320-5	1988	The results indicate that chloroquine selectively elutes HLA antigens and their noncovalently associated beta 2-M without affecting other integral platelet membrane proteins.	Chloroquine	26-37	beta-2-microglobulin	Homo sapiens	105-113
2961736-0	1987	Insulin induces chloroquine-sensitive recycling of insulin-like growth factor II receptors but not of glucose transporters in rat adipocytes.	Chloroquine	16-27	insulin-like growth factor 2	Rattus norvegicus	51-80
2961736-1	1987	Incubation of insulin-treated rat adipocytes with chloroquine, in a time- and concentration-dependent manner, was observed to inhibit the insulin-stimulated increase in insulin-like growth factor II (IGF-II) binding activity, whereas no significant change in IGF-II binding was observed in the absence of insulin.	Chloroquine	50-61	insulin-like growth factor 2	Rattus norvegicus	169-206
2961736-1	1987	Incubation of insulin-treated rat adipocytes with chloroquine, in a time- and concentration-dependent manner, was observed to inhibit the insulin-stimulated increase in insulin-like growth factor II (IGF-II) binding activity, whereas no significant change in IGF-II binding was observed in the absence of insulin.	Chloroquine	50-61	insulin-like growth factor 2	Rattus norvegicus	200-206
2961736-2	1987	The incremental increase of insulin-stimulated IGF-II binding was inhibited 50% by 0.2 mM chloroquine within 15 min and was nearly completely abolished by 60 min.	Chloroquine	90-101	insulin-like growth factor 2	Rattus norvegicus	47-53
2961736-4	1987	Scatchard analysis of IGF-II binding as well as the specific binding of an anti-IGF-II receptor antibody demonstrated that the loss of IGF-II binding in the insulin-stimulated chloroquine-treated adipocytes was due to a decrease in the number of cell-surface IGF-II receptors, whereas the total number of cellular IGF-II receptors was unaltered.	Chloroquine	176-187	insulin-like growth factor 2	Rattus norvegicus	80-86
2961736-4	1987	Scatchard analysis of IGF-II binding as well as the specific binding of an anti-IGF-II receptor antibody demonstrated that the loss of IGF-II binding in the insulin-stimulated chloroquine-treated adipocytes was due to a decrease in the number of cell-surface IGF-II receptors, whereas the total number of cellular IGF-II receptors was unaltered.	Chloroquine	176-187	insulin-like growth factor 2	Rattus norvegicus	80-86
2961736-4	1987	Scatchard analysis of IGF-II binding as well as the specific binding of an anti-IGF-II receptor antibody demonstrated that the loss of IGF-II binding in the insulin-stimulated chloroquine-treated adipocytes was due to a decrease in the number of cell-surface IGF-II receptors, whereas the total number of cellular IGF-II receptors was unaltered.	Chloroquine	176-187	insulin-like growth factor 2	Rattus norvegicus	80-86
2961736-4	1987	Scatchard analysis of IGF-II binding as well as the specific binding of an anti-IGF-II receptor antibody demonstrated that the loss of IGF-II binding in the insulin-stimulated chloroquine-treated adipocytes was due to a decrease in the number of cell-surface IGF-II receptors, whereas the total number of cellular IGF-II receptors was unaltered.	Chloroquine	176-187	insulin-like growth factor 2	Rattus norvegicus	80-86
3315005-12	1987	Parasitized mice treated with chloroquine six hours prior to ESR measurements show less nitroxide reducing capacity than do untreated mice.	Chloroquine	30-41	esterase 5 regulator	Mus musculus	61-64
2960325-0	1987	Inhibition of calmodulin stimulation of phosphodiesterase and Ca2+, Mg2+-ATPase activities and shape change of erythrocyte ghosts by chloroquine.	Chloroquine	133-144	calmodulin 1	Homo sapiens	14-24
3693398-10	1987	The proteolytic maturation of gp 80 is blocked in the presence of chloroquine and its secretion is retarded.	Chloroquine	66-77	clusterin	Canis lupus familiaris	30-35
3120732-6	1987	Chloroquine, a drug accumulating within lysosomes and acidic endosomes, decreases the uptake of 3H-astemizole by hepatocytes and induces, during isopycnic centrifugation of a particulate fraction, a shift of the 3H-label towards lower densities where it closely accompanies cathepsin B.	Chloroquine	0-11	cathepsin B	Rattus norvegicus	274-285
3448610-7	1987	The phospholipase A2 inhibitor, chloroquine, decreased both the amount of exudate and moderately the concentration of LTC4 im.	Chloroquine	32-43	phospholipase A2 group IB	Rattus norvegicus	4-20
3427027-7	1987	Statistical mechanical modeling of the chloroquine gel analysis demonstrated that the average free energy of propagation for the mutant sequence (0.7-0.9 kcal mol-1 bp-1) was approximately twice that for d(CG)n sequences and that the sequence d(GACGCGGGGCGCGTGCATATGCGTGG) forms the core Z-DNA region.	Chloroquine	39-50	modifier of LPS-response 1	Mus musculus	159-169
2960325-2	1987	It was found that the CaM activation of rat brain phosphodiesterase was abolished by the addition of chloroquine.	Chloroquine	101-112	calmodulin 1	Rattus norvegicus	22-25
2960325-7	1987	They were converted to the invaginated form by the addition of chloroquine in the concentration range of 1 X 10(-4)-5 X 10(-4)M. This concentration is similar to that which caused the inhibition of CaM activation of Ca2+, Mg2+-ATPase.	Chloroquine	63-74	calmodulin 1	Homo sapiens	198-201
3476497-7	1987	Colchicine and vinblastine inhibited cumulative biliary excretion of label by 28 and 37%, respectively; chloroquine and leupeptin each increased the amount of label in bile that was precipitable by trichloracetic acid and that coeluted with authentic 125I-TGF beta on molecular sieve chromatography.	Chloroquine	104-115	transforming growth factor, beta 1	Rattus norvegicus	256-264
3425960-0	1987	Effect of chronic chloroquine treatment on prostaglandin and human chorionic gonadotropin (hCG) stimulation of testosterone secretion by the rat testis.	Chloroquine	18-29	chorionic gonadotropin subunit beta 5	Homo sapiens	91-94
2820530-9	1987	Intracellular transport and proteolytic maturation of MPO was retarded by weak bases (NH4Cl, chloroquine) or monensin at concentrations shown to raise intralysosomal pH.	Chloroquine	93-104	myeloperoxidase	Homo sapiens	54-57
3500594-5	1987	Of the disease modifying agents tested, levamisole was ineffective while the antimalarials, chloroquine (100 microM) and hydroxychloroquine (100 microM), inhibited the action of IL-1.	Chloroquine	92-103	interleukin 1 alpha	Homo sapiens	178-182
3038881-8	1987	The ionophore monensin and the base chloroquine, which block processing of myeloperoxidase, did not affect the incorporation of 5-amino[14C]levulinic acid, further supporting the notion that the incorporation of heme is independent of final processing of the polypeptide.	Chloroquine	36-47	myeloperoxidase	Homo sapiens	75-90
3294861-3	1987	Cleavage of mSC in cultured hepatocytes is inhibited by the thiol protease inhibitors leupeptin, antipain, and E-64, but not by other inhibitors, including disopropylfluorophosphate, pepstatin, N-ethylmalemide, p-chloromercuribenzoic acid, and chloroquine.	Chloroquine	244-255	musculin	Mus musculus	12-15
3300834-4	1987	However, chloroquine had less impact on haemoglobin, ESR, rheumatoid factor levels and C-reactive protein than the other treatments.	Chloroquine	9-20	C-reactive protein	Homo sapiens	87-105
3311030-7	1987	Formation of betagranin and insulin from their respective precursors followed a parallel course and could likewise be inhibited by NH4+, chloroquine and monensin, added either before labelling or at any point of time up to 15 min after labelling.	Chloroquine	137-148	insulin	Homo sapiens	28-35
3040410-1	1987	The weak bases chloroquine, primaquine, NH4Cl and the ionophore monensin exert similar but not identical effects on sorting, transport and processing of cathepsin D in several human cell lines (fibroblasts, HepG2 cells, U937, monocytes).	Chloroquine	15-26	cathepsin D	Homo sapiens	153-164
2823097-8	1987	Phospholipase A2 activity was inhibited in a dose-dependent fashion (1-8 mg/assay) by all three drugs in the order: chlorpromazine greater than amiodarone greater than chloroquine.	Chloroquine	168-179	phospholipase A2 group IB	Homo sapiens	0-16
3497828-6	1987	Lysis of YAC-1 cells was also inhibited by colchicine and chloroquine.	Chloroquine	58-69	ADP-ribosyltransferase 1	Mus musculus	9-14
3580252-6	1987	Peak plasma chloroquine concentrations in the children with kwashiorkor varied from 9 ng ml-1 to 95 ng ml-1 (mean 40 +/- 34 ng ml-1).	Chloroquine	12-23	interleukin 17F	Homo sapiens	89-93
3580252-6	1987	Peak plasma chloroquine concentrations in the children with kwashiorkor varied from 9 ng ml-1 to 95 ng ml-1 (mean 40 +/- 34 ng ml-1).	Chloroquine	12-23	interleukin 17F	Homo sapiens	103-107
3580252-6	1987	Peak plasma chloroquine concentrations in the children with kwashiorkor varied from 9 ng ml-1 to 95 ng ml-1 (mean 40 +/- 34 ng ml-1).	Chloroquine	12-23	interleukin 17F	Homo sapiens	103-107
3580252-7	1987	Peak chloroquine concentrations in the controls varied between 69 ng ml-1 and 330 ng ml-1 (mean 134 +/- 99 ng ml-1).	Chloroquine	5-16	interleukin 17F	Homo sapiens	69-73
3580252-7	1987	Peak chloroquine concentrations in the controls varied between 69 ng ml-1 and 330 ng ml-1 (mean 134 +/- 99 ng ml-1).	Chloroquine	5-16	interleukin 17F	Homo sapiens	85-89
3580252-7	1987	Peak chloroquine concentrations in the controls varied between 69 ng ml-1 and 330 ng ml-1 (mean 134 +/- 99 ng ml-1).	Chloroquine	5-16	interleukin 17F	Homo sapiens	85-89
3610218-4	1987	MTX enters by its own carrier mechanism, while MTX-MoAb conjugates enter by endocytosis with release of MTX at the lysosomal membrane, demonstrated by the ability of chloroquine and NH4Cl (which inhibit lysosomal function) to inhibit the action of MTX-MoAb but not MTX.	Chloroquine	166-177	metaxin 1	Homo sapiens	47-50
3610218-4	1987	MTX enters by its own carrier mechanism, while MTX-MoAb conjugates enter by endocytosis with release of MTX at the lysosomal membrane, demonstrated by the ability of chloroquine and NH4Cl (which inhibit lysosomal function) to inhibit the action of MTX-MoAb but not MTX.	Chloroquine	166-177	metaxin 1	Homo sapiens	47-50
3610218-4	1987	MTX enters by its own carrier mechanism, while MTX-MoAb conjugates enter by endocytosis with release of MTX at the lysosomal membrane, demonstrated by the ability of chloroquine and NH4Cl (which inhibit lysosomal function) to inhibit the action of MTX-MoAb but not MTX.	Chloroquine	166-177	metaxin 1	Homo sapiens	47-50
3610218-4	1987	MTX enters by its own carrier mechanism, while MTX-MoAb conjugates enter by endocytosis with release of MTX at the lysosomal membrane, demonstrated by the ability of chloroquine and NH4Cl (which inhibit lysosomal function) to inhibit the action of MTX-MoAb but not MTX.	Chloroquine	166-177	metaxin 1	Homo sapiens	47-50
3103729-0	1987	Effect of chloroquine on insulin and glucose homoeostasis in normal subjects and patients with non-insulin-dependent diabetes mellitus.	Chloroquine	10-21	insulin	Homo sapiens	25-32
3564839-1	1987	The transformation of prolactin (PRL) within lactating rat hemipituitary glands incubated for 240 min and the release of the hormone into the incubation medium were progressively reduced by dopamine added to the medium over a 2.3-49 mumol/l range of concentration; the antilysosomal drug chloroquine did not alter these effects of dopamine.	Chloroquine	288-299	prolactin	Rattus norvegicus	22-31
3564839-1	1987	The transformation of prolactin (PRL) within lactating rat hemipituitary glands incubated for 240 min and the release of the hormone into the incubation medium were progressively reduced by dopamine added to the medium over a 2.3-49 mumol/l range of concentration; the antilysosomal drug chloroquine did not alter these effects of dopamine.	Chloroquine	288-299	prolactin	Rattus norvegicus	33-36
2434485-4	1987	Inhibitors of receptor recycling, chloroquine, monensin, and colchicine, inhibited uptake of apoA-I from HDL by Hep G-2 human hepatoma cells to about the same extent as a reference protein, asialofetuin, but inhibited uptake of the cholesteryl ether tracer much less.	Chloroquine	34-45	apolipoprotein A1	Homo sapiens	93-99
3029115-7	1987	HDL cholesteryl ester entering the cell under the influence of CETP was largely degraded to free cholesterol by a process inhibitable by chloroquine.	Chloroquine	137-148	cholesteryl ester transfer protein	Homo sapiens	63-67
2949857-4	1987	Conjugate formation was inhibited almost completely by treating the TNP-MABC with concentrations of chloroquine that only partially inhibited the ability of the TNP-ABC to form conjugates.	Chloroquine	100-111	ATP binding cassette subfamily B member 6 (Langereis blood group)	Homo sapiens	73-76
3539675-9	1987	Chloroquine also increased cell-associated insulin and slightly decreased the percentage of trichloroacetic acid-soluble products.	Chloroquine	0-11	insulin	Gallus gallus	43-50
3316242-6	1987	The loss in EGF binding after long incubation at 37 degrees C was prevented by the lysosomal inhibitory agent, chloroquine.	Chloroquine	111-122	epidermal growth factor	Homo sapiens	12-15
3539675-0	1987	Modulation of insulin action on 2-deoxyglucose uptake by chloroquine in chick embryo fibroblasts.	Chloroquine	57-68	insulin	Gallus gallus	14-21
3539675-2	1987	recently found that chloroquine therapy decreased intravenous insulin requirements in a case of extreme insulin resistance.	Chloroquine	20-31	insulin	Gallus gallus	62-69
3539675-2	1987	recently found that chloroquine therapy decreased intravenous insulin requirements in a case of extreme insulin resistance.	Chloroquine	20-31	insulin	Gallus gallus	104-111
3539675-7	1987	Chloroquine increased insulin-stimulated uptake of 2-deoxyglucose and alpha-aminoisobutyrate.	Chloroquine	0-11	insulin	Gallus gallus	22-29
3497888-1	1987	Effect of pyrimethamine, an antimalarial antifolate, and of mefloquine, chloroquine, and quinine, which belong to the quinoline group of antimalarials, on proliferation and interleukin 2 (IL-2) production of human lymphocytes was studied in vitro.	Chloroquine	72-83	interleukin 2	Homo sapiens	173-186
3303019-0	1987	In vitro growth and chloroquine sensitivity of Plasmodium falciparum (FCR-3 strain) in red blood cells containing HbC.	Chloroquine	20-31	keratin 88, pseudogene	Homo sapiens	114-117
3823005-3	1987	Both control fibroblasts and amniocytes incorporated labelled B12 into TC2-B12, and the proportion of labelled TC2-B12 could be increased by growing cells in the presence of chloroquine which prevents intralysosomal hydrolysis of the TC2-B12 complex.	Chloroquine	174-185	transcobalamin 2	Homo sapiens	71-74
3823005-3	1987	Both control fibroblasts and amniocytes incorporated labelled B12 into TC2-B12, and the proportion of labelled TC2-B12 could be increased by growing cells in the presence of chloroquine which prevents intralysosomal hydrolysis of the TC2-B12 complex.	Chloroquine	174-185	transcobalamin 2	Homo sapiens	111-114
3823005-3	1987	Both control fibroblasts and amniocytes incorporated labelled B12 into TC2-B12, and the proportion of labelled TC2-B12 could be increased by growing cells in the presence of chloroquine which prevents intralysosomal hydrolysis of the TC2-B12 complex.	Chloroquine	174-185	transcobalamin 2	Homo sapiens	111-114
3551268-2	1987	The number of amines (dansylcadaverine, chloroquine, cystamine, 5-methoxytryptamine) dimethylurea and monensin were shown to block the mitogenic effect of EGF.	Chloroquine	40-51	epidermal growth factor	Mus musculus	155-158
3551268-4	1987	The level of EGF degradation was reduced only by chloroquine.	Chloroquine	49-60	epidermal growth factor	Mus musculus	13-16
3533517-5	1986	Similarly, chloroquine and monensin increased the amount of [125I]IGF-I associated with aortic endothelial cells from 4.3 +/- 0.2% to 5.5 +/- 0.3% and 6.2 +/- 0.7%/mg protein, respectively.	Chloroquine	11-22	insulin-like growth factor 1	Rattus norvegicus	66-71
3493770-2	1986	Weakly basic amines such as methylamine, chloroquine and NH4Cl strongly inhibited not only protein secretion, but also the proteolytic conversion of a proform of complement C3, allowing the precursor to be released into the medium.	Chloroquine	41-52	complement C3	Rattus norvegicus	162-175
3533517-6	1986	Chloroquine and monensin increased [125I]insulin associated with rat capillary endothelial cells from a control of 2.9 +/- 0.1% to 4.0 +/- 0.2% and 3.8% +/- 0.37%, respectively.	Chloroquine	0-11	insulin	Bos taurus	41-48
3534451-4	1986	Chloroquine increased total cell-associated insulin in all cells except H4IIEC3 hepatoma cells.	Chloroquine	0-11	insulin	Homo sapiens	44-51
3534451-9	1986	Chloroquine increased insulin accumulation in all cell types except H411EC3 hepatoma cells.	Chloroquine	0-11	insulin	Homo sapiens	22-29
2944781-8	1986	Chloroquine and monensin, which act at the lysosomes and at other sites, increased both cell-associated IGF II and insulin and decreased the degradation of both hormones.	Chloroquine	0-11	insulin like growth factor 2	Bos taurus	104-110
2944781-8	1986	Chloroquine and monensin, which act at the lysosomes and at other sites, increased both cell-associated IGF II and insulin and decreased the degradation of both hormones.	Chloroquine	0-11	insulin	Bos taurus	115-122
2944781-9	1986	The increases in cell-associated 125I-IGF II produced by chloroquine (42.0 +/- 7.4%) and monensin (78.3 +/- 8.5%) were quantitatively similar to the decreases in IGF II degradation caused by the agents; however, the increase in cell-associated insulin was approximately threefold greater than could be accounted for simply by decreased insulin degradation.	Chloroquine	57-68	insulin like growth factor 2	Bos taurus	38-44
3491718-0	1986	[The therapeutic effect of cysteine proteinase inhibitor, EST, on experimental chloroquine myopathy].	Chloroquine	79-90	cystatin SA	Homo sapiens	27-56
3093192-6	1986	Pretreatment of cells with the lysosomotropic agent chloroquine (1 X 10(-5) M) overrode dopamine inhibition of PRL plaque development, but did not influence oPRL inhibition.	Chloroquine	52-63	prolactin	Rattus norvegicus	111-114
3732160-7	1986	Uptake of radiolabeled thyroglobulin from the colloid was also inhibited by chloroquine, which caused a block in the lysosomal degradation of this protein but did not affect its synthesis.	Chloroquine	76-87	thyroglobulin	Bos taurus	23-36
3760908-2	1986	Chloroquine treatment caused a large (59-101%) increase in the activity of cathepsin D in both innervated and denervated muscle.	Chloroquine	0-11	cathepsin D	Mus musculus	75-86
2874147-4	1986	The lysosomotropic bases chloroquine, methylamine, and ammonium and the carboxylic ionophore monensin inhibit the degradation and release of 125I-TGF beta from the cells.	Chloroquine	25-36	transforming growth factor, beta 1	Mus musculus	146-154
2426278-11	1986	The results demonstrate the following: (a) the receptor kinase domain migrates to the perinuclear region upon challenge with EGF; (b) both extracellular and cytoplasmic domains of the receptor are involved in migration as a unit; (c) withdrawal of EGF results in rapid recycling of the perinuclear receptors to the plasma membrane; (d) this return to the cell surface is inhibited by methylamine, chloroquine, and monensin; and (e) neither the internal migration nor the recycling process is blocked by inhibitors of protein biosynthesis.	Chloroquine	397-408	epidermal growth factor	Homo sapiens	125-128
2426278-11	1986	The results demonstrate the following: (a) the receptor kinase domain migrates to the perinuclear region upon challenge with EGF; (b) both extracellular and cytoplasmic domains of the receptor are involved in migration as a unit; (c) withdrawal of EGF results in rapid recycling of the perinuclear receptors to the plasma membrane; (d) this return to the cell surface is inhibited by methylamine, chloroquine, and monensin; and (e) neither the internal migration nor the recycling process is blocked by inhibitors of protein biosynthesis.	Chloroquine	397-408	epidermal growth factor	Homo sapiens	248-251
3513607-1	1986	The chloroquine-sensitive and chloroquine-insensitive steps in insulin degradation by cultured hepatocytes have been explored by employing low temperature to retard processing.	Chloroquine	4-15	insulin	Homo sapiens	63-70
3541897-12	1986	In the presence of chloroquine, which dramatically increased the contribution of peak I to specific binding, "intact" insulin was substantially overestimated when determined as the TCA-precipitable fraction.	Chloroquine	19-30	insulin	Homo sapiens	118-125
3769242-3	1986	In all chloroquine-treated patients spontaneous and IFN-induced NK activities were decreased, as compared with healthy controls or RA patients, not treated with chloroquine.	Chloroquine	7-18	interferon alpha 1	Homo sapiens	52-55
3014262-7	1986	Chloroquine inhibits the degradation and increases 125I-HDL3 uptake.	Chloroquine	0-11	HDL3	Homo sapiens	56-60
3758333-1	1986	Intraperitoneal administration of chloroquine (50 mg/kg, 7 days) to rats was followed by the increase of cholesterol, its esters, triglycerides and phospholipids levels in tissues, the decrease of lysosomal cholesterol esterase and acyl-koA-cholesterol acyl transferase activity in the liver and the enhancement of the non-sedimentable activity of acid phosphatase and beta-galactosidase.	Chloroquine	34-45	carboxyl ester lipase	Rattus norvegicus	207-227
3758333-1	1986	Intraperitoneal administration of chloroquine (50 mg/kg, 7 days) to rats was followed by the increase of cholesterol, its esters, triglycerides and phospholipids levels in tissues, the decrease of lysosomal cholesterol esterase and acyl-koA-cholesterol acyl transferase activity in the liver and the enhancement of the non-sedimentable activity of acid phosphatase and beta-galactosidase.	Chloroquine	34-45	galactosidase, beta 1	Rattus norvegicus	369-387
3015056-7	1986	During treatment with chloroquine or penicillamine serum osteocalcin increased significantly, concomitant with a reduction of the acute phase reactants.	Chloroquine	22-33	bone gamma-carboxyglutamate protein	Homo sapiens	57-68
3539101-4	1986	The phorbol-ester-induced enhancement of internalized insulin in HepG2 cells was additive with the potentiation of endocytosed insulin induced by both the lysosomotropic reagent chloroquine and the ionophore monensin; this indicates that TPA affects the intracellular processing of the insulin receptor at a point other than those disrupted by either of these two reagents.	Chloroquine	178-189	insulin	Homo sapiens	127-134
3086252-9	1986	Aurothioglucose, auranofin, and chloroquine, members of the class of disease-modifying antirheumatic drugs, had a general tendency to exacerbate disease, but had minimal effect on serum haptoglobin.	Chloroquine	32-43	haptoglobin	Rattus norvegicus	186-197
3703715-4	1986	Chloroquine, about as effective in PCT, can cause acute toxic reactions at the beginning of its administration.	Chloroquine	0-11	calcitonin related polypeptide alpha	Homo sapiens	35-38
3512551-4	1986	The acidtropic agents chloroquine and dibucaine, which have been reported to inhibit the recycling of various receptors, were utilized to study the detailed translocation mechanism of the glucose transporter and the insulin receptor.	Chloroquine	22-33	insulin receptor	Rattus norvegicus	216-232
3513607-2	1986	Under standard conditions (90 min association and 60 min dissociation) chloroquine inhibited insulin degradation at 15 degrees C but not at 37 degrees C. However, if the association and dissociation periods were short so that only early degradation was examined, marked inhibition of insulin degradation by chloroquine could also be observed at 37 degrees C. This inhibitory effect was observed only during the first 15 min, being masked by increased insulin degradation subsequently.	Chloroquine	71-82	insulin	Homo sapiens	93-100
3513607-2	1986	Under standard conditions (90 min association and 60 min dissociation) chloroquine inhibited insulin degradation at 15 degrees C but not at 37 degrees C. However, if the association and dissociation periods were short so that only early degradation was examined, marked inhibition of insulin degradation by chloroquine could also be observed at 37 degrees C. This inhibitory effect was observed only during the first 15 min, being masked by increased insulin degradation subsequently.	Chloroquine	71-82	insulin	Homo sapiens	284-291
3513607-2	1986	Under standard conditions (90 min association and 60 min dissociation) chloroquine inhibited insulin degradation at 15 degrees C but not at 37 degrees C. However, if the association and dissociation periods were short so that only early degradation was examined, marked inhibition of insulin degradation by chloroquine could also be observed at 37 degrees C. This inhibitory effect was observed only during the first 15 min, being masked by increased insulin degradation subsequently.	Chloroquine	71-82	insulin	Homo sapiens	284-291
3513607-3	1986	An increase in slowly dissociable insulin, as well as a twofold increase in volume density of multivesicular bodies (MVB), occurred in the presence of chloroquine at both 37 and 15 degrees C. Rapid insulin processing from the slowly dissociable compartment at 37 degrees C masked chloroquine"s effect on insulin processing under usual conditions at that temperature.	Chloroquine	151-162	insulin	Homo sapiens	34-41
3513607-3	1986	An increase in slowly dissociable insulin, as well as a twofold increase in volume density of multivesicular bodies (MVB), occurred in the presence of chloroquine at both 37 and 15 degrees C. Rapid insulin processing from the slowly dissociable compartment at 37 degrees C masked chloroquine"s effect on insulin processing under usual conditions at that temperature.	Chloroquine	151-162	insulin	Homo sapiens	198-205
3513607-3	1986	An increase in slowly dissociable insulin, as well as a twofold increase in volume density of multivesicular bodies (MVB), occurred in the presence of chloroquine at both 37 and 15 degrees C. Rapid insulin processing from the slowly dissociable compartment at 37 degrees C masked chloroquine"s effect on insulin processing under usual conditions at that temperature.	Chloroquine	151-162	insulin	Homo sapiens	198-205
3513607-3	1986	An increase in slowly dissociable insulin, as well as a twofold increase in volume density of multivesicular bodies (MVB), occurred in the presence of chloroquine at both 37 and 15 degrees C. Rapid insulin processing from the slowly dissociable compartment at 37 degrees C masked chloroquine"s effect on insulin processing under usual conditions at that temperature.	Chloroquine	280-291	insulin	Homo sapiens	198-205
3513607-3	1986	An increase in slowly dissociable insulin, as well as a twofold increase in volume density of multivesicular bodies (MVB), occurred in the presence of chloroquine at both 37 and 15 degrees C. Rapid insulin processing from the slowly dissociable compartment at 37 degrees C masked chloroquine"s effect on insulin processing under usual conditions at that temperature.	Chloroquine	280-291	insulin	Homo sapiens	198-205
3510921-4	1986	In the presence of chloroquine, the acanthotic subject"s fibroblasts internalized more insulin per available receptor compared with the normal cell line, suggesting an accelerated rate of insulin internalization.	Chloroquine	19-30	insulin	Homo sapiens	87-94
3002757-9	1986	Chloroquine also potentiated PTH-induced down-regulation of PTH receptors.	Chloroquine	0-11	parathyroid hormone	Bos taurus	29-32
3002757-9	1986	Chloroquine also potentiated PTH-induced down-regulation of PTH receptors.	Chloroquine	0-11	parathyroid hormone	Bos taurus	60-63
3510921-4	1986	In the presence of chloroquine, the acanthotic subject"s fibroblasts internalized more insulin per available receptor compared with the normal cell line, suggesting an accelerated rate of insulin internalization.	Chloroquine	19-30	insulin	Homo sapiens	188-195
3096571-5	1986	Vitellogenin endocytosis is also impaired by the addition of the primary amines methylamine or chloroquine to the culture medium.	Chloroquine	95-106	Yolk protein 1	Drosophila melanogaster	0-12
3510222-8	1986	The lysosomotropic agent chloroquine increased total cell-associated insulin, and this was due entirely to an increase in intracellular insulin.	Chloroquine	25-36	insulin	Homo sapiens	69-76
3510222-8	1986	The lysosomotropic agent chloroquine increased total cell-associated insulin, and this was due entirely to an increase in intracellular insulin.	Chloroquine	25-36	insulin	Homo sapiens	136-143
3510222-9	1986	In adipocytes from normal subjects, chloroquine increased intracellular insulin by 32% at 30 min, by 89% at 60 min, by 140% at 90 min, and by 178% at 120 min.	Chloroquine	36-47	insulin	Homo sapiens	72-79
3510222-10	1986	In comparison to the normal adipocytes, the chloroquine-mediated increase in intracellular insulin was lower in adipocytes from the diabetic subjects (-8.1% at 30 min, 37% at 60 min, 58% at 90 min, and 63% at 120 min; P less than 0.05 at all time points).	Chloroquine	44-55	insulin	Homo sapiens	91-98
3510222-11	1986	These results indicate that insulin is rapidly internalized in human adipocytes at 37 C such that approximately half of total cell-associated insulin is intracellular the intracellular insulin is largely intact; and intracellular processing of insulin by a chloroquine-sensitive pathway(s) is impaired in adipocytes from type II diabetic subjects.	Chloroquine	257-268	insulin	Homo sapiens	28-35
3943149-6	1986	It is concluded that the initial stages of iron transfer to the fetus involve the internalization of maternal iron-saturated transferrin bound to membrane receptors by receptor-mediated endocytosis, which can be inhibited by the drug chloroquine.	Chloroquine	234-245	transferrin	Homo sapiens	125-136
4054529-0	1985	Intrinsic factor-cobalamin accumulates in the ilea of mice treated with chloroquine.	Chloroquine	72-83	cobalamin binding intrinsic factor	Mus musculus	0-16
4084293-4	1985	On the other hand chloroquine (100 microM), a lysosomotropic agent that interferes with the intracellular degradation of the insulin receptor (n = 8) increased two-fold the 125I-insulin specifically bound to the intact and trypsin resistant part of the cells (p less than 0.05).	Chloroquine	18-29	insulin receptor	Oryctolagus cuniculus	125-141
4084293-4	1985	On the other hand chloroquine (100 microM), a lysosomotropic agent that interferes with the intracellular degradation of the insulin receptor (n = 8) increased two-fold the 125I-insulin specifically bound to the intact and trypsin resistant part of the cells (p less than 0.05).	Chloroquine	18-29	insulin	Oryctolagus cuniculus	125-132
4092697-3	1985	Chloroquine (CQ) intercalation also results in the selective liberation of HMG 14 and HMG 17, but, in addition, selectively releases other nuclear proteins (including histone H1A) in a pH- and ionic strength-dependent fashion.	Chloroquine	0-11	high mobility group nucleosome binding domain 1	Gallus gallus	75-81
4092697-3	1985	Chloroquine (CQ) intercalation also results in the selective liberation of HMG 14 and HMG 17, but, in addition, selectively releases other nuclear proteins (including histone H1A) in a pH- and ionic strength-dependent fashion.	Chloroquine	0-11	high mobility group nucleosomal binding domain 4	Gallus gallus	86-92
4092697-3	1985	Chloroquine (CQ) intercalation also results in the selective liberation of HMG 14 and HMG 17, but, in addition, selectively releases other nuclear proteins (including histone H1A) in a pH- and ionic strength-dependent fashion.	Chloroquine	13-15	high mobility group nucleosome binding domain 1	Gallus gallus	75-81
4092697-3	1985	Chloroquine (CQ) intercalation also results in the selective liberation of HMG 14 and HMG 17, but, in addition, selectively releases other nuclear proteins (including histone H1A) in a pH- and ionic strength-dependent fashion.	Chloroquine	13-15	high mobility group nucleosomal binding domain 4	Gallus gallus	86-92
4054529-5	1985	In chloroquine-treated mice, the major radioactive protein peak 2-4 h after an oral dose corresponded with the position of intrinsic factor.	Chloroquine	3-14	cobalamin binding intrinsic factor	Mus musculus	123-139
4054529-8	1985	It is concluded that chloroquine interferes with the release of cobalamin from intrinsic factor and thus slows the release of cobalamin from the intestine.	Chloroquine	21-32	cobalamin binding intrinsic factor	Mus musculus	79-95
3902825-0	1985	The effects of cycloheximide and chloroquine on insulin receptor metabolism.	Chloroquine	33-44	insulin receptor	Homo sapiens	48-64
3910030-11	1985	The inhibitory effect of chloroquine on the deactivation may indicate that the insulin-receptor complex can function even after internalization.	Chloroquine	25-36	insulin receptor	Rattus norvegicus	79-95
3902825-2	1985	The effects of protein synthesis inhibitors and the lysosomotropic agent chloroquine on the metabolism of the insulin receptor were examined.	Chloroquine	73-84	insulin receptor	Homo sapiens	110-126
3902825-9	1985	Chloroquine inhibited the receptor-mediated degradation of insulin, but had no effect on either the internalization or inactivation of the insulin receptor.	Chloroquine	0-11	insulin	Homo sapiens	59-66
3902825-10	1985	The insulin-induced recycling of the internalized receptor was inhibited by chloroquine, possibly through the inhibition of the discharge of insulin from the insulin-receptor complex.	Chloroquine	76-87	insulin	Homo sapiens	4-11
3902825-10	1985	The insulin-induced recycling of the internalized receptor was inhibited by chloroquine, possibly through the inhibition of the discharge of insulin from the insulin-receptor complex.	Chloroquine	76-87	insulin	Homo sapiens	141-148
3902825-10	1985	The insulin-induced recycling of the internalized receptor was inhibited by chloroquine, possibly through the inhibition of the discharge of insulin from the insulin-receptor complex.	Chloroquine	76-87	insulin	Homo sapiens	141-148
3902474-3	1985	However, in the presence of chloroquine the conversion to serum albumin was inhibited and proalbumin per se was released into medium.	Chloroquine	28-39	albumin	Rattus norvegicus	64-71
4084534-1	1985	Cationic amphiphilic drugs like chlorpromazine, propranolol, and chloroquine inhibit lysosomal phospholipase A in vitro.	Chloroquine	65-76	phospholipase A and acyltransferase 1	Rattus norvegicus	95-110
3902819-8	1985	Degraded insulin was then released from the cell interior within 4-5 min after endocytotic uptake, since this was the earliest time chloroquine was found to inhibit the release of degradation products.	Chloroquine	132-143	insulin	Homo sapiens	9-16
3932341-6	1985	Secondly, it was found that chloroquine profoundly inhibited the insulin degradative pathway, resulting in the intracellular accumulation of intact ligand and a reduction in the release of degraded products.	Chloroquine	28-39	insulin	Homo sapiens	65-72
3932341-8	1985	Based on the known actions of chloroquine, it appears that retroendocytosis of insulin does not involve vesicular acidification or dissociation of the insulin-receptor complex and that insulin is most likely carried to the cell exterior in the same vesicles (either receptor-bound or free) as those mediating recycling receptors.	Chloroquine	30-41	insulin	Homo sapiens	79-86
3899805-9	1985	These data suggest that the chloroquine-accumulating, high-density compartment of hepatic Golgi fractions is the site of dissociation of internalized insulin-receptor complexes before degradation of the ligand and receptor recycling.	Chloroquine	28-39	insulin receptor	Rattus norvegicus	150-166
3932341-9	1985	Interestingly, accumulation of undergraded insulin within chloroquine-treated cells did not result in the release of additional intact ligand, suggesting that once insulin enters the degradative compartment it is committed to catabolism and cannot exit the cell through the retroendocytotic pathway.	Chloroquine	58-69	insulin	Homo sapiens	43-50
3932341-9	1985	Interestingly, accumulation of undergraded insulin within chloroquine-treated cells did not result in the release of additional intact ligand, suggesting that once insulin enters the degradative compartment it is committed to catabolism and cannot exit the cell through the retroendocytotic pathway.	Chloroquine	58-69	insulin	Homo sapiens	164-171
2935397-5	1985	Here, we have examined the effects of the weak base chloroquine and the Na+-H+ ionophore monensin on endocytosis and intracellular transport of IgG-coated colloidal gold particles in cultured macrophages.	Chloroquine	52-63	immunoglobulin heavy variable V1-62	Mus musculus	144-147
2935397-8	1985	Since the main effect shared by chloroquine and monensin is to raise pH in acid compartments such as endocytic vesicles and lysosomes, the findings suggest that the transfer of IgG-coated particles into the lysosomes is a pH-dependent process.	Chloroquine	32-43	immunoglobulin heavy variable V1-62	Mus musculus	177-180
3915261-4	1985	Insulin-induced loss of receptors was blocked by chloroquine, suggesting that receptor loss is mediated by a chloroquine sensitive pathway.	Chloroquine	49-60	insulin	Homo sapiens	0-7
3915261-4	1985	Insulin-induced loss of receptors was blocked by chloroquine, suggesting that receptor loss is mediated by a chloroquine sensitive pathway.	Chloroquine	109-120	insulin	Homo sapiens	0-7
3915261-9	1985	Insulin-induced receptor loss is mediated by a chloroquine sensitive pathway, and is related to the post-binding process stimulated by vitamin K5.	Chloroquine	47-58	insulin	Homo sapiens	0-7
3863353-0	1985	Chloroquine stripping of HLA A,B antigens from red cells.	Chloroquine	0-11	major histocompatibility complex, class I, A	Homo sapiens	25-32
3898866-5	1985	Chloroquine and other lysosomotropic agents elevated the internalized insulin and reduced its degradation.	Chloroquine	0-11	insulin	Bos taurus	70-77
3909504-0	1985	Chloroquine and primary amines inhibit the internalization of antithrombin III.trypsin complex in cultured cells.	Chloroquine	0-11	serpin family C member 1	Bos taurus	62-78
3909504-3	1985	In contrast, the present study demonstrates the unique inhibitory effect of chloroquine on the internalization of 125I-AT III.trypsin complex by BCE cultures.	Chloroquine	76-87	serpin family C member 1	Bos taurus	119-125
3909504-5	1985	The various amines used in this study revealed: (1) differences in the process of cellular binding and internalization between AT III.protease complex and thrombin, although the degradation of both internalized ligands proceed in an analogous manner; and (2) the unique sensitivity to chloroquine of 125I-AT III.trypsin complex internalization by cultured cells.	Chloroquine	285-296	serpin family C member 1	Bos taurus	305-311
2413502-7	1985	It seems probable that chloroquine and mepacrine inhibit leukotriene release by inhibition of phospholipase A2 in lung.	Chloroquine	23-34	phospholipase A2 group IB	Homo sapiens	94-110
3885945-3	1985	Chloroquine inhibited conversion of A14-125I-insulin to iodotyrosine by about 75 percent and the remaining A14-125I-insulin was not susceptible to acid wash. Bacitracin, dansylcadavarine, and phenylarsine oxide, on the other hand, stimulated formation of intermediate products with concomitant inhibition of iodotyrosine formation.	Chloroquine	0-11	insulin	Homo sapiens	45-52
2580010-4	1985	In contrast, the same T cell clones were only minimally affected in their ability to respond to similarly chloroquine-treated APC expressing allogeneic MHC products.	Chloroquine	106-117	major histocompatibility complex, class I, C	Homo sapiens	152-155
2580020-2	1985	In this report, we demonstrate that antigen presentation of pigeon cytochrome c to an E kappa beta:E kappa alpha-restricted T cell hybridoma, 2C2, is inhibited by pretreatment of the antigen-presenting cells (APC) either with chloroquine or with fixation by paraformaldehyde.	Chloroquine	226-237	cytochrome c, somatic	Homo sapiens	67-79
2581580-3	1985	Of the substances tested, 10(-2) M chloroquine and 10(-5) M ACTH 1-24 were found to be the most effective inhibitors followed by 10(-5) M ACTH 1-39; parathormone, glucagon and insulin were found to be inhibitors an order of magnitude weaker than ACTH 1-24.	Chloroquine	35-46	insulin	Homo sapiens	176-183
4016141-3	1985	Each of these lipolytic enzymes could be inhibited by antimalarial drugs (chloroquine, mepacrine, primaquine) at concentrations above 1 x 10(-4) M. Inhibition of the alkaline cytosolic lysophospholipase by these drugs was noncompetitive with respect to the substrate, and the inhibitory potency increased, when the pH was raised.	Chloroquine	74-85	asparaginase	Rattus norvegicus	185-202
4005299-6	1985	Addition of lysozymal enzyme inhibitors, ammonium chloride and chloroquine, resulted in a markedly increased secretion of transcobalamin II.	Chloroquine	63-74	transcobalamin 2	Homo sapiens	122-139
3888644-8	1985	The activities of lysosomal enzymes, cathepsin B, beta-hexosaminidase, and acid phosphatase, were significantly decreased when the cells were treated with D600 and chloroquine, but not with nifedipine.	Chloroquine	164-175	cathepsin B	Homo sapiens	37-48
3888644-8	1985	The activities of lysosomal enzymes, cathepsin B, beta-hexosaminidase, and acid phosphatase, were significantly decreased when the cells were treated with D600 and chloroquine, but not with nifedipine.	Chloroquine	164-175	O-GlcNAcase	Homo sapiens	50-69
2579678-4	1985	Thus, chloroquine (100 microM) reduced both the uptake of alpha 2-macroglobulin X trypsin and its receptor-mediated degradation by about 70%.	Chloroquine	6-17	alpha-2-macroglobulin	Rattus norvegicus	58-79
3920463-4	1985	GnRHa-induced testosterone formation was completely blocked by phospholipase A2 inhibitor (chloroquin, 10(-4) M), but was potentiated by the addition of either cyclo-oxygenase inhibitor (indomethacin) or lipoxygenase inhibitor (nordihydroguaiaretic acid, NDGA).	Chloroquine	91-101	phospholipase A2 group IB	Rattus norvegicus	63-79
3884607-11	1985	From these results we conclude that: 1) insulin triggers endocytotic uptake of insulin-receptor complexes; 2) internalized receptors are then rapidly reinserted into the plasma membrane, and the receptors can traverse this recycling pathway within 6 min; 3) prolonged recycling does not normally result in measurable receptor loss, but when receptors are prevented from recycling, they become trapped intracellularly and are shunted to a chloroquine-sensitive degradative pathway; and 4) chloroquine and Tris are only partially effective inhibitors of receptor recycling.	Chloroquine	438-449	insulin	Homo sapiens	40-47
3884607-11	1985	From these results we conclude that: 1) insulin triggers endocytotic uptake of insulin-receptor complexes; 2) internalized receptors are then rapidly reinserted into the plasma membrane, and the receptors can traverse this recycling pathway within 6 min; 3) prolonged recycling does not normally result in measurable receptor loss, but when receptors are prevented from recycling, they become trapped intracellularly and are shunted to a chloroquine-sensitive degradative pathway; and 4) chloroquine and Tris are only partially effective inhibitors of receptor recycling.	Chloroquine	488-499	insulin	Homo sapiens	40-47
4046209-7	1985	Chloroquine apparently increases insulin binding to cells in vitro, and this is due to the effect of chloroquine on insulin-receptor recyclization to which lysosome contributes [16, 31, 32]; this drug inhibits the function of lysosome which digests insulin-receptor complexes and eventually insulin bound to its receptors is accumulated in intracellular compartments.	Chloroquine	0-11	insulin receptor	Rattus norvegicus	116-132
4046209-7	1985	Chloroquine apparently increases insulin binding to cells in vitro, and this is due to the effect of chloroquine on insulin-receptor recyclization to which lysosome contributes [16, 31, 32]; this drug inhibits the function of lysosome which digests insulin-receptor complexes and eventually insulin bound to its receptors is accumulated in intracellular compartments.	Chloroquine	0-11	insulin receptor	Rattus norvegicus	249-265
4046209-7	1985	Chloroquine apparently increases insulin binding to cells in vitro, and this is due to the effect of chloroquine on insulin-receptor recyclization to which lysosome contributes [16, 31, 32]; this drug inhibits the function of lysosome which digests insulin-receptor complexes and eventually insulin bound to its receptors is accumulated in intracellular compartments.	Chloroquine	101-112	insulin receptor	Rattus norvegicus	116-132
4046209-7	1985	Chloroquine apparently increases insulin binding to cells in vitro, and this is due to the effect of chloroquine on insulin-receptor recyclization to which lysosome contributes [16, 31, 32]; this drug inhibits the function of lysosome which digests insulin-receptor complexes and eventually insulin bound to its receptors is accumulated in intracellular compartments.	Chloroquine	101-112	insulin receptor	Rattus norvegicus	249-265
3872633-5	1985	The influence of chloroquine on the HCB-induced increase of the cytochrome P-450 content and the dependent enzymatic activities were different.	Chloroquine	17-28	cytochrome P450, family 2, subfamily g, polypeptide 1	Rattus norvegicus	64-80
3157989-5	1985	Stimulation of thrombin-induced secretion also was produced by a series of aliphatic primary amines from methylamine to butylamine, and by micromolar concentrations of chloroquine.	Chloroquine	168-179	coagulation factor II, thrombin	Homo sapiens	15-23
2981568-12	1985	The difference between the effect of chloroquine on 125I-labelled prolactin and 125I-labelled insulin uptake may reflect the greater stability of prolactin-receptor complexes in a low-pH environment.	Chloroquine	37-48	prolactin	Homo sapiens	66-75
2981568-12	1985	The difference between the effect of chloroquine on 125I-labelled prolactin and 125I-labelled insulin uptake may reflect the greater stability of prolactin-receptor complexes in a low-pH environment.	Chloroquine	37-48	prolactin receptor	Homo sapiens	146-164
3881041-6	1985	Pulse-chase perfusions with chloroquine (10 microM) inhibited precursor proteolytic processing and the time-dependent subcellular redistribution of newly synthesized cathepsin D.	Chloroquine	28-39	cathepsin D	Oryctolagus cuniculus	166-177
2985099-2	1985	Chloroquine (93 microM) inhibited beta-galactosidase activity by about 30%, while O,O"-bis(diethylaminoethyl)hexestrol showed no inhibitory effect.	Chloroquine	0-11	galactosidase, beta 1	Rattus norvegicus	34-52
2856906-2	1985	The effect of chloroquine on the biosynthesis of pig intestinal aminopeptidase N (EC 3.4.11.2) was studied by labelling with [35S]methionine in organ cultured mucosal explants.	Chloroquine	14-25	alanyl aminopeptidase, membrane	Sus scrofa	64-80
2983665-7	1985	The degradation of 125I-EGF did not occur at 4 degrees C and was inhibited at 37 degrees C by chloroquine, methylamine or NH4Cl, but not by colchicine.	Chloroquine	94-105	epidermal growth factor like 1	Rattus norvegicus	24-27
6094290-0	1984	In vivo chloroquine-induced inhibition of insulin degradation in a diabetic patient with severe insulin resistance.	Chloroquine	8-19	insulin	Homo sapiens	42-49
3880772-3	1985	In addition, chloroquine induced an increase in cell-associated 125I-insulin at 24, 48, and 72 h after preparation.	Chloroquine	13-24	insulin	Homo sapiens	69-76
20493019-2	1985	Chloroquine and quinacrine, which block the action of phospholipase A(2), inhibited either the phospholipase A(2)-stimulated or the high potassium-stimulated release of [(3)H]norepinephrine from synaptosomes.	Chloroquine	0-11	phospholipase A2 group IB	Rattus norvegicus	54-72
20493019-2	1985	Chloroquine and quinacrine, which block the action of phospholipase A(2), inhibited either the phospholipase A(2)-stimulated or the high potassium-stimulated release of [(3)H]norepinephrine from synaptosomes.	Chloroquine	0-11	phospholipase A2 group IB	Rattus norvegicus	95-113
4002295-2	1985	After regular administration of chloroquine over two years to 38 children living in a holoendemic village, their mean HbA2 rose from 2.1%, SE +/- 0.04, to 2.6%, SE +/- 0.08 (P less than 0.001) and their mean haematocrit from 0.348, SEM +/- 0.004, to 0.382, SE +/- 0.004 (P less than 0.001), values similar to those of children from the neighbouring town.	Chloroquine	32-43	hemoglobin subunit alpha 2	Homo sapiens	118-122
6094290-0	1984	In vivo chloroquine-induced inhibition of insulin degradation in a diabetic patient with severe insulin resistance.	Chloroquine	8-19	insulin	Homo sapiens	96-103
6094290-9	1984	Inhibition of insulin degrading activity (IDA) during chloroquine therapy was associated with reductions in the leukocyte lysosomal enzymes alpha-galactosidase and hexosaminidase-A but not hexosaminidase-B and beta-glucuronidase.	Chloroquine	54-65	insulin	Homo sapiens	14-21
6094290-10	1984	This study constitutes the first reported use of chloroquine for treatment of insulin resistance as a result of accelerated insulin degradation, and it provides evidence of the effectiveness of this agent in this rare condition.	Chloroquine	49-60	insulin	Homo sapiens	78-85
6094290-10	1984	This study constitutes the first reported use of chloroquine for treatment of insulin resistance as a result of accelerated insulin degradation, and it provides evidence of the effectiveness of this agent in this rare condition.	Chloroquine	49-60	insulin	Homo sapiens	124-131
6090469-10	1984	(d) When the lysosomal system is inhibited with chloroquine, secretion of degraded EGF is significantly inhibited, whereas the amount of intact EGF secreted into bile is unchanged.	Chloroquine	48-59	epidermal growth factor like 1	Rattus norvegicus	83-86
6543041-1	1984	The effect of chloroquine injection to rats on in vitro-testosterone secretion stimulated by human chorionic gonadotropin (hCG) and prostaglandin E1 (PGE1) was studied.	Chloroquine	14-25	hypertrichosis 2 (generalised, congenital)	Homo sapiens	123-126
6543041-5	1984	However, in pubertal rats chloroquine treatment inhibited testosterone secretion in hCG-stimulated testis.	Chloroquine	26-37	hypertrichosis 2 (generalised, congenital)	Homo sapiens	84-87
6488390-2	1984	The N-demethylation of benzphetamine (cytochrome P-450) was inhibited by chloroquine only while the O-deethylation of ethoxyresorufin (cytochrome P-448) was inhibited by primaquine and quinacrine.	Chloroquine	73-84	cytochrome P450, family 2, subfamily g, polypeptide 1	Rattus norvegicus	38-54
6488390-5	1984	These observations demonstrate that chloroquine and quinacrine are specific inhibitors of cytochromes P-450 and P-448, respectively.	Chloroquine	36-47	cytochrome P450, family 1, subfamily a, polypeptide 2	Rattus norvegicus	102-117
6466698-4	1984	The lipids transferred by lipoprotein lipase to cells were localized in three compartments, trypsin-releasable, resistant and metabolic; the latter was a chloroquine-sensitive pool as evidenced by inhibition of cholesteryl ester hydrolysis.	Chloroquine	154-165	lipoprotein lipase	Homo sapiens	26-44
6499716-6	1984	The decline in specific activity of PGDH in medullary tissue during the first 48 h in culture could be prevented by including inhibitors of lysosomal enzyme activity, i.e., chloroquine or ammonium chloride, in the culture medium.	Chloroquine	173-184	15-hydroxyprostaglandin dehydrogenase	Homo sapiens	36-40
6712986-2	1984	This could be due to chloroquine-induced depletion of liver lysosomal phospholipase A.	Chloroquine	21-32	phospholipase A and acyltransferase 1	Rattus norvegicus	70-85
6331647-7	1984	The EGF binding to MDA-MB-231 cells was specific for EGF and was maximum after 2 hr at 37 degrees, followed by a progressive loss of cell-associated radio-activity, which was prevented by the action of the lysosomal inhibitory agent chloroquine.	Chloroquine	233-244	epidermal growth factor	Homo sapiens	4-7
6331647-7	1984	The EGF binding to MDA-MB-231 cells was specific for EGF and was maximum after 2 hr at 37 degrees, followed by a progressive loss of cell-associated radio-activity, which was prevented by the action of the lysosomal inhibitory agent chloroquine.	Chloroquine	233-244	epidermal growth factor	Homo sapiens	53-56
6429139-12	1984	The significance of these findings concerning the use of chloroquine in studying the regulation of 3-hydroxy-3-methylglutaryl coenzyme A reductase activity is discussed.	Chloroquine	57-68	3-hydroxy-3-methylglutaryl-CoA reductase	Homo sapiens	99-146
6389296-4	1984	Not only was processing increased at higher temperatures (37 degrees C, but the effect of lysosomal inhibitors (chloroquine and methylamine) on insulin processing was abolished at this temperature.	Chloroquine	112-123	insulin	Homo sapiens	144-151
6331162-8	1984	Chloroquine (60 micrograms/ml) was added to inhibit lysosomal degradation of immunoreactive insulin.	Chloroquine	0-11	insulin	Homo sapiens	92-99
6331162-15	1984	However, the addition of chloroquine increased immunoreactive insulin by 35 percent above the medium with pentamidine and stimulatory medium (p less than 0.01).	Chloroquine	25-36	insulin	Homo sapiens	62-69
6712986-5	1984	Acid phospholipase A activity was increased in liver homogenates and in lysosomal preparations obtained from chloroquine-treated animals.	Chloroquine	109-120	phospholipase A and acyltransferase 1	Rattus norvegicus	5-20
6712986-6	1984	Thus, while fibroblasts respond to chloroquine treatment by cellular depletion of certain acid hydrolases as shown by others, the levels of acid phospholipase A increase in liver.	Chloroquine	35-46	phospholipase A and acyltransferase 1	Rattus norvegicus	145-160
6712986-7	1984	Our results provide additional new support for the hypothesis that inhibition of lysosomal phospholipase A activity is the major mechanism of chloroquine-induced phospholipidosis.	Chloroquine	142-153	phospholipase A and acyltransferase 1	Rattus norvegicus	91-106
6321139-9	1984	Exposure of the cells to chloroquine (100 microM) resulted in a 95% inhibition of [125I]LDL degradation correlating with an 80% decrease in 11 DOC released in cells preexposed to CT and insulin.	Chloroquine	25-36	insulin	Bos taurus	186-193
6712535-7	1984	Stimulation of cholesterol esterification in MPM by A-lP was inhibited by the lysosomotropic agent, chloroquine, indicating that degradation in lysosomes was a prerequisite for cholesterol esterification.	Chloroquine	100-111	C-C motif chemokine ligand 27	Homo sapiens	52-56
6715418-6	1984	They were also slightly more resistant to other unrelated drugs such as adriamycin, colchicine, bleomycin, and chloroquine, and in particular, they showed about threefold higher resistance to ricin, a toxin of Ricinus communis.	Chloroquine	111-122	ricin	Ricinus communis	192-197
6715316-10	1984	Subcellular fractionation and perfusions in the presence of chloroquine demonstrated that the multiple precursor forms of cathepsin D originated in a nonlysosomal intracellular compartment.	Chloroquine	60-71	cathepsin D	Oryctolagus cuniculus	122-133
6144779-3	1984	Chloroquine lowered the serum IgM level and also reduced plaque-forming cells in the spleen of mice.	Chloroquine	0-11	immunoglobulin heavy constant mu	Mus musculus	30-33
6363165-9	1984	At equilibrium, 55% of the cell-associated radioactivity was internalized at 37 degrees C. When chloroquine-treated (200 microM) cells were incubated with 125I-proinsulin at 37 degrees C, a 1.5-fold increase in the amount of intracellular proinsulin was observed at 1 h.(ABSTRACT TRUNCATED AT 250 WORDS)	Chloroquine	96-107	insulin	Homo sapiens	160-170
6697960-4	1984	Treatment with 10(-6) M chloroquine resulted in 20-40% inhibition of PRL release (maximum inhibition at any dose), no change in the total amount of beta-glucuronidase activity, and a number of ultrastructural changes in the Golgi region consistent with an accumulation of chloroquine within the cisternae and immature granules.	Chloroquine	24-35	prolactin	Homo sapiens	69-72
6697960-6	1984	These results are consistent with an adverse effect of chloroquine on packaging of PRL into immature granules in the Golgi apparatus, without any effect on the release of mature secretory granules.	Chloroquine	55-66	prolactin	Homo sapiens	83-86
6363165-9	1984	At equilibrium, 55% of the cell-associated radioactivity was internalized at 37 degrees C. When chloroquine-treated (200 microM) cells were incubated with 125I-proinsulin at 37 degrees C, a 1.5-fold increase in the amount of intracellular proinsulin was observed at 1 h.(ABSTRACT TRUNCATED AT 250 WORDS)	Chloroquine	96-107	insulin	Homo sapiens	239-249
6535447-9	1984	To ascertain whether internalized hCG was predominantly metabolized by lysosomal enzymes in vivo, pseudopregnant rats were pretreated with chloroquine.	Chloroquine	139-150	chorionic gonadotropin subunit beta 5	Homo sapiens	34-37
6535447-10	1984	For the first few hours after hCG stimulation, those animals pretreated with chloroquine attained greater hCG concentrations within the cytosol but membrane bound hCG was lower than that attained for controls.	Chloroquine	77-88	chorionic gonadotropin subunit beta 5	Homo sapiens	30-33
6535447-10	1984	For the first few hours after hCG stimulation, those animals pretreated with chloroquine attained greater hCG concentrations within the cytosol but membrane bound hCG was lower than that attained for controls.	Chloroquine	77-88	chorionic gonadotropin subunit beta 5	Homo sapiens	106-109
6535447-10	1984	For the first few hours after hCG stimulation, those animals pretreated with chloroquine attained greater hCG concentrations within the cytosol but membrane bound hCG was lower than that attained for controls.	Chloroquine	77-88	chorionic gonadotropin subunit beta 5	Homo sapiens	106-109
6535447-11	1984	That disparity probably reflected a combination of altered recycling of free hCG receptor in response to chloroquine as well as chloroquine"s protecting hormone from lysosomal proteases for a short time after internalization.	Chloroquine	105-116	chorionic gonadotropin subunit beta 5	Homo sapiens	77-80
6241001-3	1984	Chloroquine, a blocker of phospholipase A2 activity, decreased prolactin but not arachidonic acid stimulation of casein secretion.	Chloroquine	0-11	phospholipase A2 group IB	Homo sapiens	26-42
6413291-4	1983	Chloroquine markedly increased the biliary excretion of three lysosomal enzymes (mean +/- SEM) expressed as milliunits of activity per gram liver: N-acetyl-beta-glucosaminidase (24.4 +/- 2.7 vs. 12.5 +/- 1.4, p less than 0.01), beta-glucuronidase (26.4 +/- 4.7 vs. 10.9 +/- 1.4, p less than 0.01), and beta-galactosidase (9.8 +/- 1.7 vs. 5.5 +/- 0.8, p less than 0.05).	Chloroquine	0-11	O-GlcNAcase	Rattus norvegicus	147-176
6380785-5	1984	The mefloquine-resistant Camp strain remained sensitive to chloroquine and amodiaquine, and became slightly more resistant to quinine; there was increased sensitivity to pyrimethamine.	Chloroquine	59-70	cathelicidin antimicrobial peptide	Homo sapiens	25-29
6413291-4	1983	Chloroquine markedly increased the biliary excretion of three lysosomal enzymes (mean +/- SEM) expressed as milliunits of activity per gram liver: N-acetyl-beta-glucosaminidase (24.4 +/- 2.7 vs. 12.5 +/- 1.4, p less than 0.01), beta-glucuronidase (26.4 +/- 4.7 vs. 10.9 +/- 1.4, p less than 0.01), and beta-galactosidase (9.8 +/- 1.7 vs. 5.5 +/- 0.8, p less than 0.05).	Chloroquine	0-11	glucuronidase, beta	Rattus norvegicus	228-246
6413291-4	1983	Chloroquine markedly increased the biliary excretion of three lysosomal enzymes (mean +/- SEM) expressed as milliunits of activity per gram liver: N-acetyl-beta-glucosaminidase (24.4 +/- 2.7 vs. 12.5 +/- 1.4, p less than 0.01), beta-glucuronidase (26.4 +/- 4.7 vs. 10.9 +/- 1.4, p less than 0.01), and beta-galactosidase (9.8 +/- 1.7 vs. 5.5 +/- 0.8, p less than 0.05).	Chloroquine	0-11	galactosidase, beta 1	Rattus norvegicus	302-320
6309903-11	1983	Finally, the receptor-mediated uptake of these beta-VLDL resulted in lysosomal degradation of the lipoproteins, which could be prevented by incubating the cells with chloroquine.	Chloroquine	166-177	CD320 antigen	Mus musculus	52-56
6652360-7	1983	The process affected by chloroquine was estimated to have a T1/2 of 8 h. Cells grown in the presence of cardiac glycosides accumulate large numbers of glycoside molecules; chloroquine, NH4Cl and amantadine increase the accumulation of digoxin and digitoxin and may decrease that of ouabain.	Chloroquine	24-35	interleukin 1 receptor like 1	Homo sapiens	60-69
6604091-4	1983	The inhibition occurred if monocytes were treated with ammonium chloride and chloroquine for 1.5 hr, starting only 30 min after exposure to the stimulants, whereas only minimal inhibition occurred when monocytes were treated with the two lysosomotropic compounds 2 hr after pulsing with SLO or SpA.	Chloroquine	77-88	surfactant protein A1	Homo sapiens	294-297
6603165-3	1983	Results indicate that chloroquine inhibits tritiated thymidine in a dose-dependent way by interfering with the accessory function of monocytes, and that chloroquine inhibits the generation of immunoglobulin-secreting cells by selectively interfering with the secretion of Interleukin 1 by monocytes.	Chloroquine	22-33	interleukin 1 alpha	Homo sapiens	272-285
6603165-3	1983	Results indicate that chloroquine inhibits tritiated thymidine in a dose-dependent way by interfering with the accessory function of monocytes, and that chloroquine inhibits the generation of immunoglobulin-secreting cells by selectively interfering with the secretion of Interleukin 1 by monocytes.	Chloroquine	153-164	interleukin 1 alpha	Homo sapiens	272-285
6304043-6	1983	Both sodium azide (15 mM) and methylamine (20 mM) inhibited both the uptake and degradation of IFN-gamma at all times up to 6 h. While uptake was only slightly reduced in the presence of chloroquine (25 microM), degradation was markedly inhibited, suggesting that degradation occurs intracellularly, probably within lysosomes.	Chloroquine	187-198	interferon gamma	Homo sapiens	95-104
6847709-3	1983	Phospholipase A2 inhibitors, such as quinacrine, chloroquine, quinine and p-bromophenacyl bromide, all inhibited the secretion of catecholamines evoked by carbamylcholine in a dose-dependent manner.	Chloroquine	49-60	LOC104974671	Bos taurus	0-16
6573263-4	1983	Chloroquine and NH4Cl, known as pH-raising agents in vesicles of the lysosomal system, inhibited iron accumulation and transferrin binding in a dose-dependent manner.	Chloroquine	0-11	transferrin	Homo sapiens	119-130
6300682-0	1983	Chloroquine diverts ACTH from a regulated to a constitutive secretory pathway in AtT-20 cells.	Chloroquine	0-11	pro-opiomelanocortin-alpha	Mus musculus	20-24
6300682-5	1983	Here we show that chloroquine (200 microM) also appears to block the storage of newly synthesized ACTH in secretory granules and instead diverts it to the outside of the cell via the constitutive pathway.	Chloroquine	18-29	pro-opiomelanocortin-alpha	Mus musculus	98-102
6337153-9	1983	Incubation in the presence of 0.1 mM chloroquine led to accumulation of both intact insulin and the insulin fragment, suggesting that both are degraded by lysosomes.	Chloroquine	37-48	insulin	Homo sapiens	100-107
6337153-10	1983	The results of this study suggest the presence of two pathways for insulin degradation in liver: a chloroquine-insensitive pathway by which a portion of the B chain consisting of at least 10 amino acids is removed and a chloroquine-sensitive pathway by which both insulin and the fragment are degraded.	Chloroquine	99-110	insulin	Homo sapiens	67-74
6337153-9	1983	Incubation in the presence of 0.1 mM chloroquine led to accumulation of both intact insulin and the insulin fragment, suggesting that both are degraded by lysosomes.	Chloroquine	37-48	insulin	Homo sapiens	84-91
6337153-10	1983	The results of this study suggest the presence of two pathways for insulin degradation in liver: a chloroquine-insensitive pathway by which a portion of the B chain consisting of at least 10 amino acids is removed and a chloroquine-sensitive pathway by which both insulin and the fragment are degraded.	Chloroquine	220-231	insulin	Homo sapiens	67-74
6129307-0	1982	Stimulation of polymorphonuclear leucocyte phospholipase A2 activity by chloroquine and mepacrine.	Chloroquine	72-83	phospholipase A2 group IB	Homo sapiens	43-59
6826650-11	1983	By one-dimensional SDS PAGE, the heavily labeled chloroquine-treated PL exhibited the same labeled polypeptides as PM iodinated extracellularly with LPO-latex.	Chloroquine	49-60	lactoperoxidase	Homo sapiens	149-152
7165123-1	1982	The development of motility in porcine spermatozoa as well as the acetylcholinesterase activity of porcine testicular and epididymal spermatozoa in response to chloroquine stimulation were studied.	Chloroquine	160-171	acetylcholinesterase (Cartwright blood group)	Homo sapiens	66-86
7165123-4	1982	Chloroquine stimulation of testicular and epididymal spermatozoa remarkably enhanced sperm motility and the rate of loss of acetylcholinesterase activity only in spermatozoa obtained from the caudal portions of the epididymis.	Chloroquine	0-11	acetylcholinesterase (Cartwright blood group)	Homo sapiens	124-144
6403049-5	1983	Lysosomal inhibitor chloroquine enhances nuclear accumulation of EGF but has no significant effects on the stimulation of nuclear protein acetylation by EGF.	Chloroquine	20-31	epidermal growth factor	Homo sapiens	65-68
7165718-0	1982	The effect of chloroquine on the distribution of newly synthesized and old beta-hexosaminidase in fibroblasts.	Chloroquine	14-25	O-GlcNAcase	Homo sapiens	75-94
7165718-4	1982	Incubation of normal fibroblast cultures with chloroquine (25 mum) for 24h doubled the amount of extracellular beta-hexosaminidase activity from 15% to 37% of total culture activity while reducing the incorporation of [(14)C]leucine into intra- and extracellular enzyme by 66 and 29% of control, respectively.	Chloroquine	46-57	O-GlcNAcase	Homo sapiens	111-130
7165723-10	1982	This stimulation of acidic phospholipase A activity by chloroquine appears to be coupled to the synthesis of disaturated phosphatidylcholine, thereby enhancing remodelling of phosphatidylcholine synthesized de novo.	Chloroquine	55-66	phospholipase A and acyltransferase 1	Rattus norvegicus	27-42
6760194-0	1982	Ultrastructural basis for chloroquine-induced increase in intracellular insulin in adipocytes: alteration of lysosomal function.	Chloroquine	26-37	insulin	Homo sapiens	72-79
6760194-1	1982	A quantitative morphological analysis of insulin uptake into adipocytes was undertaken to determine the structural basis for chloroquine-induced increases in intracellular insulin.	Chloroquine	125-136	insulin	Homo sapiens	41-48
6760194-1	1982	A quantitative morphological analysis of insulin uptake into adipocytes was undertaken to determine the structural basis for chloroquine-induced increases in intracellular insulin.	Chloroquine	125-136	insulin	Homo sapiens	172-179
6760194-4	1982	Chloroquine treatment of adipocytes incubated with 70 nM ferritin-labeled insulin resulted in: (i) a 120% increase in the number of lysosomes in the cytoplasm; (ii) a 75% increase in the average concentration of ferritin-labeled insulin in a lysosome; and (iii) a 25% increase in the percentage of lysosomes containing ferritin-labeled insulin.	Chloroquine	0-11	insulin	Homo sapiens	74-81
6760194-4	1982	Chloroquine treatment of adipocytes incubated with 70 nM ferritin-labeled insulin resulted in: (i) a 120% increase in the number of lysosomes in the cytoplasm; (ii) a 75% increase in the average concentration of ferritin-labeled insulin in a lysosome; and (iii) a 25% increase in the percentage of lysosomes containing ferritin-labeled insulin.	Chloroquine	0-11	insulin	Homo sapiens	229-236
6760194-4	1982	Chloroquine treatment of adipocytes incubated with 70 nM ferritin-labeled insulin resulted in: (i) a 120% increase in the number of lysosomes in the cytoplasm; (ii) a 75% increase in the average concentration of ferritin-labeled insulin in a lysosome; and (iii) a 25% increase in the percentage of lysosomes containing ferritin-labeled insulin.	Chloroquine	0-11	insulin	Homo sapiens	229-236
6760194-6	1982	These morphological data are consistent with biochemical data concerning chloroquine-induced accumulation of 125I-labeled insulin in adipocytes.	Chloroquine	73-84	insulin	Homo sapiens	122-129
7138892-5	1982	In contrast, chloroquine inhibited the activities of the various enzymes to different extents, lysophospholipid acylhydrolase (EC 3.1.1.5) being the most sensitive enzyme, followed by phospholipase A1 (EC 3.1.1.32) and monoacylglycerol lipase, and eventually lysophospholipid monoacylglycerol hydrolase as the least sensitive enzyme.	Chloroquine	13-24	monoglyceride lipase	Rattus norvegicus	219-242
6760855-6	1982	In the presence of 0.6nm-insulin, a concentration at which most cell-associated hormone is receptor-bound, chloroquine increases the amount of (125)I-labelled insulin retained by hepatocytes.	Chloroquine	107-118	insulin	Homo sapiens	25-32
6760855-6	1982	In the presence of 0.6nm-insulin, a concentration at which most cell-associated hormone is receptor-bound, chloroquine increases the amount of (125)I-labelled insulin retained by hepatocytes.	Chloroquine	107-118	insulin	Homo sapiens	159-166
6760855-7	1982	However, chloroquine increases the retention of degradation products of insulin in incubations containing sufficient hormone (6nm) to saturate the receptor and permit occupancy of low-affinity sites.	Chloroquine	9-20	insulin	Homo sapiens	72-79
7138892-7	1982	In contrast, the inhibitory potencies towards monoacylglycerol lipase activity of chloroquine increased only up to pH 5 but decreased above this value, and the mode of inhibition was noncompetitive.	Chloroquine	82-93	monoglyceride lipase	Rattus norvegicus	46-69
7046731-8	1982	Chloroquine, and also bacitracin, at concentrations that inhibited insulin degradation, decreased the insulin-stimulated incorporation of [14C]glucose into glycogen over 2 h. This effect of chloroquine was specific, since it did not modify the basal glycogenesis, or the glycogenic effect of a glucose load in the absence of insulin.	Chloroquine	190-201	insulin	Homo sapiens	67-74
6812508-4	1982	Penicillamine at high doses enhanced the action of catabolin, while chloroquine inhibited catabolin"s effect on cartilage.	Chloroquine	68-79	interleukin 1 beta	Homo sapiens	90-99
6807295-2	1982	(1) The release of beta-galactosidase from macrophages exposed to methylamine and chloroquine was found to be highly dependent on the pH of the incubation medium; the degree of lysosomal secretion correlated closely with the amount of free base in solution at each pH investigated.	Chloroquine	82-93	galactosidase beta 1	Homo sapiens	19-37
6807295-3	1982	(2) The secretion of beta-galactosidase induced by methylamine was additively enhanced by a fixed dose of zymosan; likewise, chloroquine additively enhanced the secretion of beta-galactosidase during exposure to zymosan.	Chloroquine	125-136	galactosidase beta 1	Homo sapiens	21-39
6807295-3	1982	(2) The secretion of beta-galactosidase induced by methylamine was additively enhanced by a fixed dose of zymosan; likewise, chloroquine additively enhanced the secretion of beta-galactosidase during exposure to zymosan.	Chloroquine	125-136	galactosidase beta 1	Homo sapiens	174-192
7046731-6	1982	Chloroquine (3-50 microM), bacitracin (0.1-10 mM) and NH4Cl (1-10 mM) inhibited insulin degradation as soon as this became detectable and caused an increase in the association of insulin to hepatocytes after 20 min.	Chloroquine	0-11	insulin	Homo sapiens	80-87
7051851-7	1982	The lysosomotropic agent chloroquine inhibited 125I-VIP degradation and led to the accumulation of cell-bound 125I-VIP.	Chloroquine	25-36	vasoactive intestinal peptide	Rattus norvegicus	52-55
7051851-7	1982	The lysosomotropic agent chloroquine inhibited 125I-VIP degradation and led to the accumulation of cell-bound 125I-VIP.	Chloroquine	25-36	vasoactive intestinal peptide	Rattus norvegicus	115-118
7051001-8	1982	These studies show that insulin-receptor complexes are internalized and processed intracellularly at a chloroquine-sensitive site(s).	Chloroquine	103-114	insulin receptor	Rattus norvegicus	24-40
6803181-2	1982	The lysosomotropic agent, chloroquine, has been used to investigate the implication of lysosomal activity and membrane traffic in TRH binding, TRH internalization and TRH-induced stimulation of prolactin secretion in a rat prolactin cell line (GH3/B6).	Chloroquine	26-37	thyrotropin releasing hormone	Rattus norvegicus	130-133
6803181-2	1982	The lysosomotropic agent, chloroquine, has been used to investigate the implication of lysosomal activity and membrane traffic in TRH binding, TRH internalization and TRH-induced stimulation of prolactin secretion in a rat prolactin cell line (GH3/B6).	Chloroquine	26-37	thyrotropin releasing hormone	Rattus norvegicus	143-146
6803181-2	1982	The lysosomotropic agent, chloroquine, has been used to investigate the implication of lysosomal activity and membrane traffic in TRH binding, TRH internalization and TRH-induced stimulation of prolactin secretion in a rat prolactin cell line (GH3/B6).	Chloroquine	26-37	thyrotropin releasing hormone	Rattus norvegicus	143-146
6803181-5	1982	In contrast, chloroquine partially inhibits the spontaneous dissociation of (3H)TRH from cells previously loaded with (3H)TRH and reduces prolactin release following TRH withdrawal.	Chloroquine	13-24	thyrotropin releasing hormone	Rattus norvegicus	80-83
6803181-5	1982	In contrast, chloroquine partially inhibits the spontaneous dissociation of (3H)TRH from cells previously loaded with (3H)TRH and reduces prolactin release following TRH withdrawal.	Chloroquine	13-24	thyrotropin releasing hormone	Rattus norvegicus	122-125
6803181-5	1982	In contrast, chloroquine partially inhibits the spontaneous dissociation of (3H)TRH from cells previously loaded with (3H)TRH and reduces prolactin release following TRH withdrawal.	Chloroquine	13-24	thyrotropin releasing hormone	Rattus norvegicus	122-125
6803181-9	1982	This suggests that the effects of chloroquine on TRH interaction with GH3 cells may be mediated by an inhibition of membrane recycling.	Chloroquine	34-45	thyrotropin releasing hormone	Rattus norvegicus	49-52
7046731-8	1982	Chloroquine, and also bacitracin, at concentrations that inhibited insulin degradation, decreased the insulin-stimulated incorporation of [14C]glucose into glycogen over 2 h. This effect of chloroquine was specific, since it did not modify the basal glycogenesis, or the glycogenic effect of a glucose load in the absence of insulin.	Chloroquine	0-11	insulin	Homo sapiens	67-74
7046731-8	1982	Chloroquine, and also bacitracin, at concentrations that inhibited insulin degradation, decreased the insulin-stimulated incorporation of [14C]glucose into glycogen over 2 h. This effect of chloroquine was specific, since it did not modify the basal glycogenesis, or the glycogenic effect of a glucose load in the absence of insulin.	Chloroquine	0-11	insulin	Homo sapiens	102-109
7046731-8	1982	Chloroquine, and also bacitracin, at concentrations that inhibited insulin degradation, decreased the insulin-stimulated incorporation of [14C]glucose into glycogen over 2 h. This effect of chloroquine was specific, since it did not modify the basal glycogenesis, or the glycogenic effect of a glucose load in the absence of insulin.	Chloroquine	190-201	insulin	Homo sapiens	102-109
6271226-4	1981	Similarly, lysosomotropic agents, chloroquine (100 microM) and ammonium chloride (10 mM), partly blocked the steroidogenic response of luteal cells to hCG and/or human or rat sera.	Chloroquine	34-45	hypertrichosis 2 (generalised, congenital)	Homo sapiens	151-154
6276249-2	1982	Chloroquine (100 microM) results in an increase in prolactin receptor levels (15.7 +/- 1.2% to 35.9 +/- 3.5% specific binding), whereas cycloheximide (1 microgram/ml) induces a rapid decline (to 6.4 +/- 1.2%) suggesting a rapid synthesis and degradation of the receptor molecule.	Chloroquine	0-11	prolactin receptor	Oryctolagus cuniculus	51-69
6277962-1	1982	Receptor-mediated endocytosis of rat preputial beta-glucuronidase and the glycoconjugate mannose-BSA by rat alveolar macrophages is inhibited by chloroquine and ammonium chloride.	Chloroquine	145-156	glucuronidase, beta	Rattus norvegicus	47-65
6962628-2	1982	The combined treatment with phlebotomy and high-dose chloroquine for PCT is described and 21 patients treated were followed up for periods of up to 6 years.	Chloroquine	53-64	calcitonin related polypeptide alpha	Homo sapiens	69-72
7083452-0	1982	Interaction of VP16-213 with the DNA repair antagonist chloroquine.	Chloroquine	55-66	host cell factor C1	Homo sapiens	15-19
6263106-8	1981	Internalization of insulin as determined in chloroquine-treated cells begins later than transport activation and is in contrast to transport activation not observable at 15 degrees C. In conclusion, the coupling is not related to internalization; it is ATP-dependent, whereas the initial binding and the activated transport system are ATP-independent.	Chloroquine	44-55	insulin	Homo sapiens	19-26
6260801-6	1981	Chloroquine treatment of the cells completely inhibits degradation of thrombin.	Chloroquine	0-11	coagulation factor II, thrombin	Bos taurus	70-78
7437363-4	1980	In quiescent strips requiring stimulation by oxytocin, chloroquine had a generally depressant effect which could be overcome by higher doses of oxytocin.	Chloroquine	55-66	oxytocin/neurophysin I prepropeptide	Homo sapiens	45-53
7013817-8	1981	Treatment with chloroquine, a lysosomal enzyme inhibitor, resulted in a large increase of cell-associated insulin compared to control cells.	Chloroquine	15-26	insulin	Homo sapiens	106-113
7013817-9	1981	However, chromatographic studies of iodocompounds extracted from cells incubated with or without chloroquine show a similar pattern but differ in the size of the peak which represents the degradation products of 125I-labeled insulin.	Chloroquine	97-108	insulin	Homo sapiens	225-232
7007379-6	1981	The phospholipase A2 inhibitors, chloroquine and quinacrine, prevented the effect of GnRH on arachidonic acid formation and LH release.	Chloroquine	33-44	phospholipase A2 group IB	Homo sapiens	4-20
7007379-6	1981	The phospholipase A2 inhibitors, chloroquine and quinacrine, prevented the effect of GnRH on arachidonic acid formation and LH release.	Chloroquine	33-44	gonadotropin releasing hormone 1	Homo sapiens	85-89
7213779-4	1981	Qualitatively identical spectra of degradation intermediates were formed in the presence of chloroquine and NH4Cl as determined by autoradiography of SDS-polyacrylamide gel electrophoretic fractions, ranging from the apolipoprotein B band (Mr = 340,000) to bands with molecular weights of less than 14,000.	Chloroquine	92-103	apolipoprotein B	Bos taurus	217-233
7437363-4	1980	In quiescent strips requiring stimulation by oxytocin, chloroquine had a generally depressant effect which could be overcome by higher doses of oxytocin.	Chloroquine	55-66	oxytocin/neurophysin I prepropeptide	Homo sapiens	144-152
6108561-2	1980	When intracellular hormone degradation is inhibited by chloroquine, 125I-labeled insulin internalizes and accumulates intracellularly.	Chloroquine	55-66	insulin	Homo sapiens	81-88
6968406-7	1980	We report here that when its lysosomal degradation is inhibited by chloroquine, EGF accumulates in the nucleus.	Chloroquine	67-78	epidermal growth factor like 1	Rattus norvegicus	80-83
7000584-4	1980	Agents believed to inhibit intralysosomal degradation of various proteins also inhibited the degradation of 125I-insulin by H4 cells (chloroquine, ammonium chloride, procaine, and lidocaine); inhibitors of energy production (dinitrophenol, sodium cyanide) inhibited degradation; an agent which inhibits microtubule function (vinblastine) blocked insulin degradation; and methylamine, reported to prevent receptor aggregation,2 also interfered with insulin processing.	Chloroquine	134-145	insulin	Homo sapiens	113-120
7000584-9	1980	Vinblastine and chloroquine both significantly inhibited insulin-stimulated glucose incorporation into glycogen without affecting basal levels.	Chloroquine	16-27	insulin	Homo sapiens	57-64
6247227-3	1980	In the present experiments, lysosomotropic agents, chloroquine, ammonium chloride and methylamine, in the presence of prolactin are capable of almost completely preventing this down-regulation.	Chloroquine	51-62	prolactin	Oryctolagus cuniculus	118-127
6996681-0	1980	Chloroquine inhibits the insulin production of isolated pancreatic islets.	Chloroquine	0-11	insulin	Homo sapiens	25-32
6296934-3	1980	The same results were obtained in organ-culture of the rabbit mammary gland in the presence of prolactin; in addition, the down-regulation of prolactin receptors could be counteracted by lysosomotropic agents (chloroquine NH4Cl) in vitro.	Chloroquine	210-221	prolactin	Oryctolagus cuniculus	95-104
6296934-3	1980	The same results were obtained in organ-culture of the rabbit mammary gland in the presence of prolactin; in addition, the down-regulation of prolactin receptors could be counteracted by lysosomotropic agents (chloroquine NH4Cl) in vitro.	Chloroquine	210-221	prolactin	Oryctolagus cuniculus	142-151
488900-10	1979	4) Corticosteroids and chloroquine stabilized rat liver lysosome in vitro from the labilizing influence of incubation at 37 degrees C. 5) The administration of chloroquine to CCl4 intoxicated rats did not cause any well-expressed stabilization of lysosomes.	Chloroquine	23-34	C-C motif chemokine ligand 4	Rattus norvegicus	175-179
521111-0	1979	Effect of acute and chronic treatment of phenobarbital and chloroquin on the turnover of 2- [2-(3-pyridyl)vinyl] -3-o-tolyl-3,4-dihydro quinazoline-4-one (SRC-909).	Chloroquine	59-69	SRC proto-oncogene, non-receptor tyrosine kinase	Homo sapiens	155-158
476148-2	1979	The effects of chloroquine and mannose 6-hosphate on the secretion and uptake of the lysosomal enzyme, beta-N-acetylglucosaminidase (EC 3.2.1.30), by human fibroblasts have been compared.	Chloroquine	15-26	O-GlcNAcase	Homo sapiens	103-131
476148-4	1979	A loss of enzyme activity from the system (intra- plus extracellular activity) with increasing concentrations of chloroquine was due to inhibition of the beta-N-acetylglucosaminidase.	Chloroquine	113-124	O-GlcNAcase	Homo sapiens	154-182
476148-5	1979	At a concentration of 50 micrometers, chloroquine elicited a three fold increase in the extracellular accumulation of beta-N-acetylglucosaminidase in 24 h whereas the addition of 5 micrometers mannose 6-phosphate (a competitive inhibitor of receptor-mediated uptake) resulted in only a 13% increase.	Chloroquine	38-49	O-GlcNAcase	Homo sapiens	118-146
476148-11	1979	There was an almost total loss of the A isoenzyme of beta-N-acetylglucosaminidase from fibroblasts cultured in the presence of chloroquine.	Chloroquine	127-138	O-GlcNAcase	Homo sapiens	53-81
488900-10	1979	4) Corticosteroids and chloroquine stabilized rat liver lysosome in vitro from the labilizing influence of incubation at 37 degrees C. 5) The administration of chloroquine to CCl4 intoxicated rats did not cause any well-expressed stabilization of lysosomes.	Chloroquine	160-171	C-C motif chemokine ligand 4	Rattus norvegicus	175-179
342718-0	1977	Response of falciparum malaria to a standard regimen of chloroquine in Vientiane, Lao People"s Democratic Republic.	Chloroquine	56-67	interleukin 4 induced 1	Homo sapiens	82-85
666843-0	1978	Identification of tryptophan pyrrolase in liver lysosomes after treatment of rats with hydrocortisone and chloroquine.	Chloroquine	106-117	tryptophan 2,3-dioxygenase	Rattus norvegicus	18-38
563953-4	1978	Two established cell lines, WISH or HeLa cells, have elevated tissue factor activity in the presence of colchicine or chloroquine and suppressed activity with exogenous hydrocortisone.	Chloroquine	118-129	coagulation factor III, tissue factor	Homo sapiens	62-75
189819-1	1977	The effect of chloroquine, an inhibitor of certain lysosomal enzymes including cathepsin B (EC 3.4.22.1), on the degradation of serum lipoproteins in rat liver was studied in vivo and in liver homogenates.	Chloroquine	14-25	cathepsin B	Rattus norvegicus	79-90
326072-1	1977	Glucose-6-phosphate dehydrogenase-normal adult volunteers infected with mosquito-bone Chesson strain vivax malaria were treated with chloroquine and primaquine during the initial attack.	Chloroquine	133-144	glucose-6-phosphate dehydrogenase	Homo sapiens	0-33
557348-9	1977	The lag phase before human serum albumin-degradation starts and the inhibitory effect of chloroquine on degradation indicate that human serum albumin is degraded in lysosomes.	Chloroquine	89-100	albumin	Rattus norvegicus	142-149
170273-3	1975	However, the two regulatory actions that normally follow low density lipoprotein binding to its receptor, namely suppression of 3-hydroxy-3-methylglutaryl coenzyme A reductase activity and stimulation of cholesteryl ester formation, were both prevented when degradation of the lipoprotein was inhibited by chloroquine.	Chloroquine	306-317	3-hydroxy-3-methylglutaryl-CoA reductase	Homo sapiens	128-175
946356-2	1976	Effects of quinine and chloroquine on the sheep ERG.	Chloroquine	23-34	transcriptional regulator ERG	Ovis aries	48-51
945675-0	1976	[The ERG in chloroquine retinopathy (author"s transl)].	Chloroquine	12-23	ETS transcription factor ERG	Homo sapiens	5-8
71033-2	1976	This release is inhibited by chloroquine, a phospholipase A inhibitor.	Chloroquine	29-40	phospholipase A and acyltransferase 1	Rattus norvegicus	44-59
1122935-2	1975	Relatively low concentrations of chloroquine, 5 times 10-5 and 2 times 10-4 g/ml inhibited cholinesterase activity and potentiated acetylcholine (ACh)-induced contractions but antagonized carbachol and caffeine contractions, as well as ACh-induced contractions of eserinized muscle.	Chloroquine	33-44	butyrylcholinesterase	Homo sapiens	91-105
4607946-2	1974	The uptake of chloroquine by rat fibroblasts and the inhibition of cellular protein degradation and cathepsin B1.	Chloroquine	14-25	cathepsin B	Rattus norvegicus	100-112
4607946-7	1974	Chloroquine, at concentrations attained inside the lysosomes, inhibited cathepsin B(1) but not cathepsin D.	Chloroquine	0-11	cathepsin B	Rattus norvegicus	72-86
4607946-8	1974	It is concluded that chloroquine impairs the breakdown of cellular proteins after these have entered the lysosome system, probably through inhibition of cathepsin B(1).	Chloroquine	21-32	cathepsin B	Rattus norvegicus	153-167
6014893-0	1966	[On the influence of substances acting on connective tissue (beta-amino-propionitrile, progesterone and chloroquine) on the leucine aminopeptidase content in rat serum].	Chloroquine	104-115	carboxypeptidase Q	Homo sapiens	132-146
4794122-0	1973	[Acute kidney failure and hemolytic anemia caused by erythrocytic G6PD dificit revealed by chloroquine administration].	Chloroquine	91-102	glucose-6-phosphate dehydrogenase	Homo sapiens	66-70
5821522-0	1969	Hemolytic effects of standard single dosages of primaquine and chloroquine on G-6-PD-deficient caucasians.	Chloroquine	63-74	glucose-6-phosphate dehydrogenase	Homo sapiens	78-84
32362217-4	2021	This study reveals that Isothymol, a major component of this plant, gives the best docking scores, compared to, the co-crystallized inhibitor beta-D-mannose of the enzyme ACE2, to Captropil drug as good ACE2 inhibitor and to Chloroquine antiviral drug also involved in other mechanisms as inhibition of ACE2 cellular receptor.	Chloroquine	225-236	angiotensin converting enzyme 2	Homo sapiens	171-175
5226562-0	1966	Discussion: modifications of the ERG during chloroquine intoxications.	Chloroquine	44-55	ETS transcription factor ERG	Homo sapiens	33-36
34032210-4	2021	Further, we show that chloroquine-activated CeA neurons play important roles in itch-related comorbidities, including anxiety-like behaviors, but not in some aversive and appetitive behaviors previously ascribed to CeA neurons.	Chloroquine	22-33	itchy, E3 ubiquitin protein ligase	Mus musculus	80-84
33480093-10	2021	The reduction in tyrosinase protein level is associated with an increase in the levels of the lysosomal proteinase cathepsin S. Chloroquine, a lysosome inhibitor, restored the tyrosinase protein level downregulated by GIF-2202, although no effects of other inhibitors (against proteasome, autophagy, or exocytosis) were observed.	Chloroquine	128-139	tyrosinase	Mus musculus	17-27
33480093-10	2021	The reduction in tyrosinase protein level is associated with an increase in the levels of the lysosomal proteinase cathepsin S. Chloroquine, a lysosome inhibitor, restored the tyrosinase protein level downregulated by GIF-2202, although no effects of other inhibitors (against proteasome, autophagy, or exocytosis) were observed.	Chloroquine	128-139	tyrosinase	Mus musculus	176-186
33480093-12	2021	Chloroquine treatment resulted in co-localization of tyrosinase and cathepsin S signals near the perinuclear region, suggesting that 4-OST and GIF-2202 may alter the destination of the tyrosinase vesicle from the melanosome to the lysosome.	Chloroquine	0-11	tyrosinase	Mus musculus	53-63
33480093-12	2021	Chloroquine treatment resulted in co-localization of tyrosinase and cathepsin S signals near the perinuclear region, suggesting that 4-OST and GIF-2202 may alter the destination of the tyrosinase vesicle from the melanosome to the lysosome.	Chloroquine	0-11	protein tyrosine phosphatase, receptor type, V	Mus musculus	135-138
33480093-12	2021	Chloroquine treatment resulted in co-localization of tyrosinase and cathepsin S signals near the perinuclear region, suggesting that 4-OST and GIF-2202 may alter the destination of the tyrosinase vesicle from the melanosome to the lysosome.	Chloroquine	0-11	tyrosinase	Mus musculus	185-195
34038188-6	2021	Treatment with chloroquine decreased the expression levels of ABCB1, ABCC1, and P-gp, and increased the formation of LC3-II and the expression levels of p62 in the HNE1/DDP cells.	Chloroquine	15-26	ATP binding cassette subfamily B member 1	Homo sapiens	62-67
34038188-6	2021	Treatment with chloroquine decreased the expression levels of ABCB1, ABCC1, and P-gp, and increased the formation of LC3-II and the expression levels of p62 in the HNE1/DDP cells.	Chloroquine	15-26	ATP binding cassette subfamily C member 1	Homo sapiens	69-74
34038188-6	2021	Treatment with chloroquine decreased the expression levels of ABCB1, ABCC1, and P-gp, and increased the formation of LC3-II and the expression levels of p62 in the HNE1/DDP cells.	Chloroquine	15-26	ATP binding cassette subfamily B member 1	Homo sapiens	80-84
34038188-6	2021	Treatment with chloroquine decreased the expression levels of ABCB1, ABCC1, and P-gp, and increased the formation of LC3-II and the expression levels of p62 in the HNE1/DDP cells.	Chloroquine	15-26	nucleoporin 62	Homo sapiens	153-156
34032339-7	2021	CQ inhibited the degradation of mitophagosomes in vitrified oocytes, manifested as decreased mitochondria-lysosomes colocalization, increased fluorescence fraction of VDAC1 overlapping LC3B, increased LC3B-II/I protein expression ratio, and p62 accumulation.	Chloroquine	0-2	voltage dependent anion channel 1	Homo sapiens	167-172
33526951-7	2021	Low gap value supports the higher reactivity of DD1 than chloroquine justified by the higher electrophilicity and low nucleophilicity.	Chloroquine	57-68	aldo-keto reductase family 1 member C1	Homo sapiens	48-51
34032339-7	2021	CQ inhibited the degradation of mitophagosomes in vitrified oocytes, manifested as decreased mitochondria-lysosomes colocalization, increased fluorescence fraction of VDAC1 overlapping LC3B, increased LC3B-II/I protein expression ratio, and p62 accumulation.	Chloroquine	0-2	microtubule associated protein 1 light chain 3 beta	Homo sapiens	185-189
34032339-7	2021	CQ inhibited the degradation of mitophagosomes in vitrified oocytes, manifested as decreased mitochondria-lysosomes colocalization, increased fluorescence fraction of VDAC1 overlapping LC3B, increased LC3B-II/I protein expression ratio, and p62 accumulation.	Chloroquine	0-2	nucleoporin 62	Homo sapiens	241-244
34034472-14	2021	Autophagy inhibitor chloroquine reversed the increased expression of LC3II/I and inhibited expression of p62 in LoVo/R cells induced by radiation, and promoted the suppression of cell viability and survival induced by radiation, the radiotherapy sensitization ratio was 1.780.	Chloroquine	20-31	nucleoporin 62	Homo sapiens	105-108
34011935-5	2021	We found that downregulation of the MMP1 protein was a key abnormal feature in the neurofibromatosis 1 fibroblasts and that the decreased MMP1 was restored by the lysosomal blockers CQ and HCQ, but not by the blockers of the Ras pathway.	Chloroquine	182-184	matrix metallopeptidase 1	Homo sapiens	36-40
34011935-5	2021	We found that downregulation of the MMP1 protein was a key abnormal feature in the neurofibromatosis 1 fibroblasts and that the decreased MMP1 was restored by the lysosomal blockers CQ and HCQ, but not by the blockers of the Ras pathway.	Chloroquine	182-184	matrix metallopeptidase 1	Homo sapiens	138-142
34002696-11	2021	We rescued flight coordination with chloroquine, a lysosomal inhibitor that enhanced DAT expression in a heterologous expression system.	Chloroquine	36-47	Dopamine transporter	Drosophila melanogaster	85-88
33977847-0	2021	Computational and experimental insights on the interaction of artemisinin, dihydroartemisinin and chloroquine with SARS-CoV-2 spike protein receptor-binding domain (RBD).	Chloroquine	98-109	surface glycoprotein	Severe acute respiratory syndrome coronavirus 2	126-131
33979123-4	2021	Among promising candidates identified, several dyes (Congo red, direct violet 1, Evans blue) and novel druglike compounds (DRI-C23041, DRI-C91005) inhibited the interaction of hACE2 with the spike proteins of SARS-CoV-2 as well as SARS-CoV with low micromolar activity in our cell-free ELISA-type assays (IC50"s of 0.2-3.0 muM), whereas control compounds, such as sunset yellow FCF, chloroquine, and suramin, showed no activity.	Chloroquine	383-394	angiotensin converting enzyme 2	Homo sapiens	176-181
33979123-4	2021	Among promising candidates identified, several dyes (Congo red, direct violet 1, Evans blue) and novel druglike compounds (DRI-C23041, DRI-C91005) inhibited the interaction of hACE2 with the spike proteins of SARS-CoV-2 as well as SARS-CoV with low micromolar activity in our cell-free ELISA-type assays (IC50"s of 0.2-3.0 muM), whereas control compounds, such as sunset yellow FCF, chloroquine, and suramin, showed no activity.	Chloroquine	383-394	surface glycoprotein	Severe acute respiratory syndrome coronavirus 2	191-196
33938974-10	2021	Increased disproportionality has been found for the individual drugs and TdP: CQ (ROR: 7.41, 95% confidence interval (CI): 3.82, 12.96), HCQ (ROR: 8.49, 95% CI: 6.57, 10.98), azithromycin (ROR: 8.06, 95% CI: 6.76, 9.61).	Chloroquine	78-80	long intergenic non-protein coding RNA, regulator of reprogramming	Homo sapiens	82-85
33900318-8	2021	Furthermore, three common hot-spot residues of Met165, Hie41, and Gln189 of monomeric Mpro systems dominated the binding of Ritonavir, Arbidol, and Chloroquine.	Chloroquine	148-159	NEWENTRY	Severe acute respiratory syndrome-related coronavirus	86-90
33900318-6	2021	Ritonavir, Arbidol, and Chloroquine consistently showed an outstanding binding ability to monomeric Mpro under various methods.	Chloroquine	24-35	NEWENTRY	Severe acute respiratory syndrome-related coronavirus	100-104
34017843-10	2021	GS/BS patients" increased ACE2 and Ang 1-7 levels and their characteristic chronic metabolic alkalosis suggest a mechanism similar to that of chloroquine/hydroxychloroquine effect on ACE2 glycosylation alteration with resulting SARS-COV-2 binding inhibition and blockage/inhibition of viral entry.	Chloroquine	142-153	angiotensin converting enzyme 2	Homo sapiens	183-187
33938974-11	2021	Disproportionality was also found for other related symptoms, Standardized MedDRA Query for torsade de pointes/QT prolongation (narrow): CQ (ROR: 11.95, 95% CI: 10.04-14.22); HCQ (ROR: 20.43, 95% CI: 19.13, 21.83), AZT (ROR: 7.78, 95% CI: 7.26, 8.34).	Chloroquine	137-139	long intergenic non-protein coding RNA, regulator of reprogramming	Homo sapiens	180-183
33938974-11	2021	Disproportionality was also found for other related symptoms, Standardized MedDRA Query for torsade de pointes/QT prolongation (narrow): CQ (ROR: 11.95, 95% CI: 10.04-14.22); HCQ (ROR: 20.43, 95% CI: 19.13, 21.83), AZT (ROR: 7.78, 95% CI: 7.26, 8.34).	Chloroquine	137-139	long intergenic non-protein coding RNA, regulator of reprogramming	Homo sapiens	141-144
33938974-11	2021	Disproportionality was also found for other related symptoms, Standardized MedDRA Query for torsade de pointes/QT prolongation (narrow): CQ (ROR: 11.95, 95% CI: 10.04-14.22); HCQ (ROR: 20.43, 95% CI: 19.13, 21.83), AZT (ROR: 7.78, 95% CI: 7.26, 8.34).	Chloroquine	137-139	long intergenic non-protein coding RNA, regulator of reprogramming	Homo sapiens	180-183
34012978-5	2021	TfRC was accumulated after the inhibition of autophagy by treatment with autophagic inhibitor chloroquine or knockdown of ATG2A.	Chloroquine	94-105	transferrin receptor	Homo sapiens	0-4
33930758-5	2021	Deeping into their mechanisms of action we show that, in addition to autophagy modulation, treatment with CQ increased reactive oxygen species (ROS) causing DNA double strand breaks (DSBs), whereas LBH inhibited their repair by avoiding the correct recruitment of the recombinase Rad51 to DSBs.	Chloroquine	106-108	RAD51 recombinase	Homo sapiens	280-285
33556871-3	2021	Meanwhile, host-targeted drugs that inhibit cellular transmembrane serine protease (TMPRSS2) can prevent SARS-CoV-2 from entering cells, and its combination with chloroquine and dihydroorotate dehydrogenase (DHODH) inhibitors can limit the spread of SARS-CoV-2 and reduce the morbidity and mortality of patients with COVID-19.	Chloroquine	162-173	transmembrane serine protease 2	Homo sapiens	84-91
33674391-0	2021	COVID-19 drugs chloroquine and hydroxychloroquine, but not azithromycin and remdesivir, block hERG potassium channels.	Chloroquine	15-26	ETS transcription factor ERG	Homo sapiens	94-98
33674391-5	2021	Here we study the effects of chloroquine, hydroxychloroquine, azithromycin, and remdesivir on hERG channels.	Chloroquine	29-40	ETS transcription factor ERG	Homo sapiens	94-98
33674391-6	2021	Our results showed that while chloroquine acutely blocked hERG current (IhERG) with an IC50 of 3.0 microM, hydroxychloroquine acutely blocked IhERG 8-fold less potently, with an IC50 of 23.4 microM.	Chloroquine	30-41	ETS transcription factor ERG	Homo sapiens	58-62
33674391-10	2021	Significance Statement This work demonstrates that among off-label potential COVID-19 treatment drugs chloroquine, hydroxychloroquine, azithromycin, and remdesivir, the former two drugs block hERG potassium channels while the latter two drugs do not.	Chloroquine	102-113	ETS transcription factor ERG	Homo sapiens	192-196
33930758-6	2021	Interestingly, CQ-induced DSBs and cell death caused by CQ/LBH combination were largely abolished by the ROS scavenger N-Acetylcysteine, revealing the critical role of DSB generation in CQ/LBH-induced lethality.	Chloroquine	56-58	LBH regulator of WNT signaling pathway	Homo sapiens	189-192
33416933-8	2021	Studies indicate that one of the possible anti-inflammatory mechanisms of chloroquine and hydroxychloroquine is inhibition of the activity of NLRP3 inflammasome.	Chloroquine	74-85	NLR family pyrin domain containing 3	Homo sapiens	142-147
33930758-6	2021	Interestingly, CQ-induced DSBs and cell death caused by CQ/LBH combination were largely abolished by the ROS scavenger N-Acetylcysteine, revealing the critical role of DSB generation in CQ/LBH-induced lethality.	Chloroquine	15-17	LBH regulator of WNT signaling pathway	Homo sapiens	59-62
33930758-6	2021	Interestingly, CQ-induced DSBs and cell death caused by CQ/LBH combination were largely abolished by the ROS scavenger N-Acetylcysteine, revealing the critical role of DSB generation in CQ/LBH-induced lethality.	Chloroquine	15-17	LBH regulator of WNT signaling pathway	Homo sapiens	189-192
33930758-6	2021	Interestingly, CQ-induced DSBs and cell death caused by CQ/LBH combination were largely abolished by the ROS scavenger N-Acetylcysteine, revealing the critical role of DSB generation in CQ/LBH-induced lethality.	Chloroquine	56-58	LBH regulator of WNT signaling pathway	Homo sapiens	189-192
33925206-0	2021	Therapeutic Approach of KRAS Mutant Tumours by the Combination of Pharmacologic Ascorbate and Chloroquine.	Chloroquine	94-105	KRAS proto-oncogene, GTPase	Homo sapiens	24-28
33925206-7	2021	We predicted that the addition of both pharmacologic ascorbate and chloroquine is able to block both KRAS and mTOR pathways: in this case, no GLUT1 expression is observed, meanwhile autophagy, essential for KRAS mutant cancer cells, is blocked.	Chloroquine	67-78	KRAS proto-oncogene, GTPase	Homo sapiens	101-105
33925206-7	2021	We predicted that the addition of both pharmacologic ascorbate and chloroquine is able to block both KRAS and mTOR pathways: in this case, no GLUT1 expression is observed, meanwhile autophagy, essential for KRAS mutant cancer cells, is blocked.	Chloroquine	67-78	mechanistic target of rapamycin kinase	Homo sapiens	110-114
33925206-7	2021	We predicted that the addition of both pharmacologic ascorbate and chloroquine is able to block both KRAS and mTOR pathways: in this case, no GLUT1 expression is observed, meanwhile autophagy, essential for KRAS mutant cancer cells, is blocked.	Chloroquine	67-78	KRAS proto-oncogene, GTPase	Homo sapiens	207-211
33925206-8	2021	Corresponding to our system biological analysis, this combined pharmacologic ascorbate and chloroquine treatment in KRAS mutant cancers might be a therapeutic approach in anti-cancer therapies.	Chloroquine	91-102	KRAS proto-oncogene, GTPase	Homo sapiens	116-120
33886081-4	2021	Western blotting, qRT-PCR and ELISA also showed that chloroquine (CQ) could up-regulate the expression of p62 through impairing autophagy and induce the pyroptosis of macrophages treated by ox-LDL, as evidenced by the decrease of cell viability and membrane integrity, and the increase of pro-caspase-1, GSDMD, and proinflammatory factors IL-1beta and IL-18.	Chloroquine	53-64	nucleoporin 62	Homo sapiens	106-109
33987174-6	2021	More specifically, chloroquine elution down-regulates interleukin 8 (IL-8) and matrix metalloproteinase nine secretion while up-regulating hepatocyte growth factor, vascular endothelial growth factor A, and IL-22 secretion, suggesting a potential shift toward a resolving neutrophil phenotype.	Chloroquine	19-30	C-X-C motif chemokine ligand 8	Homo sapiens	54-67
33987174-6	2021	More specifically, chloroquine elution down-regulates interleukin 8 (IL-8) and matrix metalloproteinase nine secretion while up-regulating hepatocyte growth factor, vascular endothelial growth factor A, and IL-22 secretion, suggesting a potential shift toward a resolving neutrophil phenotype.	Chloroquine	19-30	C-X-C motif chemokine ligand 8	Homo sapiens	69-73
33987174-6	2021	More specifically, chloroquine elution down-regulates interleukin 8 (IL-8) and matrix metalloproteinase nine secretion while up-regulating hepatocyte growth factor, vascular endothelial growth factor A, and IL-22 secretion, suggesting a potential shift toward a resolving neutrophil phenotype.	Chloroquine	19-30	hepatocyte growth factor	Homo sapiens	139-163
33987174-6	2021	More specifically, chloroquine elution down-regulates interleukin 8 (IL-8) and matrix metalloproteinase nine secretion while up-regulating hepatocyte growth factor, vascular endothelial growth factor A, and IL-22 secretion, suggesting a potential shift toward a resolving neutrophil phenotype.	Chloroquine	19-30	vascular endothelial growth factor A	Homo sapiens	165-201
33987174-6	2021	More specifically, chloroquine elution down-regulates interleukin 8 (IL-8) and matrix metalloproteinase nine secretion while up-regulating hepatocyte growth factor, vascular endothelial growth factor A, and IL-22 secretion, suggesting a potential shift toward a resolving neutrophil phenotype.	Chloroquine	19-30	interleukin 22	Homo sapiens	207-212
33727332-4	2021	Calcium imaging studies demonstrated MrgprA3 and MrgprC11 agonists (chloroquine, BAM8-22 and neuropeptide FF) activated sub-populations of bladder-innervating DRG neurons, showing functional evidence of co-expression between MrgprA3, MrgprC11 and TRPV1.	Chloroquine	68-79	MAS-related GPR, member A3	Mus musculus	37-44
33727332-4	2021	Calcium imaging studies demonstrated MrgprA3 and MrgprC11 agonists (chloroquine, BAM8-22 and neuropeptide FF) activated sub-populations of bladder-innervating DRG neurons, showing functional evidence of co-expression between MrgprA3, MrgprC11 and TRPV1.	Chloroquine	68-79	MAS-related GPR, member X1	Mus musculus	49-57
33886081-4	2021	Western blotting, qRT-PCR and ELISA also showed that chloroquine (CQ) could up-regulate the expression of p62 through impairing autophagy and induce the pyroptosis of macrophages treated by ox-LDL, as evidenced by the decrease of cell viability and membrane integrity, and the increase of pro-caspase-1, GSDMD, and proinflammatory factors IL-1beta and IL-18.	Chloroquine	53-64	gasdermin D	Homo sapiens	304-309
33886081-4	2021	Western blotting, qRT-PCR and ELISA also showed that chloroquine (CQ) could up-regulate the expression of p62 through impairing autophagy and induce the pyroptosis of macrophages treated by ox-LDL, as evidenced by the decrease of cell viability and membrane integrity, and the increase of pro-caspase-1, GSDMD, and proinflammatory factors IL-1beta and IL-18.	Chloroquine	53-64	interleukin 1 alpha	Homo sapiens	339-347
33886081-4	2021	Western blotting, qRT-PCR and ELISA also showed that chloroquine (CQ) could up-regulate the expression of p62 through impairing autophagy and induce the pyroptosis of macrophages treated by ox-LDL, as evidenced by the decrease of cell viability and membrane integrity, and the increase of pro-caspase-1, GSDMD, and proinflammatory factors IL-1beta and IL-18.	Chloroquine	53-64	interleukin 18	Homo sapiens	352-357
33886081-4	2021	Western blotting, qRT-PCR and ELISA also showed that chloroquine (CQ) could up-regulate the expression of p62 through impairing autophagy and induce the pyroptosis of macrophages treated by ox-LDL, as evidenced by the decrease of cell viability and membrane integrity, and the increase of pro-caspase-1, GSDMD, and proinflammatory factors IL-1beta and IL-18.	Chloroquine	66-68	nucleoporin 62	Homo sapiens	106-109
33886081-4	2021	Western blotting, qRT-PCR and ELISA also showed that chloroquine (CQ) could up-regulate the expression of p62 through impairing autophagy and induce the pyroptosis of macrophages treated by ox-LDL, as evidenced by the decrease of cell viability and membrane integrity, and the increase of pro-caspase-1, GSDMD, and proinflammatory factors IL-1beta and IL-18.	Chloroquine	66-68	gasdermin D	Homo sapiens	304-309
33886081-4	2021	Western blotting, qRT-PCR and ELISA also showed that chloroquine (CQ) could up-regulate the expression of p62 through impairing autophagy and induce the pyroptosis of macrophages treated by ox-LDL, as evidenced by the decrease of cell viability and membrane integrity, and the increase of pro-caspase-1, GSDMD, and proinflammatory factors IL-1beta and IL-18.	Chloroquine	66-68	interleukin 1 alpha	Homo sapiens	339-347
33886081-4	2021	Western blotting, qRT-PCR and ELISA also showed that chloroquine (CQ) could up-regulate the expression of p62 through impairing autophagy and induce the pyroptosis of macrophages treated by ox-LDL, as evidenced by the decrease of cell viability and membrane integrity, and the increase of pro-caspase-1, GSDMD, and proinflammatory factors IL-1beta and IL-18.	Chloroquine	66-68	interleukin 18	Homo sapiens	352-357
33995033-6	2021	Interestingly, treatment with chloroquine and/or non-steroidal anti-inflammatory drugs counteracted the SARS-CoV-2 induced reduction of DUSP1 and DUSP5 genes expression.	Chloroquine	30-41	dual specificity phosphatase 1	Homo sapiens	136-141
33919392-7	2021	CTSL activation is specific to QC-induced autophagy since no CTSL activation is seen in ATG5 knockout cells or with the anti-malarial autophagy-inhibiting drug chloroquine.	Chloroquine	160-171	cathepsin L	Homo sapiens	0-4
33995033-6	2021	Interestingly, treatment with chloroquine and/or non-steroidal anti-inflammatory drugs counteracted the SARS-CoV-2 induced reduction of DUSP1 and DUSP5 genes expression.	Chloroquine	30-41	dual specificity phosphatase 5	Homo sapiens	146-151
33876698-0	2021	Binding of hydroxychloroquine and chloroquine dimers to palmitoyl-protein thioesterase 1 (PPT1) and its glycosylated forms: a computational approach.	Chloroquine	18-29	palmitoyl-protein thioesterase 1	Homo sapiens	56-88
33875422-10	2021	Between one in three and one in six individuals harbored reduced activity alleles of CYP2A6, CYP2B6, CYP2D6 and CYP2C8 with important implications for artemisinin, chloroquine and amodiaquine therapy.	Chloroquine	164-175	cytochrome P450 family 2 subfamily A member 6	Homo sapiens	85-91
33876698-0	2021	Binding of hydroxychloroquine and chloroquine dimers to palmitoyl-protein thioesterase 1 (PPT1) and its glycosylated forms: a computational approach.	Chloroquine	18-29	palmitoyl-protein thioesterase 1	Homo sapiens	90-94
33875422-10	2021	Between one in three and one in six individuals harbored reduced activity alleles of CYP2A6, CYP2B6, CYP2D6 and CYP2C8 with important implications for artemisinin, chloroquine and amodiaquine therapy.	Chloroquine	164-175	cytochrome P450 family 2 subfamily B member 6	Homo sapiens	93-99
33875422-10	2021	Between one in three and one in six individuals harbored reduced activity alleles of CYP2A6, CYP2B6, CYP2D6 and CYP2C8 with important implications for artemisinin, chloroquine and amodiaquine therapy.	Chloroquine	164-175	cytochrome P450 family 2 subfamily D member 6	Homo sapiens	101-107
33875422-10	2021	Between one in three and one in six individuals harbored reduced activity alleles of CYP2A6, CYP2B6, CYP2D6 and CYP2C8 with important implications for artemisinin, chloroquine and amodiaquine therapy.	Chloroquine	164-175	cytochrome P450 family 2 subfamily C member 8	Homo sapiens	112-118
33690217-4	2021	Chloroquine increased expression of stearoyl-CoA desaturase-1 (scd1), the enzyme mediating fatty acid saturation status, suggesting that a shift towards mono-unsaturated fatty acids relieved toxicity.	Chloroquine	0-11	stearoyl-CoA desaturase (delta-9-desaturase)	Danio rerio	36-61
33593821-3	2021	To determine how the metabolic vulnerabilities of TSC2-deficient cells can be targeted, we performed a high throughput screen utilizing the "Repurposing" library at the Broad Institute, with or without the autophagy inhibitor chloroquine.	Chloroquine	226-237	TSC complex subunit 2	Mus musculus	50-54
33518803-2	2021	Herein we present the effect of chloroquine (CLQ) on human ACE2 receptor.	Chloroquine	32-43	angiotensin converting enzyme 2	Homo sapiens	59-63
33518803-2	2021	Herein we present the effect of chloroquine (CLQ) on human ACE2 receptor.	Chloroquine	45-48	angiotensin converting enzyme 2	Homo sapiens	59-63
33690217-4	2021	Chloroquine increased expression of stearoyl-CoA desaturase-1 (scd1), the enzyme mediating fatty acid saturation status, suggesting that a shift towards mono-unsaturated fatty acids relieved toxicity.	Chloroquine	0-11	stearoyl-CoA desaturase (delta-9-desaturase)	Danio rerio	63-67
33518803-4	2021	Furthermore, molecular dynamics (MD) studies with CLQ docked ACE2 results in large fluctuations on RMSD up to 2.3 ns, indicating conformational and rotational changes due to the presence of drug molecule in the ACE2 moiety.	Chloroquine	50-53	angiotensin converting enzyme 2	Homo sapiens	61-65
33518803-4	2021	Furthermore, molecular dynamics (MD) studies with CLQ docked ACE2 results in large fluctuations on RMSD up to 2.3 ns, indicating conformational and rotational changes due to the presence of drug molecule in the ACE2 moiety.	Chloroquine	50-53	angiotensin converting enzyme 2	Homo sapiens	211-215
33690217-5	2021	In human ALD fibroblasts chloroquine also increased SCD1 levels and reduced saturated VLCFAs.	Chloroquine	25-36	stearoyl-CoA desaturase	Homo sapiens	52-56
33518803-6	2021	We believed that this work will help researchers to understand better the effect of CLQ on ACE2.	Chloroquine	84-87	angiotensin converting enzyme 2	Homo sapiens	91-95
32160082-10	2021	In vivo, inhibition of the P2RY12 receptor promoted autophagy of VSMCs through PI3K-AKT-MTOR in advanced atherosclerosis in apoe-/- mice, which could be impeded by an autophagy inhibitor (chloroquine).	Chloroquine	188-199	purinergic receptor P2Y, G-protein coupled 12	Mus musculus	27-33
33919804-6	2021	Ex vivo studies using the lysosomal inhibitor chloroquine confirmed that SB505124 enhanced autophagy flux in the injured hemisphere, with a significant accumulation of the autophagic proteins LC3 and p62 in SB505124 + chloroquine treated brain slices.	Chloroquine	218-229	KH RNA binding domain containing, signal transduction associated 1	Rattus norvegicus	200-203
33827587-7	2021	RESULTS: The two most important alleles for CQ resistance, crt 76T and mdr1 86Y, were found at respective frequencies of 71.4% and 6.5%.	Chloroquine	44-46	ATP binding cassette subfamily B member 1	Homo sapiens	71-75
32704040-7	2021	Furthermore, we showed that the enhanced lysosomal function by overexpression of transcription factor EB (TFEB) significantly increased MCF-7 cells resistance to doxorubicin (DOX), whereas the decreased lysosomal function by TFEB-knockdown or lysosome inhibitor chloroquine increased MCF-7 cells sensitivity to DOX.	Chloroquine	262-273	transcription factor EB	Homo sapiens	81-104
33787285-7	2021	In the preventive protocol, administration (days -3 to 21 after monocrotaline injection) of selective (E6446) or nonselective TLR9 inhibitor (chloroquine) significantly ameliorated the elevations of right ventricular systolic pressure and total pulmonary vascular resistance index as well as vascular remodeling and macrophage accumulation on day 21.	Chloroquine	142-153	toll-like receptor 9	Rattus norvegicus	126-130
33880372-7	2021	The autophagy inhibitor 3-methyladenine and chloroquine decreased apoptosis and cleaved-caspase-3 protein level and increased the Bcl-2/Bax ratio.	Chloroquine	44-55	BCL2 apoptosis regulator	Homo sapiens	130-135
33880372-7	2021	The autophagy inhibitor 3-methyladenine and chloroquine decreased apoptosis and cleaved-caspase-3 protein level and increased the Bcl-2/Bax ratio.	Chloroquine	44-55	BCL2 associated X, apoptosis regulator	Homo sapiens	136-139
33515072-12	2021	Chloroquine elicited accumulation of autophagosomes in the islets of NOR (p = 0.003) and non-diabetic NOD mice (p < 0.001), but not in islets of diabetic NOD mice; and stimulated accumulation of p62 in NOR (p < 0.001), but not in NOD mice.	Chloroquine	0-11	nucleoporin 62	Mus musculus	195-198
32997351-11	2021	CYP2C19 inhibition is attributed to higher level of circulating pro-inflammatory cytokines, while suppression of CYP2D6 is ascribed mainly to chloroquine exposure.	Chloroquine	142-153	cytochrome P450 family 2 subfamily D member 6	Homo sapiens	113-119
33725110-6	2021	DAO degradation was found to be inhibited by chloroquine, but not by MG132 treatment.	Chloroquine	45-56	D-amino acid oxidase	Sus scrofa	0-3
33358892-7	2021	Studies with PAFR antagonists have shown promising results such as inhibition of neovascularization and chloroquine-induced retinopathies, as well as reducing inflammation and retinal cell death.	Chloroquine	104-115	platelet activating factor receptor	Homo sapiens	13-17
33753496-7	2021	LTC4-mediated itch differed in bout duration and kinetics from pruritogens histamine, compound 48/80, and chloroquine.	Chloroquine	106-117	itchy, E3 ubiquitin protein ligase	Mus musculus	14-18
33726796-9	2021	In addition, blocking autophagy by chloroquine abolished the promoting effect of YAP on glioma growth.	Chloroquine	35-46	Yes1 associated transcriptional regulator	Homo sapiens	81-84
33781188-13	2021	Furthermore, one of these studies reported the binding of chloroquine and hydroxychloroquine to Mpro.	Chloroquine	58-69	NEWENTRY	Severe acute respiratory syndrome-related coronavirus	96-100
33748159-7	2021	Furthermore, cheek injection of histamine and CQ enhanced the mRNA expression of TRPV1 and TRPA1 but not TRPM8 in the TG.	Chloroquine	46-48	transient receptor potential cation channel, subfamily V, member 1	Mus musculus	81-86
33629841-2	2021	We have systematically studied the structure-activity relationship of the 4-amino-7-chloroquinoline scaffold contained in Nurr1 activators amodiaquine and chloroquine and discovered fragment-like analogues that activated Nurr1 in several cellular settings.	Chloroquine	155-166	nuclear receptor subfamily 4 group A member 2	Homo sapiens	122-127
33629841-2	2021	We have systematically studied the structure-activity relationship of the 4-amino-7-chloroquinoline scaffold contained in Nurr1 activators amodiaquine and chloroquine and discovered fragment-like analogues that activated Nurr1 in several cellular settings.	Chloroquine	155-166	nuclear receptor subfamily 4 group A member 2	Homo sapiens	221-226
33726812-5	2021	Mice with conditional knock-out of alpha1A-ARs in inhibitory interneurons (Vgat-Cre;Adra1aflox/flox mice) exhibited an increase in scratching behavior when induced by an intradermal injection of chloroquine, but not compound 48/80, which are known as models of histamine-independent and dependent itch, respectively.	Chloroquine	195-206	B cell leukemia/lymphoma 2 related protein A1a	Mus musculus	35-42
33726812-5	2021	Mice with conditional knock-out of alpha1A-ARs in inhibitory interneurons (Vgat-Cre;Adra1aflox/flox mice) exhibited an increase in scratching behavior when induced by an intradermal injection of chloroquine, but not compound 48/80, which are known as models of histamine-independent and dependent itch, respectively.	Chloroquine	195-206	solute carrier family 32 (GABA vesicular transporter), member 1	Mus musculus	75-79
33726812-5	2021	Mice with conditional knock-out of alpha1A-ARs in inhibitory interneurons (Vgat-Cre;Adra1aflox/flox mice) exhibited an increase in scratching behavior when induced by an intradermal injection of chloroquine, but not compound 48/80, which are known as models of histamine-independent and dependent itch, respectively.	Chloroquine	195-206	adrenergic receptor, alpha 1d	Mus musculus	84-89
33726812-6	2021	Furthermore, knockout of inhibitory neuronal alpha1A-ARs in the SDH using the CRISPR-Cas9 system also increased the scratching behavior elicited by chloroquine but not compound 48/80.	Chloroquine	148-159	B cell leukemia/lymphoma 2 related protein A1a	Mus musculus	45-52
33706683-3	2021	The results of the docking simulation revealed that methyl-1,4,5-tri-O-cafeoyl quinate has a stronger bond, high affinity and gives the best docking scores compared to, the co-crystallized inhibitor (PRD_002214) of the enzyme ACE2, chloroquine, hydroxychloroquine, captopril and simerprevir antiviral drugs.	Chloroquine	232-243	angiotensin converting enzyme 2	Homo sapiens	226-230
33750821-3	2021	The endosomal acidification inhibitors (8P9R and chloroquine) can synergistically enhance the activity of arbidol, a spike-ACE2 fusion inhibitor, against SARS-CoV-2 and SARS-CoV in cells.	Chloroquine	49-60	surface glycoprotein	Severe acute respiratory syndrome coronavirus 2	117-122
33750821-3	2021	The endosomal acidification inhibitors (8P9R and chloroquine) can synergistically enhance the activity of arbidol, a spike-ACE2 fusion inhibitor, against SARS-CoV-2 and SARS-CoV in cells.	Chloroquine	49-60	angiotensin converting enzyme 2	Homo sapiens	123-127
33748159-7	2021	Furthermore, cheek injection of histamine and CQ enhanced the mRNA expression of TRPV1 and TRPA1 but not TRPM8 in the TG.	Chloroquine	46-48	transient receptor potential cation channel, subfamily A, member 1	Mus musculus	91-96
33748159-7	2021	Furthermore, cheek injection of histamine and CQ enhanced the mRNA expression of TRPV1 and TRPA1 but not TRPM8 in the TG.	Chloroquine	46-48	transient receptor potential cation channel, subfamily M, member 8	Mus musculus	105-110
33748159-8	2021	Moreover, TRPV1 and TRPA1 knockout (KO) mice exhibited attenuation of itch behavior induced by histamine and CQ, respectively.	Chloroquine	109-111	transient receptor potential cation channel, subfamily V, member 1	Mus musculus	10-15
33748159-8	2021	Moreover, TRPV1 and TRPA1 knockout (KO) mice exhibited attenuation of itch behavior induced by histamine and CQ, respectively.	Chloroquine	109-111	transient receptor potential cation channel, subfamily A, member 1	Mus musculus	20-25
32313209-0	2021	Chloroquine reduces Th17 cell differentiation by stimulating T-bet expression in T cells.	Chloroquine	0-11	T-box transcription factor 21	Homo sapiens	61-66
32070194-9	2021	Moreover, the efflux of FAs and their reuptake or subsequent extracellular trafficking to adjacent cells may play an important role in cell-to-cell lipid exchange and signaling.Abbreviations: ACTB: beta actin; ADRA1A: adrenergic receptor alpha, 1a; ALB: albumin; ATG5: autophagy related 5; ATG7: autophagy related 7; BafA1: bafilomycin A1; BECN1: beclin 1; BHBA: beta-hydroxybutyrate; BSA: bovine serum albumin; CDH1: e-cadherin; CQ: chloroquine; CTSB: cathepsin B; DGAT: diacylglycerol O-acyltransferase; FA: fatty acid; HFD: high-fat diet; LAMP1: lysosomal-associated membrane protein 1; LD: lipid droplet; LIPA/LAL: lysosomal acid lipase A; LLME: Leu-Leu methyl ester hydrobromide; MAP1LC3B/LC3: microtubule associated protein 1 light chain 3 beta; MCOLN1/TRPML1: mucolipin 1; MEF: mouse embryo fibroblast; PBS: phosphate-buffered saline; PIK3C3/VPS34: phosphatidylinositol 3-kinase catalytic subunit type 3; PLIN: perilipin; PNPLA2/ATGL patatin-like phospholipase domain containing 2; RUBCN (rubicon autophagy regulator); SM: sphingomyelin; TAG: triacylglycerol; TMEM192: transmembrane protein 192; VLDL: very low density lipoprotein.	Chloroquine	434-445	actin, beta	Mus musculus	192-196
33748286-6	2021	Furthermore, rapamycin reduced urinary protein-induced NGAL and KIM-1 secretion and cell growth inhibition, while chloroquine played the opposite effect, indicating that autophagy activation by ERK pathway was an adaptive response in the exposure to urinary proteins.	Chloroquine	114-125	mitogen-activated protein kinase 1	Homo sapiens	194-197
33535144-5	2021	In this study, we focused on identifying a more potent analogue of HCQ and CQ against the spike protein of SAR-CoV-2 that can act as an effective antiviral agent for COVID-19 treatment.	Chloroquine	68-70	surface glycoprotein	Severe acute respiratory syndrome coronavirus 2	90-95
33879967-8	2021	Accumulation of phosphorylated IRE1alpha was enhanced by the treatment with chloroquine, an autophagy inhibitor.	Chloroquine	76-87	endoplasmic reticulum (ER) to nucleus signalling 1	Mus musculus	31-40
33626233-8	2021	As a proof-of-concept, we showed that the autophagy inhibitor chloroquine improved cis-platinum treatment efficacy in vivo, with greater efficacy in PD-L1 null versus PD-L1-replete BC.	Chloroquine	62-73	CD274 molecule	Homo sapiens	149-154
33626233-8	2021	As a proof-of-concept, we showed that the autophagy inhibitor chloroquine improved cis-platinum treatment efficacy in vivo, with greater efficacy in PD-L1 null versus PD-L1-replete BC.	Chloroquine	62-73	CD274 molecule	Homo sapiens	167-172
33639976-10	2021	Moreover, in the hACE2 transgenic mice model of SARS-CoV-2 infection, chloroquine and bafilomycin A1 reduced viral replication in lung tissues and alleviated viral pneumonia with reduced inflammatory exudation and infiltration in peribronchiolar and perivascular tissues, as well as improved structures of alveolar septum and pulmonary alveoli.	Chloroquine	70-81	angiotensin converting enzyme 2	Homo sapiens	17-22
33727943-8	2021	Results: The results show that all tested compounds of sumac provided good interaction with the main active site of SARS-CoV-2 Mpro, with better, lower molecular docking energy (kcal/mol) compared to the well-known drugs chloroquine and favipiravir (Avigan).	Chloroquine	221-232	NEWENTRY	Severe acute respiratory syndrome-related coronavirus	127-131
33486901-11	2021	So, the cumulative effect of oncogenic p62 should be considered when using autophagy inhibitors, especially drugs that act at the last stage of autophagy such as chloroquine and bafilomycin A1.	Chloroquine	162-173	nucleoporin 62	Homo sapiens	39-42
33345848-0	2021	Off-label use of chloroquine, hydroxychloroquine, azithromycin and lopinavir/ritonavir in COVID-19 risks prolonging the QT interval by targeting the hERG channel.	Chloroquine	17-28	ETS transcription factor ERG	Homo sapiens	149-153
33345848-3	2021	Clinically, however, many drugs, including those currently used in COVID-19, such as chloroquine, hydroxychloroquine, azithromycin, and lopinavir/ritonavir, may cause cardiotoxicity by acting on cardiac potassium channels and the hERG channel through their off-target effects.	Chloroquine	85-96	ETS transcription factor ERG	Homo sapiens	230-234
33665135-0	2021	Chloroquine ameliorates bone loss induced by d-galactose in male rats via inhibition of ERK associated osteoclastogenesis and antioxidant effect.	Chloroquine	0-11	Eph receptor B1	Rattus norvegicus	88-91
33665135-9	2021	Furthermore, CQ treatment abated serum cathepsin-k (CTSK) and serum tartrate-resistant acid phosphatase (TRAP) thus inhibited osteoclastogenesis and consequently restored the RANKL/OPG ratio.	Chloroquine	13-15	cathepsin K	Rattus norvegicus	39-50
33665135-9	2021	Furthermore, CQ treatment abated serum cathepsin-k (CTSK) and serum tartrate-resistant acid phosphatase (TRAP) thus inhibited osteoclastogenesis and consequently restored the RANKL/OPG ratio.	Chloroquine	13-15	cathepsin K	Rattus norvegicus	52-56
33665135-9	2021	Furthermore, CQ treatment abated serum cathepsin-k (CTSK) and serum tartrate-resistant acid phosphatase (TRAP) thus inhibited osteoclastogenesis and consequently restored the RANKL/OPG ratio.	Chloroquine	13-15	acid phosphatase 5, tartrate resistant	Rattus norvegicus	68-103
33665135-9	2021	Furthermore, CQ treatment abated serum cathepsin-k (CTSK) and serum tartrate-resistant acid phosphatase (TRAP) thus inhibited osteoclastogenesis and consequently restored the RANKL/OPG ratio.	Chloroquine	13-15	acid phosphatase 5, tartrate resistant	Rattus norvegicus	105-109
33665135-9	2021	Furthermore, CQ treatment abated serum cathepsin-k (CTSK) and serum tartrate-resistant acid phosphatase (TRAP) thus inhibited osteoclastogenesis and consequently restored the RANKL/OPG ratio.	Chloroquine	13-15	TNF superfamily member 11	Rattus norvegicus	175-180
33665135-10	2021	CQ demonstrated an antioxidant effect in bone where it increased both Catalase (CAT) and Superoxide dismutase (SOD).	Chloroquine	0-2	catalase	Rattus norvegicus	70-78
33665135-10	2021	CQ demonstrated an antioxidant effect in bone where it increased both Catalase (CAT) and Superoxide dismutase (SOD).	Chloroquine	0-2	catalase	Rattus norvegicus	80-83
33665135-12	2021	The present study points to the potential therapeutic effect of CQ as anti-osteoporotic agent possibly through its antioxidant effects and suppression of ERK associated osteoclastogenesis.	Chloroquine	64-66	Eph receptor B1	Rattus norvegicus	154-157
33558461-7	2021	Noninvasive imaging of autophagic flux using a novel autophagy sensor (mtFL-p62 fusion reporter) showed that combinatorial treatment of platinum-taxol along with Trametinib/chloroquine blocked autophagic flux in live cells and tumor xenografts.	Chloroquine	173-184	nucleoporin 62	Mus musculus	76-79
33068248-7	2021	Treatment of t(8;21) AML cells with the autophagy inhibitors chloroquine (CQ) or LY294002 in combination with the CDK4/6 inhibitor abemaciclib significantly increased the percentage of apoptotic (Annexin V positive) cells, whereas CQ or LY294002 single treatment had no significant effects.	Chloroquine	61-72	annexin A5	Homo sapiens	196-205
33068248-7	2021	Treatment of t(8;21) AML cells with the autophagy inhibitors chloroquine (CQ) or LY294002 in combination with the CDK4/6 inhibitor abemaciclib significantly increased the percentage of apoptotic (Annexin V positive) cells, whereas CQ or LY294002 single treatment had no significant effects.	Chloroquine	74-76	annexin A5	Homo sapiens	196-205
33068248-7	2021	Treatment of t(8;21) AML cells with the autophagy inhibitors chloroquine (CQ) or LY294002 in combination with the CDK4/6 inhibitor abemaciclib significantly increased the percentage of apoptotic (Annexin V positive) cells, whereas CQ or LY294002 single treatment had no significant effects.	Chloroquine	231-233	cyclin dependent kinase 4	Homo sapiens	114-120
33372388-4	2021	Using Western blotting, immunoprecipitation, qPCR, immunofluorescence and Dimethylmethylene blue assays, and ELISA and transmission electron microscope techniques, we found that PLCgamma1 inhibitor U73122 enhanced Collagen II, Aggrecan and GAG levels, accompanied with increased LC3B-II/I ratio and decreased P62 expression level, whereas autophagy inhibitor Chloroquine partially diminished its effect.	Chloroquine	359-370	phospholipase C, gamma 1	Rattus norvegicus	178-187
32956540-0	2021	The effect of chloroquine on the TRPC1, TRPC6, and CaSR in the pulmonary artery smooth muscle cells in hypoxia-induced experimental pulmonary artery hypertension.	Chloroquine	14-25	calcium-sensing receptor	Rattus norvegicus	51-55
33318076-6	2021	After washout of SC-68448, release of active TGFbeta was restored, whereas after washout of compound 1 the inhibition of TGFbeta activation was maintained and only reversible in the presence of a lysosomal inhibitor (chloroquine).	Chloroquine	217-228	transforming growth factor alpha	Homo sapiens	121-128
33414432-2	2021	Here, we report that lysosomotropic agents, including azithromycin, chloroquine, and hydroxychloroquine, can trigger eIF2alpha phosphorylation in vitro (in cultured human cells) and, as validated for hydroxychloroquine, in vivo (in mice).	Chloroquine	68-79	eukaryotic translation initiation factor 2A	Homo sapiens	117-126
33479386-8	2021	Interestingly, 10, 100, and 1000 ng/ml CQ extract treatment on hWA significantly enhanced UCP1 expression in a dose-dependent manner when compared to pioglitazone treatment (p < 0.001 all).	Chloroquine	39-41	uncoupling protein 1	Homo sapiens	90-94
33479386-9	2021	In conclusion, CQ decreased waist and hip circumferences in obese humans and enhanced UCP1 mRNA in hWA suggestive of its action via browning of hWA.	Chloroquine	15-17	uncoupling protein 1	Homo sapiens	86-90
33842834-8	2021	The results of our analysis with some other suggested drugs indicated that chloroquine and hydroxychloroquine had high binding energy (low inhibitory effect) with all three proteins-Mpro, PLpro, and RdRp.	Chloroquine	75-86	NEWENTRY	Severe acute respiratory syndrome-related coronavirus	182-186
33842834-8	2021	The results of our analysis with some other suggested drugs indicated that chloroquine and hydroxychloroquine had high binding energy (low inhibitory effect) with all three proteins-Mpro, PLpro, and RdRp.	Chloroquine	75-86	ORF1a polyprotein;ORF1ab polyprotein	Severe acute respiratory syndrome coronavirus 2	188-193
33842834-8	2021	The results of our analysis with some other suggested drugs indicated that chloroquine and hydroxychloroquine had high binding energy (low inhibitory effect) with all three proteins-Mpro, PLpro, and RdRp.	Chloroquine	75-86	ORF1a polyprotein;ORF1ab polyprotein	Severe acute respiratory syndrome coronavirus 2	199-203
32942003-8	2021	The inhibition of autophagic flux by chloroquine (50 mg/kg/d) further accelerated the progression of RAA in the left common carotid arteries of ApoE-/- mice.	Chloroquine	37-48	apolipoprotein E	Mus musculus	144-148
32942003-9	2021	Furthermore, chloroquine treatment exacerbated IR-induced p65 nuclear translocation, IkappaBalpha degradation, and transcription of NF-kappaB target genes in peritoneal macrophages.	Chloroquine	13-24	v-rel reticuloendotheliosis viral oncogene homolog A (avian)	Mus musculus	58-61
32942003-9	2021	Furthermore, chloroquine treatment exacerbated IR-induced p65 nuclear translocation, IkappaBalpha degradation, and transcription of NF-kappaB target genes in peritoneal macrophages.	Chloroquine	13-24	nuclear factor of kappa light polypeptide gene enhancer in B cells inhibitor, alpha	Mus musculus	85-97
32942003-9	2021	Furthermore, chloroquine treatment exacerbated IR-induced p65 nuclear translocation, IkappaBalpha degradation, and transcription of NF-kappaB target genes in peritoneal macrophages.	Chloroquine	13-24	nuclear factor of kappa light polypeptide gene enhancer in B cells 1, p105	Mus musculus	132-141
32942003-11	2021	In addition, autophagy inhibition by chloroquine accelerates the progression of RAA lesions by stimulating NF-kappaB-mediated inflammatory responses in macrophages.	Chloroquine	37-48	nuclear factor of kappa light polypeptide gene enhancer in B cells 1, p105	Mus musculus	107-116
33316543-7	2021	As expected, chloroquine blocked lysosomal degradation of the autophagic protein LC3B-II in cell culture.	Chloroquine	13-24	microtubule-associated protein 1 light chain 3 beta	Mus musculus	81-85
33316543-10	2021	When injected into mice, chloroquine caused accumulation of LC3B-II in heart tissue, and quinacrine was effective at blocking LC3B-II degradation in male, but not female skeletal muscle.	Chloroquine	25-36	microtubule-associated protein 1 light chain 3 beta	Mus musculus	60-64
33383906-5	2020	These compounds were tested against the asexual stages of two strains of P. falciparum-the chloroquine-sensitive (D10) and chloroquine-resistant (W2) strains.	Chloroquine	91-102	CHRNA7 (exons 5-10) and FAM7A (exons A-E) fusion	Homo sapiens	114-117
32926941-9	2021	Chloroquine administration in vivo inhibited the expression of PCNA (marker of proliferation) of abdominal aorta in hypertensive rats.	Chloroquine	0-11	proliferating cell nuclear antigen	Rattus norvegicus	63-67
33496364-6	2021	However, an intra-peritoneal injection of the antioxidant N-acetyl-l-cysteine (NAC) and autophagy inhibitor chloroquine inhibited the inflammatory response, liver damage, and pexophagy in the liver of catalase-KO mice during prolonged fasting.	Chloroquine	108-119	catalase	Mus musculus	201-209
33496364-8	2021	Moreover, treatment with chloroquine also ameliorated the inflammatory response and cell death in embryonic fibroblast cells from catalase-KO mice.	Chloroquine	25-36	catalase	Mus musculus	130-138
33021603-10	2021	In functional studies, PMN incubation with mtDNA suppressed CTX in a dose dependent manner which was reversed by chloroquine, suggesting an endosomal, TLR-9 dependent mechanism.	Chloroquine	113-124	toll like receptor 9	Homo sapiens	151-156
33317171-7	2020	However, when pre-treated with chloroquine (CQ), a lysosomotropic agent and a late-stage autophagy inhibitor, OGT inhibitors significantly increased LC3-II levels along with LC3 puncta formation, indicating the stimulation of autophagic flux.	Chloroquine	31-42	O-linked N-acetylglucosamine (GlcNAc) transferase	Rattus norvegicus	110-113
33289551-4	2020	Protein NMR structural footprinting data show that amodiaquine, chloroquine, and cytosporone B bind the Nurr1 LBD; ligands that do not bind include C-DIM12, celastrol, camptothecin, IP7e, isoalantolactone, ethyl 2-[2,3,4-trimethoxy-6-(1-octanoyl)phenyl]acetate (TMPA), and three high-throughput screening hit derivatives.	Chloroquine	64-75	nuclear receptor subfamily 4 group A member 2	Homo sapiens	104-109
32988589-0	2020	Effects of the autophagy modulators d-limonene and chloroquine on vimentin levels in SH-SY5Y cells.	Chloroquine	51-62	vimentin	Homo sapiens	66-74
32988589-3	2020	However, d-limonene rapidly reduced vimentin levels, an unexpected effect also induced by the autophagy inhibitor chloroquine (CQ).	Chloroquine	114-125	vimentin	Homo sapiens	36-44
32988589-4	2020	The magnitude of vimentin reduction parallels accumulation of LC3-II caused by a brief incubation with d-limonene or CQ.	Chloroquine	117-119	vimentin	Homo sapiens	17-25
32988589-5	2020	For longer exposure (48 h), d-limonene does not reduce vimentin, nor it increases LC3-II levels; conversely, a clear reduction of vimentin along with a massive accumulation of LC3-II is evident in cells treated with CQ.	Chloroquine	216-218	vimentin	Homo sapiens	130-138
32988589-8	2020	Further experiments are needed to dissect the role of vimentin reduction in the mechanisms through which CQ impairs fusion of autophagosome with lysosomes as well as in other effects of this drug.	Chloroquine	105-107	vimentin	Homo sapiens	54-62
33437375-9	2020	Notably, the effect of Adora2B on autophagy flux and cardiomyocyte protection could be mitigated by autophagy inhibitor chloroquine.	Chloroquine	120-131	adenosine A2b receptor	Mus musculus	23-30
33322305-3	2020	RT4 cells were treated with fMLF at various concentrations and times with and without pretreatment with inhibitors (chloroquine for activated TLR9, PBP10 for Fpr2).	Chloroquine	116-127	toll like receptor 9	Homo sapiens	142-146
33332057-0	2020	[Chloroquine for COVID-19: a hype or not?]	Chloroquine	1-12	FIC domain protein adenylyltransferase	Homo sapiens	29-33
33332057-1	2020	In March the CEO of Tesla, Elon Musk, posted a Tweet about the possible effects of chloroquine for COVID-19.	Chloroquine	83-94	muscle associated receptor tyrosine kinase	Homo sapiens	32-36
33448178-11	2020	In the AD cell model, the results of MTT assay were consistent with the animal experiments, and the protective effect of Sirt3 knockdown was eliminated after the treatment of the autophagy inhibitor chloroquine (all P<0.05).	Chloroquine	199-210	sirtuin 3	Mus musculus	121-126
33398283-4	2020	Chloroquine alleviated ORF3a induced phenotypes in the CNS, arguing our Drosophila model is amenable to high throughput drug screening.	Chloroquine	0-11	tarsal-less 3A	Drosophila melanogaster	23-28
33398283-6	2020	Highlights: SARS-CoV-2 ORF3a is pathogenic in the nervous system.ORF3a induces cell death, inflammation, and lysosome dysfunction.Chloroquine protects against ORF3a induced CNS distress and lysosome dysfunction.	Chloroquine	130-141	ORF3a protein	Severe acute respiratory syndrome coronavirus 2	23-28
33398283-6	2020	Highlights: SARS-CoV-2 ORF3a is pathogenic in the nervous system.ORF3a induces cell death, inflammation, and lysosome dysfunction.Chloroquine protects against ORF3a induced CNS distress and lysosome dysfunction.	Chloroquine	130-141	ORF3a protein	Severe acute respiratory syndrome coronavirus 2	65-70
33398283-6	2020	Highlights: SARS-CoV-2 ORF3a is pathogenic in the nervous system.ORF3a induces cell death, inflammation, and lysosome dysfunction.Chloroquine protects against ORF3a induced CNS distress and lysosome dysfunction.	Chloroquine	130-141	ORF3a protein	Severe acute respiratory syndrome coronavirus 2	65-70
33453994-7	2020	Consistent with high-dose liproxstatin-1 protecting via a lysosomal mechanism, we further de-monstrated that loss of viability induced by alpha-synuclein PFFs was attenuated by chloroquine and bafilomycin A1 as well as the lysosomal cysteine protease inhibitors, leupeptin, E-64D, and Ca-074-Me, but not other autophagy or lysosomal enzyme inhibitors.	Chloroquine	177-188	synuclein, alpha	Mus musculus	138-153
33317171-7	2020	However, when pre-treated with chloroquine (CQ), a lysosomotropic agent and a late-stage autophagy inhibitor, OGT inhibitors significantly increased LC3-II levels along with LC3 puncta formation, indicating the stimulation of autophagic flux.	Chloroquine	44-46	O-linked N-acetylglucosamine (GlcNAc) transferase	Rattus norvegicus	110-113
33302495-5	2020	Upon inhibition of lysosomal function by a specific blocker, chloroquine (CLQ), we comprehensively clarified a novel function of lysosomes on mediating proteolytic degradation of c-Fms and RANK surface receptors, drastically ameliorated by Rab11b overexpression in RAW-D cell-derived osteoclasts.	Chloroquine	61-72	colony stimulating factor 1 receptor	Mus musculus	179-184
33302495-5	2020	Upon inhibition of lysosomal function by a specific blocker, chloroquine (CLQ), we comprehensively clarified a novel function of lysosomes on mediating proteolytic degradation of c-Fms and RANK surface receptors, drastically ameliorated by Rab11b overexpression in RAW-D cell-derived osteoclasts.	Chloroquine	61-72	RAB11B, member RAS oncogene family	Mus musculus	240-246
33302495-5	2020	Upon inhibition of lysosomal function by a specific blocker, chloroquine (CLQ), we comprehensively clarified a novel function of lysosomes on mediating proteolytic degradation of c-Fms and RANK surface receptors, drastically ameliorated by Rab11b overexpression in RAW-D cell-derived osteoclasts.	Chloroquine	74-77	colony stimulating factor 1 receptor	Mus musculus	179-184
33302495-5	2020	Upon inhibition of lysosomal function by a specific blocker, chloroquine (CLQ), we comprehensively clarified a novel function of lysosomes on mediating proteolytic degradation of c-Fms and RANK surface receptors, drastically ameliorated by Rab11b overexpression in RAW-D cell-derived osteoclasts.	Chloroquine	74-77	RAB11B, member RAS oncogene family	Mus musculus	240-246
32521191-4	2020	One first proposed clinical trial has drawn worldwide hype to the benefit of chloroquine (CQ), in the treatment of patients infected by the recently emerged deadly coronavirus (SARS-CoV-2).	Chloroquine	77-88	FIC domain protein adenylyltransferase	Homo sapiens	54-58
33277461-0	2020	Chloroquine reverses chemoresistance via upregulation of p21WAF1/CIP1 and autophagy inhibition in ovarian cancer.	Chloroquine	0-11	cyclin dependent kinase inhibitor 1A	Homo sapiens	57-69
33277461-12	2020	These results demonstrated that CQ increases cytotoxicity in combination with CDDP by inducing lethal DNA damage by induction of p21WAF1/CIP1 expression and autophagy inhibition in CDDP-resistant EOC.	Chloroquine	32-34	cyclin dependent kinase inhibitor 1A	Homo sapiens	129-141
31992125-7	2020	The progenitor-specific mouse model of ATG7 inhibition confirms the requirement of autophagy for white/beige adipocyte turnover, and combined to in vitro experiments, reveal progenitor autophagy dependence for AT fibrogenic response to HFD, through the paracrine remodeling of TGF-BMP factors balance.Abbreviations: CQ: chloroquine; ECM: extracellular matrix; EpiAT: epididymal adipose tissue; GTF2IRD1: general transcription factor II I repeat domain-containing 1; HFD: high-fat diet; KO: knockout; OvAT: ovarian adipose tissue; PDGFR: platelet derived growth factor receptor; ScAT: subcutaneous adipose tissue; TGF-BMP: transforming growth factor-bone morphogenic protein.	Chloroquine	320-331	autophagy related 7	Mus musculus	39-43
33313438-7	2020	Importantly, genetic (using AGER siRNA) or pharmacological (using glycyrrhizin, chloroquine, hydroxychloroquine, and FPS-ZM1) inhibition of the HMGB1-AGER pathway blocks ACE2 expression.	Chloroquine	80-91	high mobility group box 1	Homo sapiens	144-149
33313438-7	2020	Importantly, genetic (using AGER siRNA) or pharmacological (using glycyrrhizin, chloroquine, hydroxychloroquine, and FPS-ZM1) inhibition of the HMGB1-AGER pathway blocks ACE2 expression.	Chloroquine	80-91	advanced glycosylation end-product specific receptor	Homo sapiens	150-154
33511016-3	2021	This study shows that autophagy and fibroblast growth factor receptor 1 signaling pathways are both activated in AZD9291 resistant NSCLC, and inhibition of them, respectively, by chloroquine (CQ) and PD173074 can synergistically reverse AZD9291 resistance.	Chloroquine	179-190	fibroblast growth factor receptor 1	Homo sapiens	36-71
33511016-3	2021	This study shows that autophagy and fibroblast growth factor receptor 1 signaling pathways are both activated in AZD9291 resistant NSCLC, and inhibition of them, respectively, by chloroquine (CQ) and PD173074 can synergistically reverse AZD9291 resistance.	Chloroquine	192-194	fibroblast growth factor receptor 1	Homo sapiens	36-71
32522067-7	2020	In this short perspective, we discuss the roles of CQ/HCQ in the treatment of COVID-19 patients and propose new ways of possible treatment for SARS-CoV-2 infection based on the molecules that selectivity target autophagy.Abbreviation: ACE2: angiotensin I converting enzyme 2; CoV: coronavirus; CQ: chloroquine; ER: endoplasmic reticulum; HCQ: hydroxychloroquine; MERS-CoV: Middle East respiratory syndrome coronavirus; SARS-CoV: severe acute respiratory syndrome coronavirus; SARS-CoV-2: severe acute respiratory syndrome coronavirus 2.	Chloroquine	298-309	angiotensin converting enzyme 2	Homo sapiens	235-239
32521191-4	2020	One first proposed clinical trial has drawn worldwide hype to the benefit of chloroquine (CQ), in the treatment of patients infected by the recently emerged deadly coronavirus (SARS-CoV-2).	Chloroquine	90-92	FIC domain protein adenylyltransferase	Homo sapiens	54-58
32892310-7	2020	In vitro experiments, TXNIP gene silencing enhanced LC3B-I conversion to LC3B-II, reduced the protein level of P62, decreased autophagosome accumulation induced by FFA treatment, increased the glucose-stimulated insulin secretion (GSIS) and autophagic flux inhibited by treatment with CQ.	Chloroquine	285-287	thioredoxin interacting protein	Mus musculus	22-27
32933997-0	2020	Chloroquine sensitizes GNAQ/11-mutated melanoma to MEK1/2 inhibition.	Chloroquine	0-11	mitogen-activated protein kinase kinase 1	Homo sapiens	51-57
32920291-0	2020	Chloroquine and hydroxychloroquine as ACE2 blockers to inhibit viropexis of 2019-nCoV Spike pseudotyped virus.	Chloroquine	0-11	surface glycoprotein	Severe acute respiratory syndrome coronavirus 2	86-91
33254688-10	2020	Conversely, chloroquine, an autophagic flux inhibitor, exacerbated PFOA-induced lipid accumulation and NLRP3 inflammasome activation.	Chloroquine	12-23	NLR family pyrin domain containing 3	Homo sapiens	103-108
32956664-4	2020	The result indicate that Molecules N  3, 7 and 14 have more binding energy with SARS-CoV-2 main protease recently crystallized (pdb code 6LU7) in comparison with the other imidazole derivatives and the two drug; Chloroquine and hydroxychloroquine.	Chloroquine	212-223	n  3, 7 and 14	None	35-49
32920291-6	2020	We further analyzed the binding character of CQ and HCQ to ACE2 by molecular docking and surface plasmon resonance (SPR) assays, 2019-nCoV spike pseudotyped virus was also used to observe the viropexis effect of CQ and HCQ in ACE2h cells.	Chloroquine	53-55	angiotensin converting enzyme 2	Homo sapiens	59-63
32920291-7	2020	RESULTS: Results showed that HCQ is slightly more toxic to ACE2h cells than CQ.	Chloroquine	30-32	angiotensin converting enzyme 2	Homo sapiens	59-63
32920291-4	2020	PURPOSE: The objective of this study is to investigate whether CQ and HCQ could be ACE2 blockers and used to inhibit 2019-nCoV virus infection.	Chloroquine	63-65	angiotensin converting enzyme 2	Homo sapiens	83-87
32920291-8	2020	Both CQ and HCQ could bind to ACE2 with KD = (7.31 +- 0.62)e-7 M and (4.82 +- 0.87)e-7 M, respectively.	Chloroquine	5-7	angiotensin converting enzyme 2	Homo sapiens	30-34
32920291-5	2020	METHODS: In our study, we used CCK-8 staining, flow cytometry and immunofluorescent staining to evaluate the toxicity and autophagy of CQ and HCQ, respectively, on ACE2 high-expressing HEK293T cells (ACE2h cells).	Chloroquine	135-137	angiotensin converting enzyme 2	Homo sapiens	164-168
32920291-10	2020	CONCLUSIONS: CQ and HCQ both inhibit the entrance 2019-nCoV into cells by blocking the binding of the virus with ACE2.	Chloroquine	13-15	angiotensin converting enzyme 2	Homo sapiens	113-117
32920291-5	2020	METHODS: In our study, we used CCK-8 staining, flow cytometry and immunofluorescent staining to evaluate the toxicity and autophagy of CQ and HCQ, respectively, on ACE2 high-expressing HEK293T cells (ACE2h cells).	Chloroquine	135-137	angiotensin converting enzyme 2	Homo sapiens	200-204
32920291-6	2020	We further analyzed the binding character of CQ and HCQ to ACE2 by molecular docking and surface plasmon resonance (SPR) assays, 2019-nCoV spike pseudotyped virus was also used to observe the viropexis effect of CQ and HCQ in ACE2h cells.	Chloroquine	45-47	angiotensin converting enzyme 2	Homo sapiens	59-63
33176880-11	2020	Favipiravir, chloroquine and hydroxychloroquine also showed some significant MPro inhibition.	Chloroquine	13-24	NEWENTRY	Severe acute respiratory syndrome-related coronavirus	77-81
33292257-15	2020	Furthermore, the inhibition effect of silencing Aurora-B on migration and invasion of OS was reversed by chloroquine and mTOR activator in vitro and vivo.	Chloroquine	105-116	aurora kinase B	Homo sapiens	48-56
33168592-6	2020	We found that TGFbeta1, chloroquine and MG132 had little effect on ATG protein levels but increased LC3 lipidation, LC3 puncta formation and autophagosome-lysosome co-localization.	Chloroquine	24-35	microtubule associated protein 1 light chain 3 alpha	Homo sapiens	100-103
33168592-6	2020	We found that TGFbeta1, chloroquine and MG132 had little effect on ATG protein levels but increased LC3 lipidation, LC3 puncta formation and autophagosome-lysosome co-localization.	Chloroquine	24-35	microtubule associated protein 1 light chain 3 alpha	Homo sapiens	116-119
33010342-3	2020	Chloroquine, BAM-822, and SLIGRL respectively bind to Mas-related G-protein-coupled receptors MrgprA3, MrgprC11, and MrgprC11/PAR2 that in turn activate TRPA1.	Chloroquine	0-11	MAS-related GPR, member A3	Mus musculus	94-101
33010342-3	2020	Chloroquine, BAM-822, and SLIGRL respectively bind to Mas-related G-protein-coupled receptors MrgprA3, MrgprC11, and MrgprC11/PAR2 that in turn activate TRPA1.	Chloroquine	0-11	MAS-related GPR, member X1	Mus musculus	103-111
33010342-3	2020	Chloroquine, BAM-822, and SLIGRL respectively bind to Mas-related G-protein-coupled receptors MrgprA3, MrgprC11, and MrgprC11/PAR2 that in turn activate TRPA1.	Chloroquine	0-11	MAS-related GPR, member X1	Mus musculus	117-125
33010342-3	2020	Chloroquine, BAM-822, and SLIGRL respectively bind to Mas-related G-protein-coupled receptors MrgprA3, MrgprC11, and MrgprC11/PAR2 that in turn activate TRPA1.	Chloroquine	0-11	pulmonary adenoma resistance 2	Mus musculus	126-130
33010342-3	2020	Chloroquine, BAM-822, and SLIGRL respectively bind to Mas-related G-protein-coupled receptors MrgprA3, MrgprC11, and MrgprC11/PAR2 that in turn activate TRPA1.	Chloroquine	0-11	transient receptor potential cation channel, subfamily A, member 1	Mus musculus	153-158
33010342-8	2020	In contrast, pretreatment with the TRPA1 antagonist significantly reduced thermal hyperalgesia and mechanical allodynia elicited by chloroquine (p<0.001 and, p<0.0001, respectively), BAM-822 (p<0.01, p<0.001, respectively) and SLGRL (p<0.05, p<0.001, respectively), indicating that effects elicited by these non-histaminergic itch mediators require TRPA1.	Chloroquine	132-143	transient receptor potential cation channel, subfamily A, member 1	Mus musculus	35-40
33200683-6	2022	Inspired by this fact, we have carried out molecular docking and dynamics simulation studies of FDA approved CQ and HCQ against SARS-CoV-2 PLpro.	Chloroquine	109-111	ORF1a polyprotein;ORF1ab polyprotein	Severe acute respiratory syndrome coronavirus 2	139-144
33200683-9	2022	We showed that the CQ and HCQ can bind with better binding affinity with PLpro as compared to reference known PLpro inhibitor.	Chloroquine	19-21	ORF1a polyprotein;ORF1ab polyprotein	Severe acute respiratory syndrome coronavirus 2	73-78
33200683-9	2022	We showed that the CQ and HCQ can bind with better binding affinity with PLpro as compared to reference known PLpro inhibitor.	Chloroquine	19-21	ORF1a polyprotein;ORF1ab polyprotein	Severe acute respiratory syndrome coronavirus 2	110-115
33200683-10	2022	Based on the presented findings, it can be anticipated that the SARS-CoV-2 PLpro may act as molecular target of CQ and HCQ, and can be projected for further exploration to design potent inhibitors of SARS-CoV-2 PLpro in the near future.	Chloroquine	112-114	ORF1a polyprotein;ORF1ab polyprotein	Severe acute respiratory syndrome coronavirus 2	75-80
33200683-10	2022	Based on the presented findings, it can be anticipated that the SARS-CoV-2 PLpro may act as molecular target of CQ and HCQ, and can be projected for further exploration to design potent inhibitors of SARS-CoV-2 PLpro in the near future.	Chloroquine	112-114	ORF1a polyprotein;ORF1ab polyprotein	Severe acute respiratory syndrome coronavirus 2	211-216
33135724-8	2020	We observed that stimulation of Rab10 and Rab12 phosphorylation induced by agents that stress the endolysosomal system (nigericin, monensin, chloroquine, and LLOMe) was not blocked in Rab29 deficient mouse embryonic fibroblasts.	Chloroquine	141-152	RAB10, member RAS oncogene family	Mus musculus	32-37
33135724-8	2020	We observed that stimulation of Rab10 and Rab12 phosphorylation induced by agents that stress the endolysosomal system (nigericin, monensin, chloroquine, and LLOMe) was not blocked in Rab29 deficient mouse embryonic fibroblasts.	Chloroquine	141-152	RAB12, member RAS oncogene family	Mus musculus	42-47
32382733-1	2020	On human lung parenchymal explants, chloroquine concentration clinically achievable in the lung (100 muM) inhibited the lipopolysaccharide-induced release of TNF-alpha (by 76%), IL-6 (by 68%), CCL2 (by 72%) and CCL3 (by 67%).	Chloroquine	36-47	tumor necrosis factor	Homo sapiens	158-167
32382733-1	2020	On human lung parenchymal explants, chloroquine concentration clinically achievable in the lung (100 muM) inhibited the lipopolysaccharide-induced release of TNF-alpha (by 76%), IL-6 (by 68%), CCL2 (by 72%) and CCL3 (by 67%).	Chloroquine	36-47	interleukin 6	Homo sapiens	178-182
32382733-1	2020	On human lung parenchymal explants, chloroquine concentration clinically achievable in the lung (100 muM) inhibited the lipopolysaccharide-induced release of TNF-alpha (by 76%), IL-6 (by 68%), CCL2 (by 72%) and CCL3 (by 67%).	Chloroquine	36-47	C-C motif chemokine ligand 2	Homo sapiens	193-197
32382733-1	2020	On human lung parenchymal explants, chloroquine concentration clinically achievable in the lung (100 muM) inhibited the lipopolysaccharide-induced release of TNF-alpha (by 76%), IL-6 (by 68%), CCL2 (by 72%) and CCL3 (by 67%).	Chloroquine	36-47	C-C motif chemokine ligand 3	Homo sapiens	211-215
33184425-7	2020	Pharmacological inhibition of autophagy by chloroquine exacerbated the AVP neuronal loss due to BiP knockdown, indicating a protective role of autophagy in AVP neurons under ER stress.	Chloroquine	43-54	heat shock protein 5	Mus musculus	96-99
33184425-7	2020	Pharmacological inhibition of autophagy by chloroquine exacerbated the AVP neuronal loss due to BiP knockdown, indicating a protective role of autophagy in AVP neurons under ER stress.	Chloroquine	43-54	arginine vasopressin	Mus musculus	71-74
33176643-8	2021	RESULTS: Nimbocinol (-7.6 Kcal/mol) and sage (-7.3 Kcal/mol) exhibited maximum BA against PLpro SARS-CoV-2 as evident from molecular docking study which was found to be even better than remdesivir (-6.1 Kcal/mol), chloroquine (-5.3 Kcal/mol) and favipiravir (-5.7 Kcal/mol).	Chloroquine	214-225	ORF1a polyprotein;ORF1ab polyprotein	Severe acute respiratory syndrome coronavirus 2	90-95
32536619-0	2020	Crotamiton, an Anti-Scabies Agent, Suppresses Histamine- and Chloroquine-Induced Itch Pathways in Sensory Neurons and Alleviates Scratching in Mice.	Chloroquine	61-72	itchy, E3 ubiquitin protein ligase	Mus musculus	81-85
32786685-7	2020	The drug repurposing study revealed the high potential of noscapine and proximal binding to the Mpro enzyme in a comparative binding pattern analyzed with chloroquine, ribavirin, and favipiravir.	Chloroquine	155-166	NEWENTRY	Severe acute respiratory syndrome-related coronavirus	96-100
32763298-5	2020	Cytochrome P450 (CYP450) and its isoforms are the main metabolizers of HCQ and CQ.	Chloroquine	72-74	cytochrome P450 family 4 subfamily F member 3	Homo sapiens	0-15
33051297-8	2020	Additionally, hydroxychloroquine (Ki = 0.36 microM) and chloroquine (Ki = 0.56 microM) were also found to potently inhibit SARS-CoV-2 Mpro We anticipate that the FEP-ABFE prediction-based virtual screening approach will be useful in many other drug repurposing or discovery efforts.	Chloroquine	21-32	NEWENTRY	Severe acute respiratory syndrome-related coronavirus	134-138
32935491-2	2020	The aim of this study was to assess the therapeutic potential of the TLR9 pathway inhibitor chloroquine in CRS mice.	Chloroquine	92-103	toll-like receptor 9	Mus musculus	69-73
32536619-8	2020	Similarly, it also blocked chloroquine-induced calcium influx in HEK293T cells, expressing both Mas-related G-protein-coupled receptor A3 (MRGPRA3) and transient receptor potential A1 (TRPA1), as a model of histamine-independent itching.	Chloroquine	27-38	transient receptor potential cation channel subfamily A member 1	Homo sapiens	152-183
32536619-8	2020	Similarly, it also blocked chloroquine-induced calcium influx in HEK293T cells, expressing both Mas-related G-protein-coupled receptor A3 (MRGPRA3) and transient receptor potential A1 (TRPA1), as a model of histamine-independent itching.	Chloroquine	27-38	transient receptor potential cation channel subfamily A member 1	Homo sapiens	185-190
32830075-10	2020	Plasma MDA and TNF-alpha concentrations were significantly lowered, and IL-10 concentration was significantly increased in GT100 + CQ and GT250 + CQ groups, relative to the IC group (P < 0.05).	Chloroquine	131-133	interleukin 10	Mus musculus	72-77
33178023-8	2020	Among them, 3-methyladenine, SBI-0206965, Chloroquine, and Bafilomycin A1 triggered BAX- and/or BAK-dependent cytotoxicity and caspase activation.	Chloroquine	42-53	BCL2 associated X, apoptosis regulator	Homo sapiens	84-87
33142674-9	2020	More importantly, inhibition of the lysosomal activity by chloroquine, we found that the endogenous levels of c-fms and RANK proteins were enhanced in osteoclasts.	Chloroquine	58-69	colony stimulating factor 1 receptor	Mus musculus	110-115
32919031-3	2020	We have previously reported that chloroquine-induced lysosomal stress facilitates LRRK2 phosphorylation of Rab10 to maintain lysosomal homeostasis.	Chloroquine	33-44	leucine rich repeat kinase 2	Homo sapiens	82-87
32919031-3	2020	We have previously reported that chloroquine-induced lysosomal stress facilitates LRRK2 phosphorylation of Rab10 to maintain lysosomal homeostasis.	Chloroquine	33-44	RAB10, member RAS oncogene family	Homo sapiens	107-112
32920000-6	2020	Chloroquine/hydroxychloroquine + azithromycin interacted with 6 genes (CCL2, CTSB, CXCL8, IL1B, IL6 and TNF), whereas chloroquine and azithromycin affected two additional genes (BCL2L1 and CYP3A4), which might be a reason behind a greater number of consequential diseases.	Chloroquine	0-11	C-C motif chemokine ligand 2	Homo sapiens	71-75
32920000-6	2020	Chloroquine/hydroxychloroquine + azithromycin interacted with 6 genes (CCL2, CTSB, CXCL8, IL1B, IL6 and TNF), whereas chloroquine and azithromycin affected two additional genes (BCL2L1 and CYP3A4), which might be a reason behind a greater number of consequential diseases.	Chloroquine	0-11	cathepsin B	Homo sapiens	77-81
32920000-6	2020	Chloroquine/hydroxychloroquine + azithromycin interacted with 6 genes (CCL2, CTSB, CXCL8, IL1B, IL6 and TNF), whereas chloroquine and azithromycin affected two additional genes (BCL2L1 and CYP3A4), which might be a reason behind a greater number of consequential diseases.	Chloroquine	0-11	C-X-C motif chemokine ligand 8	Homo sapiens	83-88
32920000-6	2020	Chloroquine/hydroxychloroquine + azithromycin interacted with 6 genes (CCL2, CTSB, CXCL8, IL1B, IL6 and TNF), whereas chloroquine and azithromycin affected two additional genes (BCL2L1 and CYP3A4), which might be a reason behind a greater number of consequential diseases.	Chloroquine	0-11	interleukin 1 beta	Homo sapiens	90-94
32920000-6	2020	Chloroquine/hydroxychloroquine + azithromycin interacted with 6 genes (CCL2, CTSB, CXCL8, IL1B, IL6 and TNF), whereas chloroquine and azithromycin affected two additional genes (BCL2L1 and CYP3A4), which might be a reason behind a greater number of consequential diseases.	Chloroquine	0-11	interleukin 6	Homo sapiens	96-99
32920000-6	2020	Chloroquine/hydroxychloroquine + azithromycin interacted with 6 genes (CCL2, CTSB, CXCL8, IL1B, IL6 and TNF), whereas chloroquine and azithromycin affected two additional genes (BCL2L1 and CYP3A4), which might be a reason behind a greater number of consequential diseases.	Chloroquine	0-11	tumor necrosis factor	Homo sapiens	104-107
32920000-6	2020	Chloroquine/hydroxychloroquine + azithromycin interacted with 6 genes (CCL2, CTSB, CXCL8, IL1B, IL6 and TNF), whereas chloroquine and azithromycin affected two additional genes (BCL2L1 and CYP3A4), which might be a reason behind a greater number of consequential diseases.	Chloroquine	0-11	BCL2 like 1	Homo sapiens	178-184
32920000-6	2020	Chloroquine/hydroxychloroquine + azithromycin interacted with 6 genes (CCL2, CTSB, CXCL8, IL1B, IL6 and TNF), whereas chloroquine and azithromycin affected two additional genes (BCL2L1 and CYP3A4), which might be a reason behind a greater number of consequential diseases.	Chloroquine	0-11	cytochrome P450 family 3 subfamily A member 4	Homo sapiens	189-195
32920000-6	2020	Chloroquine/hydroxychloroquine + azithromycin interacted with 6 genes (CCL2, CTSB, CXCL8, IL1B, IL6 and TNF), whereas chloroquine and azithromycin affected two additional genes (BCL2L1 and CYP3A4), which might be a reason behind a greater number of consequential diseases.	Chloroquine	19-30	C-C motif chemokine ligand 2	Homo sapiens	71-75
32920000-6	2020	Chloroquine/hydroxychloroquine + azithromycin interacted with 6 genes (CCL2, CTSB, CXCL8, IL1B, IL6 and TNF), whereas chloroquine and azithromycin affected two additional genes (BCL2L1 and CYP3A4), which might be a reason behind a greater number of consequential diseases.	Chloroquine	19-30	cathepsin B	Homo sapiens	77-81
32920000-6	2020	Chloroquine/hydroxychloroquine + azithromycin interacted with 6 genes (CCL2, CTSB, CXCL8, IL1B, IL6 and TNF), whereas chloroquine and azithromycin affected two additional genes (BCL2L1 and CYP3A4), which might be a reason behind a greater number of consequential diseases.	Chloroquine	19-30	C-X-C motif chemokine ligand 8	Homo sapiens	83-88
32920000-6	2020	Chloroquine/hydroxychloroquine + azithromycin interacted with 6 genes (CCL2, CTSB, CXCL8, IL1B, IL6 and TNF), whereas chloroquine and azithromycin affected two additional genes (BCL2L1 and CYP3A4), which might be a reason behind a greater number of consequential diseases.	Chloroquine	19-30	interleukin 1 beta	Homo sapiens	90-94
32920000-6	2020	Chloroquine/hydroxychloroquine + azithromycin interacted with 6 genes (CCL2, CTSB, CXCL8, IL1B, IL6 and TNF), whereas chloroquine and azithromycin affected two additional genes (BCL2L1 and CYP3A4), which might be a reason behind a greater number of consequential diseases.	Chloroquine	19-30	interleukin 6	Homo sapiens	96-99
32920000-6	2020	Chloroquine/hydroxychloroquine + azithromycin interacted with 6 genes (CCL2, CTSB, CXCL8, IL1B, IL6 and TNF), whereas chloroquine and azithromycin affected two additional genes (BCL2L1 and CYP3A4), which might be a reason behind a greater number of consequential diseases.	Chloroquine	19-30	tumor necrosis factor	Homo sapiens	104-107
32920000-6	2020	Chloroquine/hydroxychloroquine + azithromycin interacted with 6 genes (CCL2, CTSB, CXCL8, IL1B, IL6 and TNF), whereas chloroquine and azithromycin affected two additional genes (BCL2L1 and CYP3A4), which might be a reason behind a greater number of consequential diseases.	Chloroquine	19-30	BCL2 like 1	Homo sapiens	178-184
32920000-6	2020	Chloroquine/hydroxychloroquine + azithromycin interacted with 6 genes (CCL2, CTSB, CXCL8, IL1B, IL6 and TNF), whereas chloroquine and azithromycin affected two additional genes (BCL2L1 and CYP3A4), which might be a reason behind a greater number of consequential diseases.	Chloroquine	19-30	cytochrome P450 family 3 subfamily A member 4	Homo sapiens	189-195
32920000-7	2020	In contrast to lopinavir/ritonavir, chloroquine/hydroxychloroquine + azithromycin downregulated the expression of TNF and IL6.	Chloroquine	36-47	tumor necrosis factor	Homo sapiens	114-117
32920000-7	2020	In contrast to lopinavir/ritonavir, chloroquine/hydroxychloroquine + azithromycin downregulated the expression of TNF and IL6.	Chloroquine	36-47	interleukin 6	Homo sapiens	122-125
33178023-8	2020	Among them, 3-methyladenine, SBI-0206965, Chloroquine, and Bafilomycin A1 triggered BAX- and/or BAK-dependent cytotoxicity and caspase activation.	Chloroquine	42-53	BCL2 antagonist/killer 1	Homo sapiens	96-99
32768581-10	2020	CQ addition enhanced the cytotoxicity of drugs and inhibited the autophagic flux which is detected by higher levels of LC3BII and p62 correlated with the reverted MDR1, TGF-beta1 and ATG7 genes expression.	Chloroquine	0-2	nucleoporin 62	Homo sapiens	130-133
31884871-11	2020	Thus, our studies discover the TGFB-INHB/activin-mediated inhibition of TORC2 as a novel mechanism for age-dependent decreases in autophagic activity and cardiac health.Abbreviations: AI: arrhythmia index; BafA1: bafilomycin A1; BMP: bone morphogenetic protein; CQ: chloroquine; CVD: cardiovascular diseases; DI: diastolic interval; ER: endoplasmic reticulum; HP: heart period; HR: heart rate; MTOR: mechanistic target of rapamycin kinase; NGS: normal goat serum; PBST: PBS with 0.1% Triton X-100; PDPK1: 3-phosphoinositide dependent protein kinase 1; RICTOR: RPTOR independent companion of MTOR complex 2; ROI: region of interest; ROUT: robust regression and outlier removal; ROS: reactive oxygen species; R-SMAD: receptor-activated SMAD; SI: systolic interval; SOHA: semi-automatic optical heartbeat analysis; TGFB: transformation growth factor beta; TSC1: TSC complex subunit 1.	Chloroquine	266-277	glass bottom boat	Drosophila melanogaster	31-35
32768581-10	2020	CQ addition enhanced the cytotoxicity of drugs and inhibited the autophagic flux which is detected by higher levels of LC3BII and p62 correlated with the reverted MDR1, TGF-beta1 and ATG7 genes expression.	Chloroquine	0-2	ATP binding cassette subfamily B member 1	Homo sapiens	163-167
32768581-10	2020	CQ addition enhanced the cytotoxicity of drugs and inhibited the autophagic flux which is detected by higher levels of LC3BII and p62 correlated with the reverted MDR1, TGF-beta1 and ATG7 genes expression.	Chloroquine	0-2	transforming growth factor beta 1	Homo sapiens	169-178
32768581-10	2020	CQ addition enhanced the cytotoxicity of drugs and inhibited the autophagic flux which is detected by higher levels of LC3BII and p62 correlated with the reverted MDR1, TGF-beta1 and ATG7 genes expression.	Chloroquine	0-2	autophagy related 7	Homo sapiens	183-187
33051438-5	2020	Upon RPS27L knockdown, the levels of FANCD2 and FANCI are reduced due to accelerated degradation via p62-mediated autophagy-lysosome pathway, which is abrogated by chloroquine (CQ) treatment or Beclin 1 knockdown.	Chloroquine	164-175	ribosomal protein S27 like	Homo sapiens	5-11
33051438-5	2020	Upon RPS27L knockdown, the levels of FANCD2 and FANCI are reduced due to accelerated degradation via p62-mediated autophagy-lysosome pathway, which is abrogated by chloroquine (CQ) treatment or Beclin 1 knockdown.	Chloroquine	164-175	FA complementation group D2	Homo sapiens	37-43
33051438-5	2020	Upon RPS27L knockdown, the levels of FANCD2 and FANCI are reduced due to accelerated degradation via p62-mediated autophagy-lysosome pathway, which is abrogated by chloroquine (CQ) treatment or Beclin 1 knockdown.	Chloroquine	164-175	FA complementation group I	Homo sapiens	48-53
33051438-5	2020	Upon RPS27L knockdown, the levels of FANCD2 and FANCI are reduced due to accelerated degradation via p62-mediated autophagy-lysosome pathway, which is abrogated by chloroquine (CQ) treatment or Beclin 1 knockdown.	Chloroquine	164-175	nucleoporin 62	Homo sapiens	101-104
33051438-5	2020	Upon RPS27L knockdown, the levels of FANCD2 and FANCI are reduced due to accelerated degradation via p62-mediated autophagy-lysosome pathway, which is abrogated by chloroquine (CQ) treatment or Beclin 1 knockdown.	Chloroquine	177-179	ribosomal protein S27 like	Homo sapiens	5-11
33051438-5	2020	Upon RPS27L knockdown, the levels of FANCD2 and FANCI are reduced due to accelerated degradation via p62-mediated autophagy-lysosome pathway, which is abrogated by chloroquine (CQ) treatment or Beclin 1 knockdown.	Chloroquine	177-179	FA complementation group D2	Homo sapiens	37-43
33051438-5	2020	Upon RPS27L knockdown, the levels of FANCD2 and FANCI are reduced due to accelerated degradation via p62-mediated autophagy-lysosome pathway, which is abrogated by chloroquine (CQ) treatment or Beclin 1 knockdown.	Chloroquine	177-179	nucleoporin 62	Homo sapiens	101-104
33051438-5	2020	Upon RPS27L knockdown, the levels of FANCD2 and FANCI are reduced due to accelerated degradation via p62-mediated autophagy-lysosome pathway, which is abrogated by chloroquine (CQ) treatment or Beclin 1 knockdown.	Chloroquine	177-179	beclin 1	Homo sapiens	194-202
31880198-8	2020	In conclusion, our research reveals a novel molecular mechanism that oxidative modification at Cys292 and Cys361 sites regulates ATG4B function, which modulates autophagy.Abbreviations: Air-ox: air-oxidation; ATG4B: autophagy related 4B cysteine peptidase; BCNU: 1,3-bis(2-chloroethyl)-1-nitrosourea; CBB: Coomassie Brilliant Blue; CM: complete medium; CQ: chloroquine; DTT: dithiothreitol; GSH: reduced glutathione; GSNO: S-nitrosoglutathione; GSSG: oxidized glutathione; HMW: high molecular weight; H2O2: hydrogen peroxide; NAC: N-acetyl-L-cysteine; NEM: N-ethylmaleimide; PE: phosphatidylethanolamine; PTM: post-translational modification; ROS, reactive oxygen species; WT: wild type.	Chloroquine	357-368	autophagy related 4B cysteine peptidase	Homo sapiens	129-134
31880198-8	2020	In conclusion, our research reveals a novel molecular mechanism that oxidative modification at Cys292 and Cys361 sites regulates ATG4B function, which modulates autophagy.Abbreviations: Air-ox: air-oxidation; ATG4B: autophagy related 4B cysteine peptidase; BCNU: 1,3-bis(2-chloroethyl)-1-nitrosourea; CBB: Coomassie Brilliant Blue; CM: complete medium; CQ: chloroquine; DTT: dithiothreitol; GSH: reduced glutathione; GSNO: S-nitrosoglutathione; GSSG: oxidized glutathione; HMW: high molecular weight; H2O2: hydrogen peroxide; NAC: N-acetyl-L-cysteine; NEM: N-ethylmaleimide; PE: phosphatidylethanolamine; PTM: post-translational modification; ROS, reactive oxygen species; WT: wild type.	Chloroquine	357-368	autophagy related 4B cysteine peptidase	Homo sapiens	209-214
31944172-11	2020	This study shows that sustained high autophagic flux by RUBCN deficiency in PTECs leads to metabolic syndrome concomitantly with an accelerated mobilization of phospholipids from cellular membranes to lysosomes.Abbreviations: ABC: ATP binding cassette; ACADM: acyl-CoA dehydrogenase medium chain; ACTB: actin, beta; ATG: autophagy related; AUC: area under the curve; Baf: bafilomycin A1; BAT: brown adipose tissue; BODIPY: boron-dipyrromethene; BSA: bovine serum albumin; BW: body weight; CAT: chloramphenicol acetyltransferase; CM: complete medium; CPT1A: carnitine palmitoyltransferase 1a, liver; CQ: chloroquine; CTRL: control; EGFP: enhanced green fluorescent protein; CTSD: cathepsin D; EAT: epididymal adipose tissue; EGFR: epidermal growth factor receptor; EIF4EBP1: eukaryotic translation initiation factor 4E binding protein 1; FA: fatty acid; FBS: fetal bovine serum; GTT: glucose tolerance test; HE: hematoxylin and eosin; HFD: high-fat diet; I/R: ischemia-reperfusion; ITT: insulin tolerance test; KAP: kidney androgen regulated protein; KO: knockout; LAMP1: lysosomal associated membrane protein 1; LD: lipid droplet; LRP2: low density lipoprotein receptor related protein 2; MAP1LC3B: microtubule associated protein 1 light chain 3 beta; MAT: mesenteric adipose tissue; MS: mass spectrometry; MTOR: mechanistic target of rapamycin kinase; MTORC1: MTOR complex 1; NDRG1: N-myc downstream regulated 1; NDUFB5: NADH:ubiquinone oxidoreductase subunit B5; NEFA: non-esterified fatty acid; OA: oleic acid; OCT: optimal cutting temperature; ORO: Oil Red O; PAS: Periodic-acid Schiff; PFA: paraformaldehyde; PIK3C3: phosphatidylinositol 3-kinase catalytic subunit type 3; PPARA: peroxisome proliferator activated receptor alpha; PPARGC1A: PPARG coactivator 1 alpha; PTEC: proximal tubular epithelial cell; RAB7A: RAB7A, member RAS oncogene family; RPS6: ribosomal protein S6; RPS6KB1: ribosomal protein S6 kinase B1; RT: reverse transcription; RUBCN: rubicon autophagy regulator; SAT: subcutaneous adipose tissue; SFC: supercritical fluid chromatography; SQSTM1: sequestosome 1; SREBF1: sterol regulatory element binding transcription factor 1; SV-40: simian virus-40; TFEB: transcription factor EB; TG: triglyceride; TS: tissue specific; TUNEL: terminal deoxynucleotidyl transferase-mediated dUTP nick-end labeling; UN: urea nitrogen; UQCRB: ubiquinol-cytochrome c reductase binding protein; UVRAG: UV radiation resistance associated; VPS: vacuolar protein sorting; WAT: white adipose tissue.	Chloroquine	603-614	RUN domain and cysteine-rich domain containing, Beclin 1-interacting protein	Mus musculus	56-61
31884871-11	2020	Thus, our studies discover the TGFB-INHB/activin-mediated inhibition of TORC2 as a novel mechanism for age-dependent decreases in autophagic activity and cardiac health.Abbreviations: AI: arrhythmia index; BafA1: bafilomycin A1; BMP: bone morphogenetic protein; CQ: chloroquine; CVD: cardiovascular diseases; DI: diastolic interval; ER: endoplasmic reticulum; HP: heart period; HR: heart rate; MTOR: mechanistic target of rapamycin kinase; NGS: normal goat serum; PBST: PBS with 0.1% Triton X-100; PDPK1: 3-phosphoinositide dependent protein kinase 1; RICTOR: RPTOR independent companion of MTOR complex 2; ROI: region of interest; ROUT: robust regression and outlier removal; ROS: reactive oxygen species; R-SMAD: receptor-activated SMAD; SI: systolic interval; SOHA: semi-automatic optical heartbeat analysis; TGFB: transformation growth factor beta; TSC1: TSC complex subunit 1.	Chloroquine	266-277	Activin-beta	Drosophila melanogaster	41-48
33000580-14	2020	CQ granules significantly decreased the levels of neurokinin A, neurokinin B and calcitonin gene-related peptide in the lung and dorsal root ganglia.	Chloroquine	0-2	tachykinin precursor 1	Homo sapiens	50-62
32562764-3	2020	Furthermore, it is emphasized that the viral spike protein is prevented from binding gangliosides, which are composed of a glycosphingolipid with one or more sialic acids, in the presence of chloroquine or hydroxychloroquine.	Chloroquine	191-202	surface glycoprotein	Severe acute respiratory syndrome coronavirus 2	45-50
33000580-14	2020	CQ granules significantly decreased the levels of neurokinin A, neurokinin B and calcitonin gene-related peptide in the lung and dorsal root ganglia.	Chloroquine	0-2	tachykinin precursor 3	Homo sapiens	64-76
33000580-15	2020	CQ also significantly suppressed the upregulation of p-extracellular regulated protein kinase 1/2 and p-methyl ethyl ketone 1/2 induced by PM2.5 exposure.	Chloroquine	0-2	mitogen-activated protein kinase 3	Homo sapiens	55-97
32863923-5	2020	In vitro, inhibiting TLR9 expression levels using chloroquine decreased the cell viability, proliferation and migration of the CRC cell line HT29, and further experiments indicated that this may occur through downregulating the expression levels of NF-kappaB, proliferating cell nuclear antigen and Bcl-xl.	Chloroquine	50-61	toll-like receptor 9	Mus musculus	21-25
32863923-5	2020	In vitro, inhibiting TLR9 expression levels using chloroquine decreased the cell viability, proliferation and migration of the CRC cell line HT29, and further experiments indicated that this may occur through downregulating the expression levels of NF-kappaB, proliferating cell nuclear antigen and Bcl-xl.	Chloroquine	50-61	nuclear factor of kappa light polypeptide gene enhancer in B cells 1, p105	Mus musculus	249-258
32863923-5	2020	In vitro, inhibiting TLR9 expression levels using chloroquine decreased the cell viability, proliferation and migration of the CRC cell line HT29, and further experiments indicated that this may occur through downregulating the expression levels of NF-kappaB, proliferating cell nuclear antigen and Bcl-xl.	Chloroquine	50-61	proliferating cell nuclear antigen	Mus musculus	260-294
32863923-5	2020	In vitro, inhibiting TLR9 expression levels using chloroquine decreased the cell viability, proliferation and migration of the CRC cell line HT29, and further experiments indicated that this may occur through downregulating the expression levels of NF-kappaB, proliferating cell nuclear antigen and Bcl-xl.	Chloroquine	50-61	BCL2-like 1	Mus musculus	299-305
32910713-8	2021	Tandem-fluorescent-LC3 revealed less accumulation of GFP-LC3 in starved and chloroquine-treated CH12 tfg KO B cells.	Chloroquine	76-87	Trk-fused gene	Mus musculus	101-104
32439581-6	2020	Since the decrease was counteracted by cotreatment with chloroquine, the CSE-dependent decrease in the ADAR1 protein levels may be due to the activation of autophagy.	Chloroquine	56-67	adenosine deaminase RNA specific	Homo sapiens	103-108
32990233-6	2020	Combined treatment of the cells with Lv/shAURKB and the autophagy inhibitor chloroquine obviously restored the expressions of caspase-3 and Bcl-2 (P < 0.05).	Chloroquine	76-87	caspase 3	Homo sapiens	126-135
32990233-6	2020	Combined treatment of the cells with Lv/shAURKB and the autophagy inhibitor chloroquine obviously restored the expressions of caspase-3 and Bcl-2 (P < 0.05).	Chloroquine	76-87	BCL2 apoptosis regulator	Homo sapiens	140-145
33062720-3	2020	Also, CQ and HCQ inhibit the production of interferon- (IFN-) alpha and IFN-gamma and/or tumor necrotizing factor- (TNF-) alpha.	Chloroquine	6-8	interferon alpha 1	Homo sapiens	43-67
33062720-3	2020	Also, CQ and HCQ inhibit the production of interferon- (IFN-) alpha and IFN-gamma and/or tumor necrotizing factor- (TNF-) alpha.	Chloroquine	6-8	interferon gamma	Homo sapiens	72-81
33062720-3	2020	Also, CQ and HCQ inhibit the production of interferon- (IFN-) alpha and IFN-gamma and/or tumor necrotizing factor- (TNF-) alpha.	Chloroquine	6-8	tumor necrosis factor	Homo sapiens	89-127
33062720-5	2020	Moreover, CQ affects the stability between T-helper cell (Th) 1 and Th2 cytokine secretion by augmenting IL-10 production in peripheral blood mononuclear cells (PBMCs).	Chloroquine	10-12	interleukin 10	Homo sapiens	105-110
33062720-6	2020	Additionally, CQ is capable of blocking lipopolysaccharide- (LPS-) triggered stimulation of extracellular signal-modulated extracellular signal-regulated kinases 1/2 in human PBMCs.	Chloroquine	14-16	mitogen-activated protein kinase 1	Homo sapiens	123-165
33029160-2	2020	The most active extract against chloroquine-sensitive (3D7) and chloroquine-resistant (Dd2) P. falciparum strains is the A. hispidum extract which yielded a mean inhibitory concentration at 50% (IC50) of 3.66 microg/ml and 3.71 microg/ml for 3D7 and Dd2, respectively.	Chloroquine	64-75	aldo-keto reductase family 1 member C2	Homo sapiens	87-90
32990544-12	2021	Luminex analysis revealed that the combination resulted in a down-regulation of a NF-kappaB/AKT/CREB signaling pathways in both cell line, however, decreased Erk1/2 protein expression was only observed after treated with CQ combination in HCT-15 cells.	Chloroquine	221-223	nuclear factor kappa B subunit 1	Homo sapiens	82-91
32990544-12	2021	Luminex analysis revealed that the combination resulted in a down-regulation of a NF-kappaB/AKT/CREB signaling pathways in both cell line, however, decreased Erk1/2 protein expression was only observed after treated with CQ combination in HCT-15 cells.	Chloroquine	221-223	AKT serine/threonine kinase 1	Homo sapiens	92-95
32990544-12	2021	Luminex analysis revealed that the combination resulted in a down-regulation of a NF-kappaB/AKT/CREB signaling pathways in both cell line, however, decreased Erk1/2 protein expression was only observed after treated with CQ combination in HCT-15 cells.	Chloroquine	221-223	cAMP responsive element binding protein 1	Homo sapiens	96-100
32990544-12	2021	Luminex analysis revealed that the combination resulted in a down-regulation of a NF-kappaB/AKT/CREB signaling pathways in both cell line, however, decreased Erk1/2 protein expression was only observed after treated with CQ combination in HCT-15 cells.	Chloroquine	221-223	mitogen-activated protein kinase 3	Homo sapiens	158-164
32990544-14	2021	Autophagy inhibition by CQ promotes apoptosis via blockade of the NF-kappaB/AKT/CREB and activation of ROS.	Chloroquine	24-26	nuclear factor kappa B subunit 1	Homo sapiens	66-75
32990544-14	2021	Autophagy inhibition by CQ promotes apoptosis via blockade of the NF-kappaB/AKT/CREB and activation of ROS.	Chloroquine	24-26	AKT serine/threonine kinase 1	Homo sapiens	76-79
32990544-14	2021	Autophagy inhibition by CQ promotes apoptosis via blockade of the NF-kappaB/AKT/CREB and activation of ROS.	Chloroquine	24-26	cAMP responsive element binding protein 1	Homo sapiens	80-84
33062720-2	2020	CQ and HCQ are able to inhibit the production of cytokines such as interleukin- (IL-) 1, IL-2, IL-6, IL-17, and IL-22.	Chloroquine	0-2	interleukin 2	Homo sapiens	89-93
33062720-2	2020	CQ and HCQ are able to inhibit the production of cytokines such as interleukin- (IL-) 1, IL-2, IL-6, IL-17, and IL-22.	Chloroquine	0-2	interleukin 6	Homo sapiens	95-99
33062720-2	2020	CQ and HCQ are able to inhibit the production of cytokines such as interleukin- (IL-) 1, IL-2, IL-6, IL-17, and IL-22.	Chloroquine	0-2	interleukin 17A	Homo sapiens	101-106
33062720-2	2020	CQ and HCQ are able to inhibit the production of cytokines such as interleukin- (IL-) 1, IL-2, IL-6, IL-17, and IL-22.	Chloroquine	0-2	interleukin 22	Homo sapiens	112-117
32966340-9	2020	In EPC1 and EPC2, pharmacological inhibition of autophagy flux by chloroquine increased mitochondrial oxidative stress while decreasing cell viability.	Chloroquine	66-77	enhancer of polycomb homolog 1	Homo sapiens	3-7
32966340-9	2020	In EPC1 and EPC2, pharmacological inhibition of autophagy flux by chloroquine increased mitochondrial oxidative stress while decreasing cell viability.	Chloroquine	66-77	enhancer of polycomb homolog 2	Homo sapiens	12-16
32943718-6	2020	Rubicon overexpression or administration of bafilomycin A1 or chloroquine, an inhibitor of late-stage autophagy, suppressed autophagy and activated the type 1 IFN pathway.	Chloroquine	62-73	interferon alpha 1	Homo sapiens	159-162
32679150-0	2020	Matrix metallopeptidase 9 as a host protein target of chloroquine and melatonin for immunoregulation in COVID-19: A network-based meta-analysis.	Chloroquine	54-65	matrix metallopeptidase 9	Homo sapiens	0-25
32934215-8	2020	Specifically, the impact of SHH pathway inhibition (GANT61) was reversed by the pharmacological autophagy inhibitor chloroquine (CQ) or RNA interference of autophagy-related gene ATG5 or ATG7.	Chloroquine	116-127	sonic hedgehog	Mus musculus	28-31
32934215-8	2020	Specifically, the impact of SHH pathway inhibition (GANT61) was reversed by the pharmacological autophagy inhibitor chloroquine (CQ) or RNA interference of autophagy-related gene ATG5 or ATG7.	Chloroquine	129-131	sonic hedgehog	Mus musculus	28-31
33042468-8	2020	Moreover, autophagy inhibitor chloroquine (CQ) reversed the effect of CD47 antibody treatment.	Chloroquine	30-41	Cd47 molecule	Rattus norvegicus	70-74
33042468-8	2020	Moreover, autophagy inhibitor chloroquine (CQ) reversed the effect of CD47 antibody treatment.	Chloroquine	43-45	Cd47 molecule	Rattus norvegicus	70-74
32524263-3	2020	After treatment with poly(I:C)-LMW, poly (I:C)-LMW/LyoVec, and Imiquimod, the replication of IBV was significantly suppressed after 24 h. However, treatment with TLR3 pathway inhibitors such as Pepinh-TRIF, celastrol, chloroquine, and BX795 resulted in increased replication of IBV after 36 h. These results also showed that chloroquine and celastrol were most effective inhibitors of the antiviral response at 48 hpi.	Chloroquine	218-229	toll like receptor 3	Homo sapiens	162-166
32924342-0	2020	Beneficial Effect of Chloroquine and Amodiaquine on Type 1 Diabetic Tubulopathy by Attenuating Mitochondrial Nox4 and Endoplasmic Reticulum Stress.	Chloroquine	21-32	NADPH oxidase 4	Mus musculus	109-113
32924342-3	2020	We designed this study to explore the therapeutic potential of chloroquine (CQ) and amodiaquine (AQ) for inhibiting mitochondrial Nox4 and diabetic tubular injury.	Chloroquine	63-74	NADPH oxidase 4	Mus musculus	130-134
32924342-3	2020	We designed this study to explore the therapeutic potential of chloroquine (CQ) and amodiaquine (AQ) for inhibiting mitochondrial Nox4 and diabetic tubular injury.	Chloroquine	76-78	NADPH oxidase 4	Mus musculus	130-134
32924342-7	2020	RESULTS: CQ and AQ inhibited mitochondrial Nox4 and increased mitochondrial mass in hRPTCs under high-glucose conditions.	Chloroquine	9-11	NADPH oxidase 4	Mus musculus	43-47
32924342-9	2020	Notably, CQ and AQ treatment diminished Nox4 activation and ER stress in the kidneys of STZ-induced diabetic mice.	Chloroquine	9-11	NADPH oxidase 4	Mus musculus	40-44
32924342-11	2020	CONCLUSION: We substantiated the protective actions of CQ and AQ in diabetic tubulopathy associated with reduced mitochondrial Nox4 activation and ER stress alleviation.	Chloroquine	55-57	NADPH oxidase 4	Mus musculus	127-131
32524263-3	2020	After treatment with poly(I:C)-LMW, poly (I:C)-LMW/LyoVec, and Imiquimod, the replication of IBV was significantly suppressed after 24 h. However, treatment with TLR3 pathway inhibitors such as Pepinh-TRIF, celastrol, chloroquine, and BX795 resulted in increased replication of IBV after 36 h. These results also showed that chloroquine and celastrol were most effective inhibitors of the antiviral response at 48 hpi.	Chloroquine	325-336	toll like receptor 3	Homo sapiens	162-166
32787548-5	2020	Then, levels of autophagy-related proteins and inflammation-related proteins (TNF-alpha, IL-Ibeta) were detected, indicating that Chloroquine and Sirtinol reversed the protective effect of H2S on SH-SY5Y cells induced by MPP~+.	Chloroquine	130-141	tumor necrosis factor	Homo sapiens	78-87
32498855-8	2020	The probe was successfully applied for monitoring pH variation in living cells induced by proton-pump inhibitor Baf-A1 and chloroquine, indicating its great potential for pH imaging in biological applications.	Chloroquine	123-134	ATPase H+/K+ transporting non-gastric alpha2 subunit	Homo sapiens	90-101
32882870-14	2020	Whereas, 3-methyladenine/chloroquine weakened FKB+doxorubicin-induced apoptosis (decreased DNA fragmentation/caspase-3).	Chloroquine	25-36	caspase 3	Mus musculus	109-118
32686260-5	2020	CQ and HCQ act on the renin angiotensin system, with possible implications on the cardiorespiratory system.	Chloroquine	0-2	renin	Homo sapiens	22-27
32738306-8	2020	CQ affinity scores showed three low-energy results (less negative) with ACE2, CTSL and RBD, and a firm bond score with Mpro.	Chloroquine	0-2	angiotensin converting enzyme 2	Homo sapiens	72-76
32738306-8	2020	CQ affinity scores showed three low-energy results (less negative) with ACE2, CTSL and RBD, and a firm bond score with Mpro.	Chloroquine	0-2	cathepsin L	Homo sapiens	78-82
32738306-8	2020	CQ affinity scores showed three low-energy results (less negative) with ACE2, CTSL and RBD, and a firm bond score with Mpro.	Chloroquine	0-2	NEWENTRY	Severe acute respiratory syndrome-related coronavirus	119-123
32738306-10	2020	The differences in better interactions and affinity between HCQ and CQ with ACE2 and Mpro were probably due to structural differences between the drugs.	Chloroquine	61-63	angiotensin converting enzyme 2	Homo sapiens	76-80
32738306-10	2020	The differences in better interactions and affinity between HCQ and CQ with ACE2 and Mpro were probably due to structural differences between the drugs.	Chloroquine	61-63	NEWENTRY	Severe acute respiratory syndrome-related coronavirus	85-89
32873320-3	2020	We compared scratching behavior responses between wild type and Cav3.2 null mice in models of histamine- or chloroquine-induced itch.	Chloroquine	108-119	calcium channel, voltage-dependent, T type, alpha 1H subunit	Mus musculus	64-70
32873320-5	2020	Cav3.2 null mice exhibited decreased scratching responses during both histamine- and chloroquine-induced acute itch.	Chloroquine	85-96	calcium channel, voltage-dependent, T type, alpha 1H subunit	Mus musculus	0-6
32863223-8	2020	Regarding currently investigated therapies interferon-beta induced ACE2 gene expression in bronchial epithelial cells, while chloroquine tends to upregulate CTSB/L genes.	Chloroquine	125-136	cathepsin B	Homo sapiens	157-161
34026282-9	2021	These functions of TBK1 were abolished by chloroquine-medicated autophagy inhibition.P-TBK1, an activation form of TBK, is involved in selective autophagy through directly phosphorylating P62 at Ser 403, and the activation of TBK1 is also dependent on Parkin manner.	Chloroquine	42-53	TANK binding kinase 1	Homo sapiens	19-23
33024814-6	2020	Western blot analysis of the HCT-116 cell line treated with both baicalein and CQ demonstrated increased expression of LC3-II, a component of autophagy.	Chloroquine	79-81	microtubule associated protein 1 light chain 3 alpha	Homo sapiens	119-122
32903238-4	2020	Here, we investigated the crude extract and its fractions against chloroquine (CQ)-sensitive 3D7, CQ-resistant Dd2, and artemisinin (ART)-resistant IPC 4912 Mondulkiri strains of Plasmodium falciparum.	Chloroquine	98-100	aldo-keto reductase family 1 member C2	Homo sapiens	111-114
33024814-7	2020	The combination of baicalein with CQ culminated in activation of caspase-3-mediated apoptosis.	Chloroquine	34-36	caspase 3	Homo sapiens	65-74
32983963-11	2020	In addition, NAC (low concentration) and CQ, previously considered to be tumor inhibitors, were shown to promote tumorigenesis in PTC with high SIRT6 expression by inducing the Warburg effect.	Chloroquine	41-43	sirtuin 6	Mus musculus	144-149
34026282-9	2021	These functions of TBK1 were abolished by chloroquine-medicated autophagy inhibition.P-TBK1, an activation form of TBK, is involved in selective autophagy through directly phosphorylating P62 at Ser 403, and the activation of TBK1 is also dependent on Parkin manner.	Chloroquine	42-53	TANK binding kinase 1	Homo sapiens	87-91
34026282-9	2021	These functions of TBK1 were abolished by chloroquine-medicated autophagy inhibition.P-TBK1, an activation form of TBK, is involved in selective autophagy through directly phosphorylating P62 at Ser 403, and the activation of TBK1 is also dependent on Parkin manner.	Chloroquine	42-53	TANK binding kinase 1	Homo sapiens	87-91
32864162-7	2020	We also identified other variants, that are associated with adverse effects, most notable in hydroxychloroquine/chloroquine (G6PD; hemolysis), ribavirin (ITPA; hemolysis), and interferon beta -1b (IRF6; liver toxicity).	Chloroquine	100-111	glucose-6-phosphate dehydrogenase	Homo sapiens	125-129
32864162-6	2020	We found several drug-gene variant pairs that may alter the pharmacokinetics of hydroxychloroquine/chloroquine (CYP2C8, CYP2D6, SLCO1A2, and SLCO1B1); azithromycin (ABCB1); ribavirin (SLC29A1, SLC28A2, and SLC28A3); and lopinavir/ritonavir (SLCO1B1, ABCC2, CYP3A).	Chloroquine	87-98	cytochrome P450 family 2 subfamily C member 8	Homo sapiens	112-118
32864162-6	2020	We found several drug-gene variant pairs that may alter the pharmacokinetics of hydroxychloroquine/chloroquine (CYP2C8, CYP2D6, SLCO1A2, and SLCO1B1); azithromycin (ABCB1); ribavirin (SLC29A1, SLC28A2, and SLC28A3); and lopinavir/ritonavir (SLCO1B1, ABCC2, CYP3A).	Chloroquine	87-98	cytochrome P450 family 2 subfamily D member 6	Homo sapiens	120-126
32864162-7	2020	We also identified other variants, that are associated with adverse effects, most notable in hydroxychloroquine/chloroquine (G6PD; hemolysis), ribavirin (ITPA; hemolysis), and interferon beta -1b (IRF6; liver toxicity).	Chloroquine	100-111	interferon regulatory factor 6	Homo sapiens	197-201
32824620-4	2020	The PMTPV-induced decrease in CLDN1 expression was inhibited by monodansylcadaverine, a clathrin-mediated endocytosis inhibitor, and chloroquine, a lysosome inhibitor.	Chloroquine	133-144	claudin 1	Homo sapiens	30-35
32864162-6	2020	We found several drug-gene variant pairs that may alter the pharmacokinetics of hydroxychloroquine/chloroquine (CYP2C8, CYP2D6, SLCO1A2, and SLCO1B1); azithromycin (ABCB1); ribavirin (SLC29A1, SLC28A2, and SLC28A3); and lopinavir/ritonavir (SLCO1B1, ABCC2, CYP3A).	Chloroquine	87-98	solute carrier organic anion transporter family member 1A2	Homo sapiens	128-135
32864162-6	2020	We found several drug-gene variant pairs that may alter the pharmacokinetics of hydroxychloroquine/chloroquine (CYP2C8, CYP2D6, SLCO1A2, and SLCO1B1); azithromycin (ABCB1); ribavirin (SLC29A1, SLC28A2, and SLC28A3); and lopinavir/ritonavir (SLCO1B1, ABCC2, CYP3A).	Chloroquine	87-98	solute carrier organic anion transporter family member 1B1	Homo sapiens	141-148
32864162-6	2020	We found several drug-gene variant pairs that may alter the pharmacokinetics of hydroxychloroquine/chloroquine (CYP2C8, CYP2D6, SLCO1A2, and SLCO1B1); azithromycin (ABCB1); ribavirin (SLC29A1, SLC28A2, and SLC28A3); and lopinavir/ritonavir (SLCO1B1, ABCC2, CYP3A).	Chloroquine	87-98	ATP binding cassette subfamily B member 1	Homo sapiens	165-170
32864162-6	2020	We found several drug-gene variant pairs that may alter the pharmacokinetics of hydroxychloroquine/chloroquine (CYP2C8, CYP2D6, SLCO1A2, and SLCO1B1); azithromycin (ABCB1); ribavirin (SLC29A1, SLC28A2, and SLC28A3); and lopinavir/ritonavir (SLCO1B1, ABCC2, CYP3A).	Chloroquine	87-98	solute carrier family 29 member 1 (Augustine blood group)	Homo sapiens	184-191
32864162-6	2020	We found several drug-gene variant pairs that may alter the pharmacokinetics of hydroxychloroquine/chloroquine (CYP2C8, CYP2D6, SLCO1A2, and SLCO1B1); azithromycin (ABCB1); ribavirin (SLC29A1, SLC28A2, and SLC28A3); and lopinavir/ritonavir (SLCO1B1, ABCC2, CYP3A).	Chloroquine	87-98	solute carrier family 28 member 2	Homo sapiens	193-200
32864162-6	2020	We found several drug-gene variant pairs that may alter the pharmacokinetics of hydroxychloroquine/chloroquine (CYP2C8, CYP2D6, SLCO1A2, and SLCO1B1); azithromycin (ABCB1); ribavirin (SLC29A1, SLC28A2, and SLC28A3); and lopinavir/ritonavir (SLCO1B1, ABCC2, CYP3A).	Chloroquine	87-98	solute carrier family 28 member 3	Homo sapiens	206-213
32864162-6	2020	We found several drug-gene variant pairs that may alter the pharmacokinetics of hydroxychloroquine/chloroquine (CYP2C8, CYP2D6, SLCO1A2, and SLCO1B1); azithromycin (ABCB1); ribavirin (SLC29A1, SLC28A2, and SLC28A3); and lopinavir/ritonavir (SLCO1B1, ABCC2, CYP3A).	Chloroquine	87-98	solute carrier organic anion transporter family member 1B1	Homo sapiens	241-248
32864162-6	2020	We found several drug-gene variant pairs that may alter the pharmacokinetics of hydroxychloroquine/chloroquine (CYP2C8, CYP2D6, SLCO1A2, and SLCO1B1); azithromycin (ABCB1); ribavirin (SLC29A1, SLC28A2, and SLC28A3); and lopinavir/ritonavir (SLCO1B1, ABCC2, CYP3A).	Chloroquine	87-98	ATP binding cassette subfamily C member 2	Homo sapiens	250-255
32864162-6	2020	We found several drug-gene variant pairs that may alter the pharmacokinetics of hydroxychloroquine/chloroquine (CYP2C8, CYP2D6, SLCO1A2, and SLCO1B1); azithromycin (ABCB1); ribavirin (SLC29A1, SLC28A2, and SLC28A3); and lopinavir/ritonavir (SLCO1B1, ABCC2, CYP3A).	Chloroquine	87-98	cytochrome P450 family 3 subfamily A member 4	Homo sapiens	257-262
32913505-12	2020	Moreover, activated RhoA, Cdc42 and Rac1 decreased after CQ treatment.	Chloroquine	57-59	ras homolog family member A	Homo sapiens	20-24
32913505-12	2020	Moreover, activated RhoA, Cdc42 and Rac1 decreased after CQ treatment.	Chloroquine	57-59	cell division cycle 42	Homo sapiens	26-31
32913505-12	2020	Moreover, activated RhoA, Cdc42 and Rac1 decreased after CQ treatment.	Chloroquine	57-59	Rac family small GTPase 1	Homo sapiens	36-40
32654071-4	2020	In the present study, we demonstrated that GEM induced apoptosis and protective autophagy in GBC cells, which may be related to the AKT/mTOR signaling pathway, and GEM in combination with autophagy inhibitor chloroquine can strengthen the cytotoxic effect of GEM on GBC in vitro and in vivo.	Chloroquine	208-219	AKT serine/threonine kinase 1	Homo sapiens	132-135
32784543-6	2020	Of specific interest are chloroquine/hydroxychloroquine"s ability to inhibit SARS-CoV infection by impairing ACE2, the SARS-CoV2 entry point, through terminal glycosylation via effects on TGN/post-Golgi pH homeostasis.	Chloroquine	25-36	angiotensin converting enzyme 2	Homo sapiens	109-113
32793908-5	2020	Chloroquine or hydroxychloroquine increase cleaved active SP-domain of TMPRSS2, and this is potentiated by MEKi.	Chloroquine	0-11	transmembrane serine protease 2	Homo sapiens	71-78
32824072-4	2020	Furthermore, CQ and HCQ also influenced the proofreading and capping of viral RNA in SARS-CoV-2, performed by nsp10/nsp14 and nsp10/nsp16.	Chloroquine	13-15	ORF1a polyprotein;ORF1ab polyprotein	Severe acute respiratory syndrome coronavirus 2	110-115
32824072-4	2020	Furthermore, CQ and HCQ also influenced the proofreading and capping of viral RNA in SARS-CoV-2, performed by nsp10/nsp14 and nsp10/nsp16.	Chloroquine	13-15	ORF1a polyprotein;ORF1ab polyprotein	Severe acute respiratory syndrome coronavirus 2	126-131
32752951-4	2021	In this study, molecular docking and reactivity were applied for eighteen drugs, which are similar in structure to chloroquine and hydroxychloroquine, the potential inhibitors to angiotensin-converting enzyme (ACE2).	Chloroquine	115-126	angiotensin I converting enzyme	Homo sapiens	179-208
32752951-4	2021	In this study, molecular docking and reactivity were applied for eighteen drugs, which are similar in structure to chloroquine and hydroxychloroquine, the potential inhibitors to angiotensin-converting enzyme (ACE2).	Chloroquine	115-126	angiotensin converting enzyme 2	Homo sapiens	210-214
32654071-4	2020	In the present study, we demonstrated that GEM induced apoptosis and protective autophagy in GBC cells, which may be related to the AKT/mTOR signaling pathway, and GEM in combination with autophagy inhibitor chloroquine can strengthen the cytotoxic effect of GEM on GBC in vitro and in vivo.	Chloroquine	208-219	mechanistic target of rapamycin kinase	Homo sapiens	136-140
32626921-6	2020	Inhibition of autophagy using autophagy inhibitors 3-methyladenine and chloroquine upregulated the expression of DR5 and enhanced TRAIL-induced apoptosis, as confirmed by the increase of pro-apoptotic proteins caspase-8 and caspase-3.	Chloroquine	71-82	TNF receptor superfamily member 10b	Homo sapiens	113-116
31945259-6	2020	PC7-induced degradation of apoA-V is inhibited by bafilomycin-A1, and the alkalinizing agents: chloroquine and NH4 Cl.	Chloroquine	95-106	proprotein convertase subtilisin/kexin type 7	Homo sapiens	0-3
31945259-6	2020	PC7-induced degradation of apoA-V is inhibited by bafilomycin-A1, and the alkalinizing agents: chloroquine and NH4 Cl.	Chloroquine	95-106	apolipoprotein A5	Homo sapiens	27-33
32626921-6	2020	Inhibition of autophagy using autophagy inhibitors 3-methyladenine and chloroquine upregulated the expression of DR5 and enhanced TRAIL-induced apoptosis, as confirmed by the increase of pro-apoptotic proteins caspase-8 and caspase-3.	Chloroquine	71-82	TNF superfamily member 10	Homo sapiens	130-135
32626921-6	2020	Inhibition of autophagy using autophagy inhibitors 3-methyladenine and chloroquine upregulated the expression of DR5 and enhanced TRAIL-induced apoptosis, as confirmed by the increase of pro-apoptotic proteins caspase-8 and caspase-3.	Chloroquine	71-82	caspase 8	Homo sapiens	210-219
32626921-6	2020	Inhibition of autophagy using autophagy inhibitors 3-methyladenine and chloroquine upregulated the expression of DR5 and enhanced TRAIL-induced apoptosis, as confirmed by the increase of pro-apoptotic proteins caspase-8 and caspase-3.	Chloroquine	71-82	caspase 3	Homo sapiens	224-233
32640976-13	2020	Furthermore, chloroquine inhibited proliferation and promoted apoptosis and oxidative stress of SRA01/04 cells by activating ATM/p53 signaling pathway.	Chloroquine	13-24	ATM serine/threonine kinase	Homo sapiens	125-128
32084457-6	2020	Inhibiting in vivo autophagic flux via chloroquine showed increased levels of HAS2 in the heart and aorta.	Chloroquine	39-50	hyaluronan synthase 2	Homo sapiens	78-82
32766148-0	2020	Chloroquine Triggers Cell Death and Inhibits PARPs in Cell Models of Aggressive Hepatoblastoma.	Chloroquine	0-11	poly(ADP-ribose) polymerase 1	Homo sapiens	45-50
32766148-10	2020	Following CQ treatment HB spheroids exhibited increased caspase 3/7 activity indicating the induction of apoptotic cell death.	Chloroquine	10-12	caspase 3	Homo sapiens	56-67
32766148-15	2020	Conclusions: CQ treatment inhibits cell survival in cell models of aggressive HB, presumably by perturbing NAD+ levels, impairing aspartate bioavailability, and inhibiting PARP expression.	Chloroquine	13-15	poly(ADP-ribose) polymerase 1	Homo sapiens	172-176
32339925-8	2020	Furthermore, as a lysosome inhibitor, chloroquine pre-treatment obviously enhanced LC3-II expression and mitophagy formation in MeHg-treated cells.	Chloroquine	38-49	microtubule-associated protein 1 light chain 3 alpha	Mus musculus	83-86
32674481-6	2020	However, at lower concentrations, hydroxychloroquine and chloroquine appear to exert immunomodulatory effects by inhibiting nucleic acid sensors, including toll-like receptor 9 and cyclic GMP-AMP synthase.	Chloroquine	41-52	toll like receptor 9	Homo sapiens	156-176
32674481-6	2020	However, at lower concentrations, hydroxychloroquine and chloroquine appear to exert immunomodulatory effects by inhibiting nucleic acid sensors, including toll-like receptor 9 and cyclic GMP-AMP synthase.	Chloroquine	41-52	cyclic GMP-AMP synthase	Homo sapiens	181-204
32810966-11	2020	Suppressing Cdc37 expression in MM cell line NCI-H929 induced BTZ resistance and autophagy activation, while CQ could rescue BTZ resistance caused by Cdc37 inhibition.	Chloroquine	109-111	cell division cycle 37, HSP90 cochaperone	Homo sapiens	150-155
32278692-9	2020	Surprisingly, treatment with diclofenac or chloroquine/diclofenac markedly up-regulated cardiac RhoA and Rho-kinase1.	Chloroquine	43-54	ras homolog family member A	Rattus norvegicus	96-100
32519067-10	2020	Besides, shRNA knockdown of HCN2 channels significantly reduced the accumulation of LC3-II and increased neuron survival in the OGD/R and transient global cerebral ischemia (TGCI) models, and CQ also eliminated the effects of HCN2-shRNA.	Chloroquine	192-194	hyperpolarization activated cyclic nucleotide gated potassium and sodium channel 2	Homo sapiens	28-32
32519067-10	2020	Besides, shRNA knockdown of HCN2 channels significantly reduced the accumulation of LC3-II and increased neuron survival in the OGD/R and transient global cerebral ischemia (TGCI) models, and CQ also eliminated the effects of HCN2-shRNA.	Chloroquine	192-194	hyperpolarization activated cyclic nucleotide gated potassium and sodium channel 2	Homo sapiens	226-230
32519067-11	2020	Furthermore, we found that the percentage of LC3-positive puncta that co-localized with LAMP-1-positive lysosomes decreased in Con-shRNA-transfected HT22 neurons exposed to OGD/R or CQ.	Chloroquine	182-184	microtubule associated protein 1 light chain 3 alpha	Homo sapiens	45-48
32519067-11	2020	Furthermore, we found that the percentage of LC3-positive puncta that co-localized with LAMP-1-positive lysosomes decreased in Con-shRNA-transfected HT22 neurons exposed to OGD/R or CQ.	Chloroquine	182-184	lysosomal associated membrane protein 1	Homo sapiens	88-94
32519067-12	2020	In HCN2-shRNA-transfected HT22 neurons, the percentage of LC3-positive puncta that co-localized with LAMP-1-positive lysosomes increased under OGD/R; however, the percentage was significantly decreased by the addition of CQ to HCN2-shRNA-transfected HT22 neurons.	Chloroquine	221-223	hyperpolarization activated cyclic nucleotide gated potassium and sodium channel 2	Homo sapiens	3-7
32519067-12	2020	In HCN2-shRNA-transfected HT22 neurons, the percentage of LC3-positive puncta that co-localized with LAMP-1-positive lysosomes increased under OGD/R; however, the percentage was significantly decreased by the addition of CQ to HCN2-shRNA-transfected HT22 neurons.	Chloroquine	221-223	microtubule associated protein 1 light chain 3 alpha	Homo sapiens	58-61
32519067-12	2020	In HCN2-shRNA-transfected HT22 neurons, the percentage of LC3-positive puncta that co-localized with LAMP-1-positive lysosomes increased under OGD/R; however, the percentage was significantly decreased by the addition of CQ to HCN2-shRNA-transfected HT22 neurons.	Chloroquine	221-223	hyperpolarization activated cyclic nucleotide gated potassium and sodium channel 2	Homo sapiens	227-231
32497731-6	2020	Importantly, mammospheres were selectively sensitive to encapsulated chloroquine and thisdepends on the expression of the gene encoding ATM kinase.	Chloroquine	69-80	ATM serine/threonine kinase	Homo sapiens	136-139
32497731-8	2020	We noted that this ATM-dependent sensitivity of mammospheres to encapsulated chloroquine was independent of the status of the tumor suppressor gene p53.	Chloroquine	77-88	ATM serine/threonine kinase	Homo sapiens	19-22
32701417-4	2021	The binding of WB-6 to CL-beta2GPI or DNA, and endocytosis was not prevented by chloroquine, but pre-treatment of the cells with chloroquine significantly suppressed TF expression.	Chloroquine	129-140	coagulation factor III, tissue factor	Homo sapiens	166-168
32694530-6	2020	IL1B expression decreased in CQ and CQ NP-treated cells after 48 h (p < 0.001) and 24 h (p < 0.05) of treatment, respectively.	Chloroquine	29-31	interleukin 1 beta	Homo sapiens	0-4
32694530-6	2020	IL1B expression decreased in CQ and CQ NP-treated cells after 48 h (p < 0.001) and 24 h (p < 0.05) of treatment, respectively.	Chloroquine	36-38	interleukin 1 beta	Homo sapiens	0-4
32694530-7	2020	IFNG and IL12 expressions significantly decreased (p < 0.001) in cells treated with CQ and CQ NPs at 24 and 48 h compared to NT.	Chloroquine	84-86	interferon gamma	Homo sapiens	0-4
32694530-7	2020	IFNG and IL12 expressions significantly decreased (p < 0.001) in cells treated with CQ and CQ NPs at 24 and 48 h compared to NT.	Chloroquine	91-93	interferon gamma	Homo sapiens	0-4
32694530-8	2020	TNFA and IL10 expressions significantly decreased after 48 h (p < 0.001) and 24 h (p < 0.002), respectively, by both CQ and CQ NPs treatment.	Chloroquine	117-119	tumor necrosis factor	Homo sapiens	0-4
32694530-8	2020	TNFA and IL10 expressions significantly decreased after 48 h (p < 0.001) and 24 h (p < 0.002), respectively, by both CQ and CQ NPs treatment.	Chloroquine	117-119	interleukin 10	Homo sapiens	9-13
32694530-8	2020	TNFA and IL10 expressions significantly decreased after 48 h (p < 0.001) and 24 h (p < 0.002), respectively, by both CQ and CQ NPs treatment.	Chloroquine	124-126	tumor necrosis factor	Homo sapiens	0-4
32694530-8	2020	TNFA and IL10 expressions significantly decreased after 48 h (p < 0.001) and 24 h (p < 0.002), respectively, by both CQ and CQ NPs treatment.	Chloroquine	124-126	interleukin 10	Homo sapiens	9-13
32677545-4	2021	Molecular docking studies showed that hydroxychloroquine and chloroquine do not interact with SARS-CoV-2 proteins, but bind to the amino acids ASP350, ASP382, ALA348, PHE40 and PHE390 on the ACE2 allosteric site rather than the ACE2 active site.	Chloroquine	45-56	angiotensin converting enzyme 2	Homo sapiens	191-195
32677545-4	2021	Molecular docking studies showed that hydroxychloroquine and chloroquine do not interact with SARS-CoV-2 proteins, but bind to the amino acids ASP350, ASP382, ALA348, PHE40 and PHE390 on the ACE2 allosteric site rather than the ACE2 active site.	Chloroquine	45-56	angiotensin converting enzyme 2	Homo sapiens	228-232
32774749-6	2020	RESULTS: CQ markedly reversed the CyPA downregulation induced by RNAi and increased intracellular levels of LC3 and p62.	Chloroquine	9-11	peptidylprolyl isomerase A	Homo sapiens	34-38
32774749-6	2020	RESULTS: CQ markedly reversed the CyPA downregulation induced by RNAi and increased intracellular levels of LC3 and p62.	Chloroquine	9-11	microtubule associated protein 1 light chain 3 alpha	Homo sapiens	108-111
32774749-6	2020	RESULTS: CQ markedly reversed the CyPA downregulation induced by RNAi and increased intracellular levels of LC3 and p62.	Chloroquine	9-11	nucleoporin 62	Homo sapiens	116-119
32774749-11	2020	Immunofluorescence indicated colocalization of endogenous CyPA with ubiquitin and with p62 in response to CQ treatment, and co-immunoprecipitation analysis confirmed interaction between CyPA and p62.	Chloroquine	106-108	peptidylprolyl isomerase A	Homo sapiens	58-62
32774749-11	2020	Immunofluorescence indicated colocalization of endogenous CyPA with ubiquitin and with p62 in response to CQ treatment, and co-immunoprecipitation analysis confirmed interaction between CyPA and p62.	Chloroquine	106-108	nucleoporin 62	Homo sapiens	87-90
32774749-11	2020	Immunofluorescence indicated colocalization of endogenous CyPA with ubiquitin and with p62 in response to CQ treatment, and co-immunoprecipitation analysis confirmed interaction between CyPA and p62.	Chloroquine	106-108	peptidylprolyl isomerase A	Homo sapiens	186-190
32774749-11	2020	Immunofluorescence indicated colocalization of endogenous CyPA with ubiquitin and with p62 in response to CQ treatment, and co-immunoprecipitation analysis confirmed interaction between CyPA and p62.	Chloroquine	106-108	nucleoporin 62	Homo sapiens	195-198
32482387-4	2020	Interestingly, we detected an increase in LC3BII and SQSTM1/P62 in MPC5 through inhibiting TM7SF1, and which can be completely corrected after blocking the autolysosome degradation with chloroquine (CQ).	Chloroquine	186-197	sequestosome 1	Mus musculus	53-59
32482387-4	2020	Interestingly, we detected an increase in LC3BII and SQSTM1/P62 in MPC5 through inhibiting TM7SF1, and which can be completely corrected after blocking the autolysosome degradation with chloroquine (CQ).	Chloroquine	186-197	sequestosome 1	Mus musculus	60-63
32482387-4	2020	Interestingly, we detected an increase in LC3BII and SQSTM1/P62 in MPC5 through inhibiting TM7SF1, and which can be completely corrected after blocking the autolysosome degradation with chloroquine (CQ).	Chloroquine	199-201	sequestosome 1	Mus musculus	53-59
32482387-4	2020	Interestingly, we detected an increase in LC3BII and SQSTM1/P62 in MPC5 through inhibiting TM7SF1, and which can be completely corrected after blocking the autolysosome degradation with chloroquine (CQ).	Chloroquine	199-201	sequestosome 1	Mus musculus	60-63
32482387-4	2020	Interestingly, we detected an increase in LC3BII and SQSTM1/P62 in MPC5 through inhibiting TM7SF1, and which can be completely corrected after blocking the autolysosome degradation with chloroquine (CQ).	Chloroquine	199-201	G protein-coupled receptor 137B	Mus musculus	91-97
32640976-13	2020	Furthermore, chloroquine inhibited proliferation and promoted apoptosis and oxidative stress of SRA01/04 cells by activating ATM/p53 signaling pathway.	Chloroquine	13-24	tumor protein p53	Homo sapiens	129-132
32640976-14	2020	The influence conferred by chloroquine was abolished by WRN overexpression.	Chloroquine	27-38	WRN RecQ like helicase	Homo sapiens	56-59
32641037-0	2020	Caspase1/11 signaling affects muscle regeneration and recovery following ischemia, and can be modulated by chloroquine.	Chloroquine	107-118	caspase 1	Mus musculus	0-11
32641037-1	2020	BACKGROUND: We previously showed that the autophagy inhibitor chloroquine (CQ) increases inflammatory cleaved caspase-1 activity in myocytes, and that caspase-1/11 is protective in sterile liver injury.	Chloroquine	62-73	caspase 1	Mus musculus	110-119
32641037-1	2020	BACKGROUND: We previously showed that the autophagy inhibitor chloroquine (CQ) increases inflammatory cleaved caspase-1 activity in myocytes, and that caspase-1/11 is protective in sterile liver injury.	Chloroquine	62-73	caspase 1	Mus musculus	151-163
32641037-1	2020	BACKGROUND: We previously showed that the autophagy inhibitor chloroquine (CQ) increases inflammatory cleaved caspase-1 activity in myocytes, and that caspase-1/11 is protective in sterile liver injury.	Chloroquine	75-77	caspase 1	Mus musculus	110-119
32641037-1	2020	BACKGROUND: We previously showed that the autophagy inhibitor chloroquine (CQ) increases inflammatory cleaved caspase-1 activity in myocytes, and that caspase-1/11 is protective in sterile liver injury.	Chloroquine	75-77	caspase 1	Mus musculus	151-163
32641037-3	2020	We hypothesized that caspase-1/11 mediates recovery in muscle via effects on autophagy and this is modulated by CQ.	Chloroquine	112-114	caspase 1	Mus musculus	21-30
32641037-5	2020	CQ effects on autophagosome formation, microtubule associated protein 1A/1B-light chain 3 (LC3), and caspase-1 expression was measured using electron microscopy and immunofluorescence.	Chloroquine	0-2	microtubule-associated protein 1 light chain 3 alpha	Mus musculus	91-94
32641037-10	2020	RESULTS: CQ increased autophagosomes, LC3 consolidation, total caspase-1 expression and cleaved caspase-1 in muscle.	Chloroquine	9-11	microtubule-associated protein 1 light chain 3 alpha	Mus musculus	38-41
32641037-10	2020	RESULTS: CQ increased autophagosomes, LC3 consolidation, total caspase-1 expression and cleaved caspase-1 in muscle.	Chloroquine	9-11	caspase 1	Mus musculus	63-72
32641037-10	2020	RESULTS: CQ increased autophagosomes, LC3 consolidation, total caspase-1 expression and cleaved caspase-1 in muscle.	Chloroquine	9-11	caspase 1	Mus musculus	96-105
32641037-11	2020	Perfusion, fibrosis, myofiber regeneration, muscle contraction, MuSC fusion, OCR, ECAR and glycolytic enzyme expression was variably affected by CQ depending on presence of caspase-1/11.	Chloroquine	145-147	caspase 1	Mus musculus	173-185
32641037-13	2020	CQ diminished peak force in whole muscle, and myocyte fusion in MuSC and these effects were exacerbated in caspase-1/11KO mice.	Chloroquine	0-2	caspase 1	Mus musculus	107-116
32641037-14	2020	CQ reductions in maximal respiration and ATP production were reduced in caspase-1/11KO mice.	Chloroquine	0-2	caspase 1	Mus musculus	72-81
32641037-16	2020	CONCLUSION: Caspase-1/11 signaling affects the response to ischemia in muscle and effects are variably modulated by CQ.	Chloroquine	116-118	caspase 1	Mus musculus	12-24
32714335-3	2020	Chloroquine appears to inhibit in vitro SARS virus" replication and to interfere with SARS-CoV2 receptor (ACE2).	Chloroquine	0-11	angiotensin converting enzyme 2	Homo sapiens	106-110
32469265-0	2021	Docking study of chloroquine and hydroxychloroquine interaction with RNA binding domain of nucleocapsid phospho-protein - an in silico insight into the comparative efficacy of repurposing antiviral drugs.	Chloroquine	17-28	nucleocapsid phosphoprotein	Severe acute respiratory syndrome coronavirus 2	91-103
32662244-7	2020	Furthermore, autophagy blockers chloroquine and bafilomycin A1 caused p16 aggregation within stalled vesicles containing autophagosome marker LC3.	Chloroquine	32-43	cyclin dependent kinase inhibitor 2A	Homo sapiens	70-73
32665905-8	2020	Results: Memantine (2.5 microM), dizocilpine (5 microM), chloroquine (10 and 20 microM) and BD-1063 (1, 10 and 30 microM) decreased the neurotoxic effects of Abeta on the SH-SY5Y cells.	Chloroquine	57-68	amyloid beta precursor protein	Homo sapiens	158-163
32665905-9	2020	However, chloroquine (40 microM) increased the neurotoxic effects of Abeta.	Chloroquine	9-20	amyloid beta precursor protein	Homo sapiens	69-74
32665905-10	2020	Cell viability in the cells treated with memantine + Abeta + chloroquine (10, 20, and 40 muM) was significantly lower than the memantine + Abeta-treated group.	Chloroquine	61-72	amyloid beta precursor protein	Homo sapiens	53-58
32403970-8	2020	Importantly, Mlkl, but not Ripk3, deficiency prevents the inhibition of autophagy by PA or chloroquine in hepatocytes.	Chloroquine	91-102	mixed lineage kinase domain-like	Mus musculus	13-17
32753885-0	2020	Chloroquine Combined with Imatinib Overcomes Imatinib Resistance in Gastrointestinal Stromal Tumors by Inhibiting Autophagy via the MAPK/ERK Pathway.	Chloroquine	0-11	mitogen-activated protein kinase 1	Homo sapiens	137-140
32403970-10	2020	Importantly, inhibition of autophagy by leupeptin or chloroquine triggers MLKL translocation to the plasma membrane, suggesting that MLKL is intimately involved in the regulation of autophagy under multiple conditions.	Chloroquine	53-64	mixed lineage kinase domain-like	Mus musculus	74-78
32403970-10	2020	Importantly, inhibition of autophagy by leupeptin or chloroquine triggers MLKL translocation to the plasma membrane, suggesting that MLKL is intimately involved in the regulation of autophagy under multiple conditions.	Chloroquine	53-64	mixed lineage kinase domain-like	Mus musculus	133-137
31995116-11	2020	Chloroquine significantly reduced PINK1, p62/SQSTM1, Rab9 and particularly Parkin expression during reperfusion, without an effect on mitochondrial total and phospho DRP1 levels.	Chloroquine	0-11	PTEN induced kinase 1	Rattus norvegicus	34-39
32058824-7	2020	Mechanistically, we demonstrated that CQ might enhance the sensitivity of SGC-7901cells and improve the resistance of SGC-7901/DDP cells to DDP through inhibiting mTORC1 pathway, especially to SGC-7901/DDP cells.	Chloroquine	38-40	CREB regulated transcription coactivator 1	Mus musculus	163-169
31995116-11	2020	Chloroquine significantly reduced PINK1, p62/SQSTM1, Rab9 and particularly Parkin expression during reperfusion, without an effect on mitochondrial total and phospho DRP1 levels.	Chloroquine	0-11	KH RNA binding domain containing, signal transduction associated 1	Rattus norvegicus	41-44
31995116-11	2020	Chloroquine significantly reduced PINK1, p62/SQSTM1, Rab9 and particularly Parkin expression during reperfusion, without an effect on mitochondrial total and phospho DRP1 levels.	Chloroquine	0-11	sequestosome 1	Rattus norvegicus	45-51
31995116-11	2020	Chloroquine significantly reduced PINK1, p62/SQSTM1, Rab9 and particularly Parkin expression during reperfusion, without an effect on mitochondrial total and phospho DRP1 levels.	Chloroquine	0-11	RAB9A, member RAS oncogene family	Rattus norvegicus	53-57
32369772-5	2020	CQ treatment induced ER stress, and an unfolded protein response was activated through the PERK-eIF2alpha-ATF4 pathway, resulting in the expression of the pro-apoptotic protein C/EBP homologous protein (CHOP), which reflects ER stress-mediated apoptotic cell death.	Chloroquine	0-2	eukaryotic translation initiation factor 2 alpha kinase 3	Mus musculus	91-95
32291281-9	2020	Despite inhibition of PC2 function by temperature blockade, brefeldin-A, chloroquine, and multiple inhibitors that blocked production of mature glucagon from proglucagon, beta-cells retained the ability to produce mature insulin.	Chloroquine	73-84	proprotein convertase subtilisin/kexin type 2	Homo sapiens	22-25
32369772-5	2020	CQ treatment induced ER stress, and an unfolded protein response was activated through the PERK-eIF2alpha-ATF4 pathway, resulting in the expression of the pro-apoptotic protein C/EBP homologous protein (CHOP), which reflects ER stress-mediated apoptotic cell death.	Chloroquine	0-2	eukaryotic translation initiation factor 2A	Mus musculus	96-105
32369772-5	2020	CQ treatment induced ER stress, and an unfolded protein response was activated through the PERK-eIF2alpha-ATF4 pathway, resulting in the expression of the pro-apoptotic protein C/EBP homologous protein (CHOP), which reflects ER stress-mediated apoptotic cell death.	Chloroquine	0-2	activating transcription factor 4	Mus musculus	106-110
32369772-5	2020	CQ treatment induced ER stress, and an unfolded protein response was activated through the PERK-eIF2alpha-ATF4 pathway, resulting in the expression of the pro-apoptotic protein C/EBP homologous protein (CHOP), which reflects ER stress-mediated apoptotic cell death.	Chloroquine	0-2	DNA-damage inducible transcript 3	Mus musculus	177-201
32369772-5	2020	CQ treatment induced ER stress, and an unfolded protein response was activated through the PERK-eIF2alpha-ATF4 pathway, resulting in the expression of the pro-apoptotic protein C/EBP homologous protein (CHOP), which reflects ER stress-mediated apoptotic cell death.	Chloroquine	0-2	DNA-damage inducible transcript 3	Mus musculus	203-207
32333649-0	2020	The friendly use of chloroquine in the COVID-19 disease: a warning for the G6PD-deficient males and for the unaware carriers of pathogenic alterations of the G6PD gene.	Chloroquine	20-31	glucose-6-phosphate dehydrogenase	Homo sapiens	75-79
32314441-7	2020	Secretion of soluble (P)RR into the medium was increased dose-dependently by bafilomycin A1 or chloroquine.	Chloroquine	95-106	ATPase H+ transporting accessory protein 2	Homo sapiens	21-26
32537026-6	2020	Furthermore, pharmacologically inhibiting autophagy with chloroquine and 3-methyladenine decreased SPAG6 knockdown-mediated apoptosis, indicating that SPAG6 knockdown-mediated autophagy promoted apoptosis in SKM-1 cells.	Chloroquine	57-68	sperm associated antigen 6	Homo sapiens	99-104
32537026-6	2020	Furthermore, pharmacologically inhibiting autophagy with chloroquine and 3-methyladenine decreased SPAG6 knockdown-mediated apoptosis, indicating that SPAG6 knockdown-mediated autophagy promoted apoptosis in SKM-1 cells.	Chloroquine	57-68	sperm associated antigen 6	Homo sapiens	151-156
32469087-7	2020	Concurrently, HMGB1 impaired insulin sensitivities by attenuating the abundance of insulin receptor substrate-1, Akt phosphorylation, GLUT4 translocation, and glucose uptake in granulosa cells, which were reversed by blocking autophagy pathways with siRNA-mediated knockdown of ATG7 or with chloroquine and bafilomycin A1, the lysosome inhibitors.	Chloroquine	291-302	high mobility group box 1	Homo sapiens	14-19
32724457-0	2020	Autophagy-lysosome inhibitor chloroquine prevents CTLA-4 degradation of T cells and attenuates acute rejection in murine skin and heart transplantation.	Chloroquine	29-40	cytotoxic T-lymphocyte-associated protein 4	Mus musculus	50-56
32724457-7	2020	Results: Chloroquine (CQ) was identified as an inhibitor of CTLA-4 degradation, which augmented both surface and total CTLA-4 expression in T cells.	Chloroquine	9-20	cytotoxic T-lymphocyte-associated protein 4	Mus musculus	60-66
32724457-7	2020	Results: Chloroquine (CQ) was identified as an inhibitor of CTLA-4 degradation, which augmented both surface and total CTLA-4 expression in T cells.	Chloroquine	9-20	cytotoxic T-lymphocyte-associated protein 4	Mus musculus	119-125
32724457-7	2020	Results: Chloroquine (CQ) was identified as an inhibitor of CTLA-4 degradation, which augmented both surface and total CTLA-4 expression in T cells.	Chloroquine	22-24	cytotoxic T-lymphocyte-associated protein 4	Mus musculus	60-66
32724457-7	2020	Results: Chloroquine (CQ) was identified as an inhibitor of CTLA-4 degradation, which augmented both surface and total CTLA-4 expression in T cells.	Chloroquine	22-24	cytotoxic T-lymphocyte-associated protein 4	Mus musculus	119-125
32724457-9	2020	Besides decreasing the frequencies of the CD4+ and CD8+ effector T cells, especially IFN-gamma producing T cells, CQ also increased the proportion of regulatory T cells in the spleen.	Chloroquine	114-116	CD4 antigen	Mus musculus	42-45
32724457-10	2020	The CTLA-4 blockade abrogated the benefits of CQ on the survival of heart allografts.	Chloroquine	46-48	cytotoxic T-lymphocyte-associated protein 4	Mus musculus	4-10
32724457-11	2020	Moreover, CQ enhanced CTLA-4 expression in activated human T cells and reduced the secretion of IFN-gamma in human mixed lymphocyte reaction.	Chloroquine	10-12	cytotoxic T-lymphocyte associated protein 4	Homo sapiens	22-28
32724457-11	2020	Moreover, CQ enhanced CTLA-4 expression in activated human T cells and reduced the secretion of IFN-gamma in human mixed lymphocyte reaction.	Chloroquine	10-12	interferon gamma	Homo sapiens	96-105
32220540-8	2020	In accordance, combined treatment with MARCKS antagonists, bortezomib and the autophagy inhibitor, chloroquine, significantly diminished tumor growth in drug-resistant MM cell lines as well as primary MM cells.	Chloroquine	99-110	myristoylated alanine rich protein kinase C substrate	Homo sapiens	39-45
32298640-2	2020	Here, we tested the multimodal capacity of peripheral first-order neurons, focusing on the genetically defined subpopulation of mouse C-fibers that express the chloroquine receptor MrgprA3.	Chloroquine	160-171	MAS-related GPR, member A3	Mus musculus	181-188
32636813-7	2020	The endocytosis of the biomarker MCP is dependent on low pH and cytoskeletal actin filaments, as shown with various inhibitors (chloroquine, ammonia chloride, cytochalasin D).	Chloroquine	128-139	capping actin protein, gelsolin like	Homo sapiens	33-36
32685013-4	2020	Methods: By taking advantage of the strong affinity between negatively charged MnO2 and positively charged chloroquine (CQ), the nanoparticles were fabricated by integrating MnO2 and CQ in human serum albumin (HSA)-based nanoplatform (HSA-MnO2-CQ NPs).	Chloroquine	183-185	albumin	Homo sapiens	195-208
32685013-4	2020	Methods: By taking advantage of the strong affinity between negatively charged MnO2 and positively charged chloroquine (CQ), the nanoparticles were fabricated by integrating MnO2 and CQ in human serum albumin (HSA)-based nanoplatform (HSA-MnO2-CQ NPs).	Chloroquine	183-185	albumin	Homo sapiens	195-208
32555132-6	2020	In addition, CQ or Baf stimulation enhances G1 arrest in TGF-ss treated HK-2 cells, as investigated using propidium iodide (PI) staining and flow cytometry, which was further confirmed by a decrease in the expression of phosphorylated retinoblastoma protein (p-RB) and cyclin-dependent kinase 4 (CDK4).	Chloroquine	13-15	RB transcriptional corepressor 1	Homo sapiens	220-257
32704543-6	2020	We also show that coadministration of lysosomotropic or lysosome-destabilizing compounds (an antibiotic azithromycin, an antidepressant siramesine, an antimalaria compound chloroquine) renders resistant tumor cells sensitive to currently used CDK4/6 inhibitors.	Chloroquine	172-183	cyclin dependent kinase 4	Homo sapiens	243-249
32555132-6	2020	In addition, CQ or Baf stimulation enhances G1 arrest in TGF-ss treated HK-2 cells, as investigated using propidium iodide (PI) staining and flow cytometry, which was further confirmed by a decrease in the expression of phosphorylated retinoblastoma protein (p-RB) and cyclin-dependent kinase 4 (CDK4).	Chloroquine	13-15	RB transcriptional corepressor 1	Homo sapiens	259-263
32555132-6	2020	In addition, CQ or Baf stimulation enhances G1 arrest in TGF-ss treated HK-2 cells, as investigated using propidium iodide (PI) staining and flow cytometry, which was further confirmed by a decrease in the expression of phosphorylated retinoblastoma protein (p-RB) and cyclin-dependent kinase 4 (CDK4).	Chloroquine	13-15	cyclin dependent kinase 4	Homo sapiens	269-294
32555132-6	2020	In addition, CQ or Baf stimulation enhances G1 arrest in TGF-ss treated HK-2 cells, as investigated using propidium iodide (PI) staining and flow cytometry, which was further confirmed by a decrease in the expression of phosphorylated retinoblastoma protein (p-RB) and cyclin-dependent kinase 4 (CDK4).	Chloroquine	13-15	cyclin dependent kinase 4	Homo sapiens	296-300
32555132-7	2020	The upregulation of p21 induced by CQ or Baf may mediate an enhanced G1 arrest in TGF-ss treated HK-2 cells.	Chloroquine	35-37	cyclin dependent kinase inhibitor 1A	Homo sapiens	20-23
32354745-6	2020	We posit that combining the activity of VPA, to modulate epigenetically the  cellular acetylome, with chloroquine, to alter the lysosomal environment to favor stability of the trafficked I1061T variant protein, can have a significant therapeutic benefit in patients carrying at least one copy of the I1061T variant of NPC1, the most common disease-associated mutation leading to NPC disease.	Chloroquine	102-113	NPC intracellular cholesterol transporter 1	Homo sapiens	318-322
32577690-8	2020	The high prevalence of variants in the G6PD gene found in this analysis suggests that it may be a significant interaction factor in clinical trials of chloroquine and hydrochloroquine for treatment of COVID-19 in Africans.	Chloroquine	151-162	glucose-6-phosphate dehydrogenase	Homo sapiens	39-43
32641992-5	2020	PDA@hm was then loaded with autophagy inhibitor chloroquine (CQ) and conjugated with glucose consumer glucose oxidase (GOx) (PDA@hm@CQ@GOx), forming a corona-like structure nanoparticle.	Chloroquine	48-59	hydroxyacid oxidase 1	Homo sapiens	119-122
32641992-5	2020	PDA@hm was then loaded with autophagy inhibitor chloroquine (CQ) and conjugated with glucose consumer glucose oxidase (GOx) (PDA@hm@CQ@GOx), forming a corona-like structure nanoparticle.	Chloroquine	48-59	hydroxyacid oxidase 1	Homo sapiens	135-138
32641992-5	2020	PDA@hm was then loaded with autophagy inhibitor chloroquine (CQ) and conjugated with glucose consumer glucose oxidase (GOx) (PDA@hm@CQ@GOx), forming a corona-like structure nanoparticle.	Chloroquine	61-63	hydroxyacid oxidase 1	Homo sapiens	119-122
32641992-5	2020	PDA@hm was then loaded with autophagy inhibitor chloroquine (CQ) and conjugated with glucose consumer glucose oxidase (GOx) (PDA@hm@CQ@GOx), forming a corona-like structure nanoparticle.	Chloroquine	61-63	hydroxyacid oxidase 1	Homo sapiens	135-138
32641992-5	2020	PDA@hm was then loaded with autophagy inhibitor chloroquine (CQ) and conjugated with glucose consumer glucose oxidase (GOx) (PDA@hm@CQ@GOx), forming a corona-like structure nanoparticle.	Chloroquine	132-134	hydroxyacid oxidase 1	Homo sapiens	119-122
32641992-5	2020	PDA@hm was then loaded with autophagy inhibitor chloroquine (CQ) and conjugated with glucose consumer glucose oxidase (GOx) (PDA@hm@CQ@GOx), forming a corona-like structure nanoparticle.	Chloroquine	132-134	hydroxyacid oxidase 1	Homo sapiens	135-138
32141386-5	2020	3-methyladenine (3-MA) and chloroquine (CQ) could inhibit the activity of ALP, PINP and the autophagy in LF group.	Chloroquine	27-38	alkaline phosphatase, placental	Homo sapiens	74-77
32495214-5	2020	Blocking autophagy with pharmacological inhibitors chloroquine (CQ) or LY294002 partly reduced T-DM1-induced apoptosis and Caspase-3/7 activation, suggesting that autophagy played an essential role in the cytotoxicity induced by T-DM1 in HER2-positive breast cancer cells.	Chloroquine	51-62	immunoglobulin heavy diversity 1-7	Homo sapiens	97-100
32495214-5	2020	Blocking autophagy with pharmacological inhibitors chloroquine (CQ) or LY294002 partly reduced T-DM1-induced apoptosis and Caspase-3/7 activation, suggesting that autophagy played an essential role in the cytotoxicity induced by T-DM1 in HER2-positive breast cancer cells.	Chloroquine	51-62	caspase 3	Homo sapiens	123-134
32495214-5	2020	Blocking autophagy with pharmacological inhibitors chloroquine (CQ) or LY294002 partly reduced T-DM1-induced apoptosis and Caspase-3/7 activation, suggesting that autophagy played an essential role in the cytotoxicity induced by T-DM1 in HER2-positive breast cancer cells.	Chloroquine	64-66	immunoglobulin heavy diversity 1-7	Homo sapiens	97-100
32495214-5	2020	Blocking autophagy with pharmacological inhibitors chloroquine (CQ) or LY294002 partly reduced T-DM1-induced apoptosis and Caspase-3/7 activation, suggesting that autophagy played an essential role in the cytotoxicity induced by T-DM1 in HER2-positive breast cancer cells.	Chloroquine	64-66	caspase 3	Homo sapiens	123-134
32495214-5	2020	Blocking autophagy with pharmacological inhibitors chloroquine (CQ) or LY294002 partly reduced T-DM1-induced apoptosis and Caspase-3/7 activation, suggesting that autophagy played an essential role in the cytotoxicity induced by T-DM1 in HER2-positive breast cancer cells.	Chloroquine	64-66	immunoglobulin heavy diversity 1-7	Homo sapiens	231-234
32495214-5	2020	Blocking autophagy with pharmacological inhibitors chloroquine (CQ) or LY294002 partly reduced T-DM1-induced apoptosis and Caspase-3/7 activation, suggesting that autophagy played an essential role in the cytotoxicity induced by T-DM1 in HER2-positive breast cancer cells.	Chloroquine	64-66	erb-b2 receptor tyrosine kinase 2	Homo sapiens	238-242
32516999-6	2020	Intriguingly, CQ vastly modulated the CNS resident cells astrocytes, oligodendrocytes (OLs) and microglia (MG), with the latter producing IL-10 and IL-12p70.	Chloroquine	14-16	interleukin 10	Mus musculus	138-143
32141386-5	2020	3-methyladenine (3-MA) and chloroquine (CQ) could inhibit the activity of ALP, PINP and the autophagy in LF group.	Chloroquine	40-42	alkaline phosphatase, placental	Homo sapiens	74-77
32249902-12	2020	Moreover, CQ (10 muM) induced GO-OFs apoptosis without aggravating oxidative stress.	Chloroquine	10-12	latexin	Homo sapiens	17-20
32306288-4	2020	Chloroquine is metabolized by cytochrome P450 and renal clearance is responsible for one third of total clearance.	Chloroquine	0-11	cytochrome P450 family 4 subfamily F member 3	Homo sapiens	30-45
32128658-6	2020	However, inhibition of autophagy by 3-methyladenine or chloroquine significantly reduced the anti-inflammatory effect of GSTP1.	Chloroquine	55-66	glutathione S-transferase pi 1	Homo sapiens	121-126
33304449-0	2020	Inhibition of Wnt signaling by Frizzled7 antibody-coated nanoshells sensitizes triple-negative breast cancer cells to the autophagy regulator chloroquine.	Chloroquine	142-153	frizzled class receptor 7	Homo sapiens	31-40
32299030-7	2020	In the cardiomyocyte cell line H9c2, further accumulation of LC3II and the augmentation of p62 after treatment with high glucose and chloroquine confirmed increased autophagic activity in diabetic hearts.	Chloroquine	133-144	KH RNA binding domain containing, signal transduction associated 1	Rattus norvegicus	91-94
32476662-13	2020	Moreover, chloroquine pretreatment abolished sevoflurane-induced infarct size reduction, CK-MB level, NAD+ content loss, and cytochrome c release, with concomitant increase the ratios of LC3II/LC3I and levels of P62 and Beclin 1, but p-AMPK expression was not downregulated by chloroquine.	Chloroquine	10-21	microtubule-associated protein 1 light chain 3 alpha	Rattus norvegicus	187-197
32476662-13	2020	Moreover, chloroquine pretreatment abolished sevoflurane-induced infarct size reduction, CK-MB level, NAD+ content loss, and cytochrome c release, with concomitant increase the ratios of LC3II/LC3I and levels of P62 and Beclin 1, but p-AMPK expression was not downregulated by chloroquine.	Chloroquine	10-21	KH RNA binding domain containing, signal transduction associated 1	Rattus norvegicus	212-215
32476662-13	2020	Moreover, chloroquine pretreatment abolished sevoflurane-induced infarct size reduction, CK-MB level, NAD+ content loss, and cytochrome c release, with concomitant increase the ratios of LC3II/LC3I and levels of P62 and Beclin 1, but p-AMPK expression was not downregulated by chloroquine.	Chloroquine	10-21	beclin 1	Rattus norvegicus	220-228
32476662-13	2020	Moreover, chloroquine pretreatment abolished sevoflurane-induced infarct size reduction, CK-MB level, NAD+ content loss, and cytochrome c release, with concomitant increase the ratios of LC3II/LC3I and levels of P62 and Beclin 1, but p-AMPK expression was not downregulated by chloroquine.	Chloroquine	10-21	protein kinase AMP-activated catalytic subunit alpha 2	Rattus norvegicus	236-240
32375574-2	2021	This study demonstrated the putative inhibitory potential of lopinavir, remdesivir, oseltamir, azithromycin, ribavirin, and chloroquine towards V-ATPase, protein kinase A, SARS-CoV spike glycoprotein/ACE-2 complex and viral proteases.	Chloroquine	124-135	angiotensin converting enzyme 2	Homo sapiens	200-205
32486191-7	2020	Chloroquine and monensin significantly blocked the uptake of rh-alpha-Gal-A, indicating that the clathrin-mediated endocytosis is involved in recombinant enzyme delivery.	Chloroquine	0-11	galactosidase alpha	Homo sapiens	64-75
32424110-13	2020	After inhibiting autophagy with 3-MA or CQ, compared with OA alone, cell mitochondrial membrane potential and ATP concentration were significantly reduced, cell p62 expression was reduced, and LC3-II expression was increased, apoptosis-related protein Bax protein was increased, and Bcl-2 protein was decreased, which suggested that 3-MA or CQ treatment increased OA-induced apoptosis of SMMC-7721 cells.	Chloroquine	40-42	nucleoporin 62	Homo sapiens	161-164
32424110-13	2020	After inhibiting autophagy with 3-MA or CQ, compared with OA alone, cell mitochondrial membrane potential and ATP concentration were significantly reduced, cell p62 expression was reduced, and LC3-II expression was increased, apoptosis-related protein Bax protein was increased, and Bcl-2 protein was decreased, which suggested that 3-MA or CQ treatment increased OA-induced apoptosis of SMMC-7721 cells.	Chloroquine	40-42	BCL2 associated X, apoptosis regulator	Homo sapiens	252-255
32424110-13	2020	After inhibiting autophagy with 3-MA or CQ, compared with OA alone, cell mitochondrial membrane potential and ATP concentration were significantly reduced, cell p62 expression was reduced, and LC3-II expression was increased, apoptosis-related protein Bax protein was increased, and Bcl-2 protein was decreased, which suggested that 3-MA or CQ treatment increased OA-induced apoptosis of SMMC-7721 cells.	Chloroquine	40-42	BCL2 apoptosis regulator	Homo sapiens	283-288
33612800-4	2020	In an acute B. pseudomallei infection model, we have previously demonstrated that treatment with anti-malarial drug, chloroquine, modulated inflammatory cytokine levels and increased animal survivability via Akt-mediated inhibition of glycogen synthase kinase-3beta (GSK3beta).	Chloroquine	117-128	glycogen synthase kinase 3 alpha	Mus musculus	267-275
33612800-6	2020	Here we evaluate the effect of chloroquine treatment in combination with a subtherapeutic dose of the antibiotic doxycycline on animal survivability, cytokine levels and phosphorylation states of GSK3beta (Ser9) in a murine model of acute melioidosis infection to investigate whether chloroquine could be used as an adjunct therapy along with doxycycline for the treatment of melioidosis.	Chloroquine	31-42	glycogen synthase kinase 3 alpha	Mus musculus	196-204
33612800-10	2020	B. pseudomallei-infected mice subjected to adjunct treatment with chloroquine and doxycycline significantly (P<0.05) reduced serum levels of pro-inflammatory cytokines (TNF-alpha, IFN-gamma and IL-6) but increased levels of antiinflammatory cytokines (IL-4 and IL-10).	Chloroquine	66-77	tumor necrosis factor	Mus musculus	169-178
33612800-10	2020	B. pseudomallei-infected mice subjected to adjunct treatment with chloroquine and doxycycline significantly (P<0.05) reduced serum levels of pro-inflammatory cytokines (TNF-alpha, IFN-gamma and IL-6) but increased levels of antiinflammatory cytokines (IL-4 and IL-10).	Chloroquine	66-77	interferon gamma	Mus musculus	180-189
33612800-10	2020	B. pseudomallei-infected mice subjected to adjunct treatment with chloroquine and doxycycline significantly (P<0.05) reduced serum levels of pro-inflammatory cytokines (TNF-alpha, IFN-gamma and IL-6) but increased levels of antiinflammatory cytokines (IL-4 and IL-10).	Chloroquine	66-77	interleukin 6	Mus musculus	194-198
33612800-10	2020	B. pseudomallei-infected mice subjected to adjunct treatment with chloroquine and doxycycline significantly (P<0.05) reduced serum levels of pro-inflammatory cytokines (TNF-alpha, IFN-gamma and IL-6) but increased levels of antiinflammatory cytokines (IL-4 and IL-10).	Chloroquine	66-77	interleukin 4	Mus musculus	252-256
33612800-10	2020	B. pseudomallei-infected mice subjected to adjunct treatment with chloroquine and doxycycline significantly (P<0.05) reduced serum levels of pro-inflammatory cytokines (TNF-alpha, IFN-gamma and IL-6) but increased levels of antiinflammatory cytokines (IL-4 and IL-10).	Chloroquine	66-77	interleukin 10	Mus musculus	261-266
33612800-11	2020	Western blot analysis demonstrated that the intensities of pGSK3beta (Ser9) in liver samples from mice treated with chloroquine and doxycycline combination were significantly (P<0.05) higher suggesting that the adjunct treatment resulted in significant inhibition of GSK3beta.	Chloroquine	116-127	glycogen synthase kinase 3 alpha	Mus musculus	60-68
33612800-12	2020	Taken together the bacteriostatic action of doxycycline coupled with the cytokine-modulating effect of chloroquine gave full protection to B. pseudomallei-infected mice and involved inhibition of GSK3beta.	Chloroquine	103-114	glycogen synthase kinase 3 alpha	Mus musculus	196-204
32199904-5	2020	Autophagy inhibition by palmitic acid and chloroquine in bovine theca cells increased p62 and ubiquitin and induced the expression of cytochrome P450 17A1 (CYP17A1) and plasminogen activator inhibitor-1 (PAI-1) mRNA.	Chloroquine	42-53	nucleoporin 62	Homo sapiens	86-89
32382017-9	2020	We also found ZHX2 overexpression induce Sunitinib resistance though activating autophagy and the combination treatment of Sunitinib and Chloroquine could significantly rescue the phenomenon.	Chloroquine	137-148	zinc fingers and homeoboxes 2	Homo sapiens	14-18
32199904-5	2020	Autophagy inhibition by palmitic acid and chloroquine in bovine theca cells increased p62 and ubiquitin and induced the expression of cytochrome P450 17A1 (CYP17A1) and plasminogen activator inhibitor-1 (PAI-1) mRNA.	Chloroquine	42-53	steroid 17-alpha-hydroxylase/17,20 lyase	Bos taurus	134-154
32199904-5	2020	Autophagy inhibition by palmitic acid and chloroquine in bovine theca cells increased p62 and ubiquitin and induced the expression of cytochrome P450 17A1 (CYP17A1) and plasminogen activator inhibitor-1 (PAI-1) mRNA.	Chloroquine	42-53	steroid 17-alpha-hydroxylase/17,20 lyase	Bos taurus	156-163
32199904-5	2020	Autophagy inhibition by palmitic acid and chloroquine in bovine theca cells increased p62 and ubiquitin and induced the expression of cytochrome P450 17A1 (CYP17A1) and plasminogen activator inhibitor-1 (PAI-1) mRNA.	Chloroquine	42-53	serpin family E member 1	Bos taurus	169-202
32199904-5	2020	Autophagy inhibition by palmitic acid and chloroquine in bovine theca cells increased p62 and ubiquitin and induced the expression of cytochrome P450 17A1 (CYP17A1) and plasminogen activator inhibitor-1 (PAI-1) mRNA.	Chloroquine	42-53	serpin family E member 1	Bos taurus	204-209
32199904-6	2020	Furthermore, palmitic acid and chloroquine exposure significantly increased reactive oxygen species (ROS) and activated p38 and c-Jun N-terminal kinase (JNK).	Chloroquine	31-42	mitogen-activated protein kinase 14	Homo sapiens	120-123
32199904-6	2020	Furthermore, palmitic acid and chloroquine exposure significantly increased reactive oxygen species (ROS) and activated p38 and c-Jun N-terminal kinase (JNK).	Chloroquine	31-42	mitogen-activated protein kinase 8	Homo sapiens	128-151
32199904-6	2020	Furthermore, palmitic acid and chloroquine exposure significantly increased reactive oxygen species (ROS) and activated p38 and c-Jun N-terminal kinase (JNK).	Chloroquine	31-42	mitogen-activated protein kinase 8	Homo sapiens	153-156
32477333-6	2020	The impact was compared with a pharmaceutical agent, i.e., chloroquine (CQN), that is clinically applied to antagonize endosomal TLR- activation.	Chloroquine	59-70	toll like receptor 8	Homo sapiens	129-132
32477333-6	2020	The impact was compared with a pharmaceutical agent, i.e., chloroquine (CQN), that is clinically applied to antagonize endosomal TLR- activation.	Chloroquine	72-75	toll like receptor 8	Homo sapiens	129-132
31175354-9	2020	Cotreatment with CQ and Niraparib promoted the formation of gamma-H2AX foci while inhibiting the recruitment of the homologous recombination (HR) repair protein RAD51 to double-strand break (DSB) sites.	Chloroquine	17-19	RAD51 recombinase	Homo sapiens	161-166
32249612-9	2020	CQ treatment significantly ameliorated lithium-induced polyuria, polydipsia, natriuresis and kaliuresis accompanied with attenuated downregulation of AQP2 and NKCC2 protein.	Chloroquine	0-2	aquaporin 2	Mus musculus	150-154
32249612-9	2020	CQ treatment significantly ameliorated lithium-induced polyuria, polydipsia, natriuresis and kaliuresis accompanied with attenuated downregulation of AQP2 and NKCC2 protein.	Chloroquine	0-2	solute carrier family 12, member 1	Mus musculus	159-164
32249612-10	2020	The protective effect of CQ on AQP2 protein abundance was confirmed in cultured cortical collecting duct cells.	Chloroquine	25-27	aquaporin 2	Mus musculus	31-35
32249612-11	2020	In addition, we found lithium-induced proliferation of collecting duct cells was also suppressed by CQ detected by PCNA staining.	Chloroquine	100-102	proliferating cell nuclear antigen	Mus musculus	115-119
32249612-12	2020	Moreover, both p-mTOR and beta-catenin expression which has been reported to be increased by lithium and associated with cell proliferation were reduced by CQ.	Chloroquine	156-158	mechanistic target of rapamycin kinase	Mus musculus	17-21
32249612-12	2020	Moreover, both p-mTOR and beta-catenin expression which has been reported to be increased by lithium and associated with cell proliferation were reduced by CQ.	Chloroquine	156-158	catenin (cadherin associated protein), beta 1	Mus musculus	26-38
32007918-9	2020	In vivo, combined DDP and autophagy inhibitor chloroquine (CQ) enhanced the anti-tumor effect of DDP; additionally, the negative correlation of MGMT and ATG4B was confirmed.	Chloroquine	59-61	autophagy related 4B cysteine peptidase	Homo sapiens	153-158
32088265-4	2020	Chloroquine and hydroxychloroquine increased IL-1beta-induced CXCL8 secretion in macrophages which was critically dependent on the lysosomotropic character and inhibition of macroautophagy but independent from the NLRP3 inflammasome.	Chloroquine	0-11	interleukin 1 alpha	Homo sapiens	45-53
32088265-4	2020	Chloroquine and hydroxychloroquine increased IL-1beta-induced CXCL8 secretion in macrophages which was critically dependent on the lysosomotropic character and inhibition of macroautophagy but independent from the NLRP3 inflammasome.	Chloroquine	0-11	C-X-C motif chemokine ligand 8	Homo sapiens	62-67
32088265-4	2020	Chloroquine and hydroxychloroquine increased IL-1beta-induced CXCL8 secretion in macrophages which was critically dependent on the lysosomotropic character and inhibition of macroautophagy but independent from the NLRP3 inflammasome.	Chloroquine	0-11	NLR family pyrin domain containing 3	Homo sapiens	214-219
32319589-8	2020	When the autophagic flux was attenuated by the inhibitor, chloroquine, or by genetically modified ATG5 siRNA, the enhancement of TRAIL-induced autophagy by neferine-induced was also attenuated.	Chloroquine	58-69	TNF superfamily member 10	Homo sapiens	129-134
32007918-9	2020	In vivo, combined DDP and autophagy inhibitor chloroquine (CQ) enhanced the anti-tumor effect of DDP; additionally, the negative correlation of MGMT and ATG4B was confirmed.	Chloroquine	46-57	O-6-methylguanine-DNA methyltransferase	Homo sapiens	144-148
32007918-9	2020	In vivo, combined DDP and autophagy inhibitor chloroquine (CQ) enhanced the anti-tumor effect of DDP; additionally, the negative correlation of MGMT and ATG4B was confirmed.	Chloroquine	46-57	autophagy related 4B cysteine peptidase	Homo sapiens	153-158
32007918-9	2020	In vivo, combined DDP and autophagy inhibitor chloroquine (CQ) enhanced the anti-tumor effect of DDP; additionally, the negative correlation of MGMT and ATG4B was confirmed.	Chloroquine	59-61	O-6-methylguanine-DNA methyltransferase	Homo sapiens	144-148
32092826-8	2020	Furthermore, we found that the autophagy level was upregulated in I/R injury, which could be raised further through resveratrol intervention; and chloroquine (CQ, an autophagy inhibitor) did reverse these protective effects of SIRT1 activation.	Chloroquine	146-157	sirtuin 1	Rattus norvegicus	227-232
32092826-8	2020	Furthermore, we found that the autophagy level was upregulated in I/R injury, which could be raised further through resveratrol intervention; and chloroquine (CQ, an autophagy inhibitor) did reverse these protective effects of SIRT1 activation.	Chloroquine	159-161	sirtuin 1	Rattus norvegicus	227-232
32209654-4	2020	We found that administration of autophagic inhibitors such as chloroquine or bafilomycin A1, or depletion of autophagy-related 5 (ATG5), results in accumulation of intracellular VEGFA, indicating that VEGFA is a basal autophagic substrate.	Chloroquine	62-73	vascular endothelial growth factor A	Mus musculus	178-183
32209654-4	2020	We found that administration of autophagic inhibitors such as chloroquine or bafilomycin A1, or depletion of autophagy-related 5 (ATG5), results in accumulation of intracellular VEGFA, indicating that VEGFA is a basal autophagic substrate.	Chloroquine	62-73	vascular endothelial growth factor A	Mus musculus	201-206
32209654-6	2020	We validated these findings by demonstrating the physiological relevance of this process in vivo Mice starved for 48 h exhibited a sharp decrease in overall cardiac and aortic VEGFA that could be blocked by systemic chloroquine treatment.	Chloroquine	216-227	vascular endothelial growth factor A	Mus musculus	176-181
32146648-5	2020	Further we found that autophagy inhibition by CQ pre-treatment led to the generation of ROS and a decrease in the mitochondrial membrane potential (MMP) that subsequently caused caspase-3-mediated apoptotic cell death in NB cells.	Chloroquine	46-48	caspase 3	Homo sapiens	178-187
32102751-6	2020	Sustained autophagy inhibition by CQ exacerbated HFD-induced muscular damage and changes in the expression of Atrogin-1 and MyoD.	Chloroquine	34-36	F-box protein 32	Rattus norvegicus	110-119
32393432-7	2020	Inhibition of autophagy by chloroquine (CQ) affected the anti-apoptotic effect of CCN2.	Chloroquine	27-38	cellular communication network factor 2	Homo sapiens	82-86
32393432-7	2020	Inhibition of autophagy by chloroquine (CQ) affected the anti-apoptotic effect of CCN2.	Chloroquine	40-42	cellular communication network factor 2	Homo sapiens	82-86
31865445-18	2020	Both chloroquine and HCQ may induce PAI in SLE patients.	Chloroquine	5-16	serpin family E member 1	Homo sapiens	36-39
32085901-7	2020	In order to identify the mechanism by which Septin4 interacts with these processes, we blocked autophagy by chloroquine (CQ).	Chloroquine	108-119	septin 4	Mus musculus	44-51
32085901-7	2020	In order to identify the mechanism by which Septin4 interacts with these processes, we blocked autophagy by chloroquine (CQ).	Chloroquine	121-123	septin 4	Mus musculus	44-51
32340354-7	2020	The inhibition of the lysosomal activity with bafilomycin or chloroquine prevented both LiCl- and SB216763-mediated downregulation of Aqp2 protein expression.	Chloroquine	61-72	aquaporin 2	Homo sapiens	134-138
32340354-8	2020	Bafilomycin and chloroquine induced the accumulation of Aqp2 in lysosomal structures, which was prevented in cells treated with dibutyryl cyclic adenosine monophosphate (dbcAMP), which led to phosphorylation and membrane localization of Aqp2.	Chloroquine	16-27	aquaporin 2	Homo sapiens	56-60
32340354-8	2020	Bafilomycin and chloroquine induced the accumulation of Aqp2 in lysosomal structures, which was prevented in cells treated with dibutyryl cyclic adenosine monophosphate (dbcAMP), which led to phosphorylation and membrane localization of Aqp2.	Chloroquine	16-27	aquaporin 2	Homo sapiens	237-241
32132327-9	2020	When chloroquine was used as an inhibitor of autophagy, the apoptosis rate and Caspase-3 expression decreased compared with the use of arecoline alone.	Chloroquine	5-16	caspase 3	Homo sapiens	79-88
31923533-6	2020	The peptide-induced decrease in CLDN2 expression was suppressed by monodansylcadaverine (MDC), a clathrin-dependent endocytosis (CDE) inhibitor, and chloroquine, a lysosome inhibitor.	Chloroquine	149-160	claudin 2	Homo sapiens	32-37
32112488-6	2020	Sustained pharmacological inhibition of autophagy using Chloroquine (50 mg kg-1  day-1 ) abolishes the beneficial effects of beta2 -adrenoceptor activation on the skeletal muscle proteostasis and contractility properties in neurogenic myopathy.	Chloroquine	56-67	adrenergic receptor, beta 2	Mus musculus	125-144
32414129-4	2020	Inhibition of autophagy by a chemical agent (such as chloroquine, bafilomycin A1, or 3-methyladenine) increases the AHR protein levels in HeLa cells whereas activation of autophagy by short-term nutrition deprivation reduces its levels.	Chloroquine	53-64	aryl hydrocarbon receptor	Homo sapiens	116-119
32414129-5	2020	Treatment of chloroquine retards the degradation of AHR and triggers physical interaction between AHR and LC3B.	Chloroquine	13-24	aryl hydrocarbon receptor	Homo sapiens	52-55
32414129-5	2020	Treatment of chloroquine retards the degradation of AHR and triggers physical interaction between AHR and LC3B.	Chloroquine	13-24	aryl hydrocarbon receptor	Homo sapiens	98-101
32414129-5	2020	Treatment of chloroquine retards the degradation of AHR and triggers physical interaction between AHR and LC3B.	Chloroquine	13-24	microtubule associated protein 1 light chain 3 beta	Homo sapiens	106-110
32414129-6	2020	Knockdown of LC3B suppresses the chloroquine-mediated increase of AHR.	Chloroquine	33-44	microtubule associated protein 1 light chain 3 beta	Homo sapiens	13-17
32414129-6	2020	Knockdown of LC3B suppresses the chloroquine-mediated increase of AHR.	Chloroquine	33-44	aryl hydrocarbon receptor	Homo sapiens	66-69
32414129-8	2020	Although most data in this study were derived from HeLa cells, human lung (A549), liver (Hep3B), and breast (T-47D and MDA-MB-468) cells also exhibit AHR levels sensitive to chloroquine treatment and AHR-p62/LC3 interactions.	Chloroquine	174-185	aryl hydrocarbon receptor	Homo sapiens	150-153
32072231-9	2020	Furthermore, a reduction in implantation sites and increase in the HOXA10 and PR protein levels were observed in response to chloroquine treatment.	Chloroquine	125-136	homeobox A10	Mus musculus	67-73
32072231-10	2020	In addition, impaired uterine decidualization and dysregulation of the PR and HOXA10 protein levels was observed after autophagy inhibited by 3-methyladenine and chloroquine in in vivo artificial decidualization mouse model.	Chloroquine	162-173	homeobox A10	Mus musculus	78-84
31955515-3	2020	In this study, we discovered that NEK2 enhances MM cell autophagy, and a combination of autophagy inhibitor chloroquine (CQ) and chemotherapeutic bortezomib (BTZ) significantly prevents NEK2-induced drug resistance in MM cells.	Chloroquine	108-119	NIMA related kinase 2	Homo sapiens	186-190
31955515-3	2020	In this study, we discovered that NEK2 enhances MM cell autophagy, and a combination of autophagy inhibitor chloroquine (CQ) and chemotherapeutic bortezomib (BTZ) significantly prevents NEK2-induced drug resistance in MM cells.	Chloroquine	121-123	NIMA related kinase 2	Homo sapiens	186-190
32235789-6	2020	AhR inhibition blocked TCDD- and chloroquine-induced p65NF-kappaB and p38MAPK phosphorylation in proinflammatory cytokines-stimulated HaCaT cells.	Chloroquine	33-44	aryl hydrocarbon receptor	Homo sapiens	0-3
32232002-0	2020	Chloroquine Inhibits Stemness of Esophageal Squamous Cell Carcinoma Cells Through Targeting CXCR4-STAT3 Pathway.	Chloroquine	0-11	C-X-C motif chemokine receptor 4	Homo sapiens	92-97
31926991-9	2020	Treatment with chloroquine, an inhibitor of autophagic degradation, abrogated CAV1 plasmid-mediated alleviation of lipid accumulation.	Chloroquine	15-26	caveolin 1	Homo sapiens	78-82
32214849-11	2020	Chloroquine treatment enhanced autophagosome accumulation and cell death but with reduced c-PARP level suggests that mechanism of caspase-independent cell death also contributes to Verapamil/chemotherapy-induced anticancer effects.	Chloroquine	0-11	poly(ADP-ribose) polymerase 1	Homo sapiens	92-96
32232002-0	2020	Chloroquine Inhibits Stemness of Esophageal Squamous Cell Carcinoma Cells Through Targeting CXCR4-STAT3 Pathway.	Chloroquine	0-11	signal transducer and activator of transcription 3	Homo sapiens	98-103
32232002-5	2020	Furthermore, the anti-malarial agent chloroquine (CQ) targeted CXCR4-positive ESCC cells via STAT3 pathway.	Chloroquine	37-48	C-X-C motif chemokine receptor 4	Homo sapiens	63-68
32232002-5	2020	Furthermore, the anti-malarial agent chloroquine (CQ) targeted CXCR4-positive ESCC cells via STAT3 pathway.	Chloroquine	37-48	signal transducer and activator of transcription 3	Homo sapiens	93-98
32232002-5	2020	Furthermore, the anti-malarial agent chloroquine (CQ) targeted CXCR4-positive ESCC cells via STAT3 pathway.	Chloroquine	50-52	C-X-C motif chemokine receptor 4	Homo sapiens	63-68
32232002-5	2020	Furthermore, the anti-malarial agent chloroquine (CQ) targeted CXCR4-positive ESCC cells via STAT3 pathway.	Chloroquine	50-52	signal transducer and activator of transcription 3	Homo sapiens	93-98
31902824-7	2020	The expression levels of CD81 in HEK293T cells treated with a proteasome inhibitor (lactacystin) and lysosome inhibitors (chloroquine and bafilomycin A1) were analyzed by flow cytometry.	Chloroquine	122-133	CD81 molecule	Homo sapiens	25-29
32210783-7	2020	After Bafilomycin A1 and Chloroquine (CQ) blocked the fusion of autophagy and lysosome, as well as the degradation of autolysosomes (ALs), DHA treatment increased the level of LC3 II/I and decreased the expression of p62.	Chloroquine	25-36	nucleoporin 62	Mus musculus	217-220
32210783-7	2020	After Bafilomycin A1 and Chloroquine (CQ) blocked the fusion of autophagy and lysosome, as well as the degradation of autolysosomes (ALs), DHA treatment increased the level of LC3 II/I and decreased the expression of p62.	Chloroquine	38-40	nucleoporin 62	Mus musculus	217-220
31184563-5	2020	Furthermore, autophagy and ATG7 (autophagy related 7) expression was induced in BAT by Dex, and treatment with the autophagy inhibitor chloroquine or adenovirus-mediated ATG7 knockdown prevented Dex-induced BAT whitening and fat mass gain.	Chloroquine	135-146	autophagy related 7	Mus musculus	27-31
31184563-5	2020	Furthermore, autophagy and ATG7 (autophagy related 7) expression was induced in BAT by Dex, and treatment with the autophagy inhibitor chloroquine or adenovirus-mediated ATG7 knockdown prevented Dex-induced BAT whitening and fat mass gain.	Chloroquine	135-146	autophagy related 7	Mus musculus	33-52
31902824-11	2020	CD81 was mainly localized on the plasma membrane in normal cells, but also co-localized with lysosomal LAMP1 and early endosomal EEA1 in chloroquine-treated cells.	Chloroquine	137-148	CD81 molecule	Homo sapiens	0-4
31902824-11	2020	CD81 was mainly localized on the plasma membrane in normal cells, but also co-localized with lysosomal LAMP1 and early endosomal EEA1 in chloroquine-treated cells.	Chloroquine	137-148	early endosome antigen 1	Homo sapiens	129-133
31884097-4	2020	KEY FINDINGS: We observed that both 4-PBA and CQ treatment significantly inhibited the excessive autophagy and reduced apoptosis as well as decreasing p-PERK and p-eIF2alpha expressions.	Chloroquine	46-48	eukaryotic translation initiation factor 2A	Rattus norvegicus	164-173
32001317-5	2020	In addition, treatment of cells with autophagy flux inhibitor, chloroquine, induced further accumulation of LC3-II, suggesting that mitophagy induced by rotenone is due to involvement of mitochondrial FUNDC1.	Chloroquine	63-74	FUN14 domain containing 1	Homo sapiens	201-207
31302751-9	2020	Treatment of cells with chloroquine increased abundance of AQP2-WT, but not AQP2-L137P.	Chloroquine	24-35	aquaporin 2	Homo sapiens	59-63
31302751-9	2020	Treatment of cells with chloroquine increased abundance of AQP2-WT, but not AQP2-L137P.	Chloroquine	24-35	aquaporin 2	Homo sapiens	59-64
31535378-9	2020	Treatment with OPG and chloroquine, an autophagy inhibitor, attenuated OPG-induced inhibition of osteoclastic bone resorption, whereas rapamycin (RAP), an autophagy inducer, enhanced OPG-induced inhibition of differentiation, survival, and bone resorption activity of osteoclasts.	Chloroquine	23-34	tumor necrosis factor receptor superfamily, member 11b (osteoprotegerin)	Mus musculus	71-74
31535378-9	2020	Treatment with OPG and chloroquine, an autophagy inhibitor, attenuated OPG-induced inhibition of osteoclastic bone resorption, whereas rapamycin (RAP), an autophagy inducer, enhanced OPG-induced inhibition of differentiation, survival, and bone resorption activity of osteoclasts.	Chloroquine	23-34	tumor necrosis factor receptor superfamily, member 11b (osteoprotegerin)	Mus musculus	71-74
31926268-7	2020	Inhibition of autophagy with chloroquine (CQ) disordered the protective effects of Mfn2 overexpression on NPCs.	Chloroquine	29-40	mitofusin 2	Rattus norvegicus	83-87
31926268-7	2020	Inhibition of autophagy with chloroquine (CQ) disordered the protective effects of Mfn2 overexpression on NPCs.	Chloroquine	42-44	mitofusin 2	Rattus norvegicus	83-87
32033497-13	2020	Combined treatment with Tenovin-6 and autophagy inhibitor chloroquine increased the cytotoxic effect by inducing microtubule-associated protein 1 light chain 3B (LC3B)-II accumulation, and by enhancing apoptosis and cell-cycle arrest.	Chloroquine	58-69	microtubule associated protein 1 light chain 3 beta	Homo sapiens	162-166
31913597-4	2020	One new compound, Y7j, was found to demonstrate good potency against chloroquine-resistant Plasmodium falciparum Dd2 cells (EC50 = 0.33 muM) without eliciting cytotoxicity against HepG2 cells (EC50 > 40 muM).	Chloroquine	69-80	latexin	Homo sapiens	136-139
32070358-9	2020	Parasites harbouring pfcrt K76 alleles showed significantly lower IC50s to chloroquine than the parasites harbouring K76T alleles (21.4 nM vs. 43.1 nM, p-value = 3.9 x 10-8).	Chloroquine	75-86	keratin 76	Homo sapiens	27-30
32070358-11	2020	CONCLUSION: This study found evidence of stable persistence of chloroquine susceptibility with the fixation of pfcrt K76 in Northern Uganda after discontinuation of chloroquine in the region.	Chloroquine	63-74	keratin 76	Homo sapiens	117-120
32070358-11	2020	CONCLUSION: This study found evidence of stable persistence of chloroquine susceptibility with the fixation of pfcrt K76 in Northern Uganda after discontinuation of chloroquine in the region.	Chloroquine	165-176	keratin 76	Homo sapiens	117-120
32104716-0	2020	Chloroquine and Rapamycin Augment Interleukin-37 Expression via the LC3, ERK, and AP-1 Axis in the Presence of Lipopolysaccharides.	Chloroquine	0-11	microtubule associated protein 1 light chain 3 alpha	Homo sapiens	68-71
32104716-0	2020	Chloroquine and Rapamycin Augment Interleukin-37 Expression via the LC3, ERK, and AP-1 Axis in the Presence of Lipopolysaccharides.	Chloroquine	0-11	mitogen-activated protein kinase 1	Homo sapiens	73-76
32104716-0	2020	Chloroquine and Rapamycin Augment Interleukin-37 Expression via the LC3, ERK, and AP-1 Axis in the Presence of Lipopolysaccharides.	Chloroquine	0-11	Jun proto-oncogene, AP-1 transcription factor subunit	Homo sapiens	82-86
32104716-8	2020	IL-37 was upregulated by rapamycin and chloroquine in both U937 cells and human PBMCs in the presence of LPS.	Chloroquine	39-50	interleukin 37	Homo sapiens	0-5
32104716-12	2020	In monkeys, chloroquine increased IL-37 expression, which was inversely correlated with CD4 proliferation and phosphorylated STAT3.	Chloroquine	12-23	interleukin 37	Homo sapiens	34-39
32104716-12	2020	In monkeys, chloroquine increased IL-37 expression, which was inversely correlated with CD4 proliferation and phosphorylated STAT3.	Chloroquine	12-23	CD4 molecule	Homo sapiens	88-91
32104716-12	2020	In monkeys, chloroquine increased IL-37 expression, which was inversely correlated with CD4 proliferation and phosphorylated STAT3.	Chloroquine	12-23	signal transducer and activator of transcription 3	Homo sapiens	125-130
32104716-13	2020	IL-37 levels were induced by rapamycin and chloroquine through the LC3, Erk1/2, and NF-kappaB/AP-1 pathways.	Chloroquine	43-54	interleukin 37	Homo sapiens	0-5
32104716-13	2020	IL-37 levels were induced by rapamycin and chloroquine through the LC3, Erk1/2, and NF-kappaB/AP-1 pathways.	Chloroquine	43-54	microtubule associated protein 1 light chain 3 alpha	Homo sapiens	67-70
32104716-13	2020	IL-37 levels were induced by rapamycin and chloroquine through the LC3, Erk1/2, and NF-kappaB/AP-1 pathways.	Chloroquine	43-54	mitogen-activated protein kinase 3	Homo sapiens	72-78
32104716-13	2020	IL-37 levels were induced by rapamycin and chloroquine through the LC3, Erk1/2, and NF-kappaB/AP-1 pathways.	Chloroquine	43-54	Jun proto-oncogene, AP-1 transcription factor subunit	Homo sapiens	94-98
33346412-7	2020	The expressions of LC3 and Bcl-2 in the testis tissue were significantly higher in the VC + rapamycin (P<0.01) but lower in the VC + chloroquine group (P<0.01), while those of p62 and Bax remarkably lower in the VC + rapamycin (P<0.01) but higher in the VC + chloroquine group than in the VC model controls (P<0.01).	Chloroquine	133-144	annexin A3	Rattus norvegicus	19-22
33346412-7	2020	The expressions of LC3 and Bcl-2 in the testis tissue were significantly higher in the VC + rapamycin (P<0.01) but lower in the VC + chloroquine group (P<0.01), while those of p62 and Bax remarkably lower in the VC + rapamycin (P<0.01) but higher in the VC + chloroquine group than in the VC model controls (P<0.01).	Chloroquine	259-270	annexin A3	Rattus norvegicus	19-22
31738958-6	2020	Knockdown of ATG7, beclin-1 or cotreatment with chloroquine, partly restored sensitivity to docetaxel in the FOXM1-overexpressing cells.	Chloroquine	48-59	forkhead box M1	Homo sapiens	109-114
32089648-0	2020	CD154 Induces Interleukin-6 Secretion by Kidney Tubular Epithelial Cells under Hypoxic Conditions: Inhibition by Chloroquine.	Chloroquine	113-124	CD40 ligand	Homo sapiens	0-5
32089648-0	2020	CD154 Induces Interleukin-6 Secretion by Kidney Tubular Epithelial Cells under Hypoxic Conditions: Inhibition by Chloroquine.	Chloroquine	113-124	interleukin 6	Homo sapiens	14-27
32089648-7	2020	Searching for inhibitors of CD154-mediated IL-6 production by HK-2 cells in hypoxic conditions, we observed that chloroquine, a drug that has been repurposed as an anti-inflammatory agent, alleviated this induction.	Chloroquine	113-124	CD40 ligand	Homo sapiens	28-33
32089648-7	2020	Searching for inhibitors of CD154-mediated IL-6 production by HK-2 cells in hypoxic conditions, we observed that chloroquine, a drug that has been repurposed as an anti-inflammatory agent, alleviated this induction.	Chloroquine	113-124	interleukin 6	Homo sapiens	43-47
32089648-9	2020	The inhibition of CD154-induced IL-6 production by chloroquine suggests the potential usefulness of this drug as a therapeutic adjunct in conditions associated with acute kidney injury.	Chloroquine	51-62	CD40 ligand	Homo sapiens	18-23
32089648-9	2020	The inhibition of CD154-induced IL-6 production by chloroquine suggests the potential usefulness of this drug as a therapeutic adjunct in conditions associated with acute kidney injury.	Chloroquine	51-62	interleukin 6	Homo sapiens	32-36
31732153-9	2020	Moreover, in RNF183-expressing cells, chloroquine treatment increased the protein levels of the alpha1 and beta1 subunits.	Chloroquine	38-49	ring finger protein 183	Homo sapiens	13-19
31732153-9	2020	Moreover, in RNF183-expressing cells, chloroquine treatment increased the protein levels of the alpha1 and beta1 subunits.	Chloroquine	38-49	adrenoceptor alpha 1D	Homo sapiens	96-112
31892570-8	2020	Finally, the combined treatment of 3-MA or CQ with DDP further up-regulated DDP-induced caspase-3 activity in vitro and exhibited synergistic anti-tumor effects on mice.	Chloroquine	43-45	caspase 3	Mus musculus	88-97
31653348-6	2020	Mechanistic studies of LC3-II, p62 and phosphorylation of p70S6K in HepG2 cells revealed that MTX treatment induced mTOR-dependent autophagy activation, which was further confirmed by the autophagic flux assay using lysosomal inhibitor chloroquine (CQ).	Chloroquine	236-247	mechanistic target of rapamycin kinase	Homo sapiens	116-120
31653348-6	2020	Mechanistic studies of LC3-II, p62 and phosphorylation of p70S6K in HepG2 cells revealed that MTX treatment induced mTOR-dependent autophagy activation, which was further confirmed by the autophagic flux assay using lysosomal inhibitor chloroquine (CQ).	Chloroquine	249-251	mechanistic target of rapamycin kinase	Homo sapiens	116-120
31653348-7	2020	In the combined treatment of MTX and CQ, where autophagy was inhibited by CQ, the elevations of cleaved Caspase-3 and PARP were observed, indicating the enhanced apoptosis in HepG2 cells.	Chloroquine	37-39	poly(ADP-ribose) polymerase 1	Homo sapiens	118-122
31661702-8	2020	Decreased expression of LC3II/I and p-AKT was demonstrated in CQ-treated rats.	Chloroquine	62-64	microtubule-associated protein 1 light chain 3 alpha	Rattus norvegicus	24-31
31647899-9	2020	In addition, chloroquine pretreatment reduced High-mobility group box 1 (HMGB1) content in the cerebrospinal fluid (CSF) and serum and lowered myeloperoxidase (MPO) activity and inflammatory cytokines gene expression both in the ob/ob diabetic mice and WT mice.	Chloroquine	13-24	high mobility group box 1	Mus musculus	46-71
31647899-9	2020	In addition, chloroquine pretreatment reduced High-mobility group box 1 (HMGB1) content in the cerebrospinal fluid (CSF) and serum and lowered myeloperoxidase (MPO) activity and inflammatory cytokines gene expression both in the ob/ob diabetic mice and WT mice.	Chloroquine	13-24	high mobility group box 1	Mus musculus	73-78
31647899-9	2020	In addition, chloroquine pretreatment reduced High-mobility group box 1 (HMGB1) content in the cerebrospinal fluid (CSF) and serum and lowered myeloperoxidase (MPO) activity and inflammatory cytokines gene expression both in the ob/ob diabetic mice and WT mice.	Chloroquine	13-24	myeloperoxidase	Mus musculus	143-158
31647899-9	2020	In addition, chloroquine pretreatment reduced High-mobility group box 1 (HMGB1) content in the cerebrospinal fluid (CSF) and serum and lowered myeloperoxidase (MPO) activity and inflammatory cytokines gene expression both in the ob/ob diabetic mice and WT mice.	Chloroquine	13-24	myeloperoxidase	Mus musculus	160-163
31647899-10	2020	Moreover, harmful DNA damage-signaling responses, including PARP activation and p53 activation, were also attenuated by chloroquine pretreatment in these two kinds of mice.	Chloroquine	120-131	poly (ADP-ribose) polymerase family, member 1	Mus musculus	60-64
31647899-10	2020	Moreover, harmful DNA damage-signaling responses, including PARP activation and p53 activation, were also attenuated by chloroquine pretreatment in these two kinds of mice.	Chloroquine	120-131	transformation related protein 53, pseudogene	Mus musculus	80-83
31479873-6	2020	Besides, inhibition of autophagy by chloroquine or 3-methyladenin and its activation by rapamycin were associated with elevated mRNA and protein levels of IL-6 and TNF-alpha inflammatory cytokines in C2C12 cells.	Chloroquine	36-47	interleukin 6	Mus musculus	155-159
31479873-6	2020	Besides, inhibition of autophagy by chloroquine or 3-methyladenin and its activation by rapamycin were associated with elevated mRNA and protein levels of IL-6 and TNF-alpha inflammatory cytokines in C2C12 cells.	Chloroquine	36-47	tumor necrosis factor	Mus musculus	164-173
33052313-6	2020	Moreover, the docking on mucin as well as various receptors including Angiotensin-converting enzyme 2 (ACE-2), heparin sulphate proteoglycan and Phosphatidylinositol binding clathrin assembly protein (PICALM), which are expressed in the lung and intranasal tissues and represent initial sites of attachment of the viral particles to the surface of respiratory cells, has shown good binding of CQ and HCQ to these receptors.	Chloroquine	393-395	phosphatidylinositol binding clathrin assembly protein	Homo sapiens	145-199
33292107-6	2020	Chloroquine is both an inhibitor and inducer of the transporter MRP1 and is also a substrate of the Mate and MRP1 transport systems.	Chloroquine	0-11	ATP binding cassette subfamily C member 1	Homo sapiens	64-68
33292107-6	2020	Chloroquine is both an inhibitor and inducer of the transporter MRP1 and is also a substrate of the Mate and MRP1 transport systems.	Chloroquine	0-11	ATP binding cassette subfamily C member 1	Homo sapiens	109-113
31661702-8	2020	Decreased expression of LC3II/I and p-AKT was demonstrated in CQ-treated rats.	Chloroquine	62-64	AKT serine/threonine kinase 1	Rattus norvegicus	38-41
31661702-10	2020	Both MR and AQP2, which are mainly located in the distal tubule and collecting duct, were significantly reduced in CQ-treated rats, thus leading to increased exosomal secretion of AQP2 in urine.	Chloroquine	115-117	aquaporin 2	Rattus norvegicus	12-16
31661702-10	2020	Both MR and AQP2, which are mainly located in the distal tubule and collecting duct, were significantly reduced in CQ-treated rats, thus leading to increased exosomal secretion of AQP2 in urine.	Chloroquine	115-117	aquaporin 2	Rattus norvegicus	180-184
31661702-11	2020	Additionally, chronic CQ administration increased aldosterone and vasopressin levels in serum, but lowered the blood pressure, glomerular filtration rate, and urine concentration.	Chloroquine	22-24	arginine vasopressin	Rattus norvegicus	66-77
31661702-12	2020	CONCLUSIONS: CQ administration damages glomerular, proximal tubule autophagy, and severe distal tubular cells apoptosis by inhibiting cAMP/PKA/AKT signaling.	Chloroquine	13-15	AKT serine/threonine kinase 1	Rattus norvegicus	143-146
31701195-4	2019	Moreover, miR328 was found selectively degraded in the lysosomes of K562R cells, as inhibition of lysosome with chloroquine restored miR328 expression and increased sensitivity to imatinib.	Chloroquine	112-123	microRNA 328	Homo sapiens	10-16
31852519-6	2019	Exposed cells then underwent RNA sequencing (RNAseq) to determine the effects of TX or CQ co-treatments on cellular response to IFN-gamma at a molecular level.	Chloroquine	87-89	interferon gamma	Homo sapiens	128-137
32473812-7	2020	The chloroquine hype, fueled by low-quality studies and media announcements, has yielded to the implementation of more than 150 studies worldwide.	Chloroquine	4-15	FIC domain protein adenylyltransferase	Homo sapiens	16-20
31849673-6	2019	Additionally, aFGF promoted autophagy with increasing mTOR and decreasing p62 expressions, and then exerts its neuroprotective role in 6-OHDA-treated PC12 cells, which were abolished by chloroquine (CQ) treatment.	Chloroquine	186-197	fibroblast growth factor 1	Rattus norvegicus	14-18
31849673-6	2019	Additionally, aFGF promoted autophagy with increasing mTOR and decreasing p62 expressions, and then exerts its neuroprotective role in 6-OHDA-treated PC12 cells, which were abolished by chloroquine (CQ) treatment.	Chloroquine	199-201	fibroblast growth factor 1	Rattus norvegicus	14-18
31574376-16	2019	Additionally, overexpression of AR suppressed ENZ-induced autophagy-related genes (LC3-II/I, ATG5, and p-AMPKalpha) in T24 cells, and CQ exerted synergistic effects with ENZ to suppressed AR-responsive genes expression (KLK2 and KLK3) in bladder cancer.	Chloroquine	134-136	androgen receptor	Homo sapiens	32-34
31574376-16	2019	Additionally, overexpression of AR suppressed ENZ-induced autophagy-related genes (LC3-II/I, ATG5, and p-AMPKalpha) in T24 cells, and CQ exerted synergistic effects with ENZ to suppressed AR-responsive genes expression (KLK2 and KLK3) in bladder cancer.	Chloroquine	134-136	androgen receptor	Homo sapiens	188-190
31574376-16	2019	Additionally, overexpression of AR suppressed ENZ-induced autophagy-related genes (LC3-II/I, ATG5, and p-AMPKalpha) in T24 cells, and CQ exerted synergistic effects with ENZ to suppressed AR-responsive genes expression (KLK2 and KLK3) in bladder cancer.	Chloroquine	134-136	kallikrein related peptidase 2	Homo sapiens	220-224
31574376-16	2019	Additionally, overexpression of AR suppressed ENZ-induced autophagy-related genes (LC3-II/I, ATG5, and p-AMPKalpha) in T24 cells, and CQ exerted synergistic effects with ENZ to suppressed AR-responsive genes expression (KLK2 and KLK3) in bladder cancer.	Chloroquine	134-136	kallikrein related peptidase 3	Homo sapiens	229-233
31701195-4	2019	Moreover, miR328 was found selectively degraded in the lysosomes of K562R cells, as inhibition of lysosome with chloroquine restored miR328 expression and increased sensitivity to imatinib.	Chloroquine	112-123	microRNA 328	Homo sapiens	133-139
31824317-0	2019	Intradermal Injection of Oxytocin Aggravates Chloroquine-Induced Itch Responses via Activating the Vasopressin-1a Receptor/Nitric Oxide Pathway in Mice.	Chloroquine	45-56	itchy, E3 ubiquitin protein ligase	Mus musculus	65-69
31827438-3	2019	We thus tested the hypothesis that blocking IK1 and IKACh with chloroquine decreases the burden of persistent atrial fibrillation.	Chloroquine	63-74	IKAROS family zinc finger 1	Homo sapiens	44-47
31827438-4	2019	We used patch clamp to determine the IC50 of IK1 and IKACh block by chloroquine and molecular modeling to simulate the interaction between chloroquine and Kir2.1 and Kir3.1, the molecular correlates of IK1 and IKACh.	Chloroquine	139-150	potassium inwardly rectifying channel subfamily J member 2	Homo sapiens	155-161
31827438-4	2019	We used patch clamp to determine the IC50 of IK1 and IKACh block by chloroquine and molecular modeling to simulate the interaction between chloroquine and Kir2.1 and Kir3.1, the molecular correlates of IK1 and IKACh.	Chloroquine	139-150	potassium inwardly rectifying channel subfamily J member 3	Homo sapiens	166-172
31827438-4	2019	We used patch clamp to determine the IC50 of IK1 and IKACh block by chloroquine and molecular modeling to simulate the interaction between chloroquine and Kir2.1 and Kir3.1, the molecular correlates of IK1 and IKACh.	Chloroquine	139-150	IKAROS family zinc finger 1	Homo sapiens	202-205
31827438-7	2019	In patch clamp the IC50 of IK1 block by chloroquine was similar to that of IKACh.	Chloroquine	40-51	IKAROS family zinc finger 1	Homo sapiens	27-30
31473883-5	2019	Moreover, MCF-7 cells with chloroquine (CQ) treatment boosted Rasal2 KO-induced secretory autophagy.	Chloroquine	27-38	RAS protein activator like 2	Homo sapiens	62-68
31473883-5	2019	Moreover, MCF-7 cells with chloroquine (CQ) treatment boosted Rasal2 KO-induced secretory autophagy.	Chloroquine	40-42	RAS protein activator like 2	Homo sapiens	62-68
31676321-8	2019	The relationship between alpinetin-regulated AhR/suv39h1/TSC2/mTORC1 signals, autophagy and apoptosis of Caco-2 and NCM460 cells was confirmed by using CH223191, siAhR, siTSC2 and chloroquine.	Chloroquine	180-191	aryl hydrocarbon receptor	Homo sapiens	45-48
31676321-8	2019	The relationship between alpinetin-regulated AhR/suv39h1/TSC2/mTORC1 signals, autophagy and apoptosis of Caco-2 and NCM460 cells was confirmed by using CH223191, siAhR, siTSC2 and chloroquine.	Chloroquine	180-191	SUV39H1 histone lysine methyltransferase	Homo sapiens	49-56
31824317-7	2019	In conclusion, OT plays a role in CQ-induced scratching behavior via V1AR binding events.	Chloroquine	34-36	arginine vasopressin receptor 1A	Mus musculus	69-73
31824317-8	2019	V1AR antagonists could be used as possible treatments for CQ-induced itch.	Chloroquine	58-60	arginine vasopressin receptor 1A	Mus musculus	0-4
31824317-8	2019	V1AR antagonists could be used as possible treatments for CQ-induced itch.	Chloroquine	58-60	itchy, E3 ubiquitin protein ligase	Mus musculus	69-73
31824317-0	2019	Intradermal Injection of Oxytocin Aggravates Chloroquine-Induced Itch Responses via Activating the Vasopressin-1a Receptor/Nitric Oxide Pathway in Mice.	Chloroquine	45-56	arginine vasopressin receptor 1A	Mus musculus	99-122
31827702-7	2019	Cotreatment with the autophagy inhibitor (3-methyladenine, LY294002, or chloroquine) resulted in a significant enhancement of quercetin-induced BAK activation and subsequently the mitochondrial damage-mediated apoptosis pathway by augmenting the downregulation of BAG3 and MCL-1 levels in J/Neo cells.	Chloroquine	72-83	BAG cochaperone 3	Homo sapiens	264-268
31827702-7	2019	Cotreatment with the autophagy inhibitor (3-methyladenine, LY294002, or chloroquine) resulted in a significant enhancement of quercetin-induced BAK activation and subsequently the mitochondrial damage-mediated apoptosis pathway by augmenting the downregulation of BAG3 and MCL-1 levels in J/Neo cells.	Chloroquine	72-83	MCL1 apoptosis regulator, BCL2 family member	Homo sapiens	273-278
31824317-5	2019	Mechanistically, OT-mediated enhancement of CQ-induced scratching behavior was significantly suppressed by conivaptan (0.05 mg/ml), a vasopressin-1a receptor (V1AR) antagonist and 1,400 W (3 mg/kg), inhibitor of inducible nitric oxide synthase (iNOS), but not OT receptor (OTR) antagonist L-368,899 (0.05 mg/ml).	Chloroquine	44-46	arginine vasopressin receptor 1A	Mus musculus	134-157
31824317-5	2019	Mechanistically, OT-mediated enhancement of CQ-induced scratching behavior was significantly suppressed by conivaptan (0.05 mg/ml), a vasopressin-1a receptor (V1AR) antagonist and 1,400 W (3 mg/kg), inhibitor of inducible nitric oxide synthase (iNOS), but not OT receptor (OTR) antagonist L-368,899 (0.05 mg/ml).	Chloroquine	44-46	arginine vasopressin receptor 1A	Mus musculus	159-163
31824317-5	2019	Mechanistically, OT-mediated enhancement of CQ-induced scratching behavior was significantly suppressed by conivaptan (0.05 mg/ml), a vasopressin-1a receptor (V1AR) antagonist and 1,400 W (3 mg/kg), inhibitor of inducible nitric oxide synthase (iNOS), but not OT receptor (OTR) antagonist L-368,899 (0.05 mg/ml).	Chloroquine	44-46	nitric oxide synthase 2, inducible	Mus musculus	212-243
31824317-5	2019	Mechanistically, OT-mediated enhancement of CQ-induced scratching behavior was significantly suppressed by conivaptan (0.05 mg/ml), a vasopressin-1a receptor (V1AR) antagonist and 1,400 W (3 mg/kg), inhibitor of inducible nitric oxide synthase (iNOS), but not OT receptor (OTR) antagonist L-368,899 (0.05 mg/ml).	Chloroquine	44-46	nitric oxide synthase 2, inducible	Mus musculus	245-249
31824317-5	2019	Mechanistically, OT-mediated enhancement of CQ-induced scratching behavior was significantly suppressed by conivaptan (0.05 mg/ml), a vasopressin-1a receptor (V1AR) antagonist and 1,400 W (3 mg/kg), inhibitor of inducible nitric oxide synthase (iNOS), but not OT receptor (OTR) antagonist L-368,899 (0.05 mg/ml).	Chloroquine	44-46	oxytocin receptor	Mus musculus	260-271
31824317-5	2019	Mechanistically, OT-mediated enhancement of CQ-induced scratching behavior was significantly suppressed by conivaptan (0.05 mg/ml), a vasopressin-1a receptor (V1AR) antagonist and 1,400 W (3 mg/kg), inhibitor of inducible nitric oxide synthase (iNOS), but not OT receptor (OTR) antagonist L-368,899 (0.05 mg/ml).	Chloroquine	44-46	oxytocin receptor	Mus musculus	273-276
31630227-8	2019	Klotho gene deficiency-induced arterial stiffness was accompanied by upregulation of MMP9, TGFbeta-1, TGFbeta-3, RUNX2, and ALP, but these changes were effectively mitigated by chloroquine.	Chloroquine	177-188	klotho	Mus musculus	0-6
31542387-12	2019	By contrast, pretreatment with CQ further enhanced NLRP3 inflammasome signaling pathway.	Chloroquine	31-33	NLR family, pyrin domain containing 3	Mus musculus	51-56
31630227-9	2019	Chloroquine also halted an increase in scleraxis expression in aortas of Klotho (+/-) mice.	Chloroquine	0-11	scleraxis	Mus musculus	39-48
31630227-9	2019	Chloroquine also halted an increase in scleraxis expression in aortas of Klotho (+/-) mice.	Chloroquine	0-11	klotho	Mus musculus	73-79
31630227-12	2019	Suppression of enhanced autophagy by chloroquine lessens Klotho gene deficiency-induced arterial stiffening and hypertension by stopping upregulation of MMP9 and scleraxis.	Chloroquine	37-48	matrix metallopeptidase 9	Mus musculus	153-157
31630227-12	2019	Suppression of enhanced autophagy by chloroquine lessens Klotho gene deficiency-induced arterial stiffening and hypertension by stopping upregulation of MMP9 and scleraxis.	Chloroquine	37-48	scleraxis	Mus musculus	162-171
31664129-7	2019	Importantly, using a valid animal model of inflammatory bowel disease (IBD), we demonstrated that CQ promotes Foxp3 expression and differentiation of TREG cells in a Nurr1-dependent manner, leading to significant improvement of IBD-related symptoms.	Chloroquine	98-100	forkhead box P3	Homo sapiens	110-115
31664129-7	2019	Importantly, using a valid animal model of inflammatory bowel disease (IBD), we demonstrated that CQ promotes Foxp3 expression and differentiation of TREG cells in a Nurr1-dependent manner, leading to significant improvement of IBD-related symptoms.	Chloroquine	98-100	nuclear receptor subfamily 4 group A member 2	Homo sapiens	166-171
31664129-0	2019	Chloroquine modulates inflammatory autoimmune responses through Nurr1 in autoimmune diseases.	Chloroquine	0-11	nuclear receptor subfamily 4 group A member 2	Homo sapiens	64-69
31664129-8	2019	Taken together, these data suggest that CQ ameliorates autoimmune diseases via regulating Nurr1 function/expression and that Nurr1 is a promising target for developing effective therapeutics of human inflammatory autoimmune diseases.	Chloroquine	40-42	nuclear receptor subfamily 4 group A member 2	Homo sapiens	90-95
31664129-4	2019	In this study, using in vitro T cell differentiation models, we demonstrate that CQ activates TREG cell differentiation and induces Foxp3 gene expression in a Nurr1-dependent manner.	Chloroquine	81-83	forkhead box P3	Homo sapiens	132-137
31664129-4	2019	In this study, using in vitro T cell differentiation models, we demonstrate that CQ activates TREG cell differentiation and induces Foxp3 gene expression in a Nurr1-dependent manner.	Chloroquine	81-83	nuclear receptor subfamily 4 group A member 2	Homo sapiens	159-164
31102570-1	2019	Bis-indole derivatives including 1,1-bis(3"-indolyl)-1-(4-chlorophenyl)methane (DIM-C-pPhCl) and substituted quinolines such as chloroquine (CQ) and amodiaquine (AQ) are nuclear receptor 4A2 (NR4A2, Nurr1) ligands, and they exhibit anti-inflammatory activities in mouse and rat models of Parkinson"s disease, respectively.	Chloroquine	128-139	nuclear receptor subfamily 4, group A, member 2	Mus musculus	170-190
31664129-5	2019	Remarkably, CQ appears to induce Nurr1 function by two distinct mechanisms: firstly, by direct binding to Nurr1"s ligand-binding domain and promoting its transcriptional activity and secondly by upregulation of Nurr1 expression through the CREB signaling pathway.	Chloroquine	12-14	nuclear receptor subfamily 4 group A member 2	Homo sapiens	33-38
31664129-5	2019	Remarkably, CQ appears to induce Nurr1 function by two distinct mechanisms: firstly, by direct binding to Nurr1"s ligand-binding domain and promoting its transcriptional activity and secondly by upregulation of Nurr1 expression through the CREB signaling pathway.	Chloroquine	12-14	nuclear receptor subfamily 4 group A member 2	Homo sapiens	106-111
31664129-5	2019	Remarkably, CQ appears to induce Nurr1 function by two distinct mechanisms: firstly, by direct binding to Nurr1"s ligand-binding domain and promoting its transcriptional activity and secondly by upregulation of Nurr1 expression through the CREB signaling pathway.	Chloroquine	12-14	nuclear receptor subfamily 4 group A member 2	Homo sapiens	106-111
31664129-5	2019	Remarkably, CQ appears to induce Nurr1 function by two distinct mechanisms: firstly, by direct binding to Nurr1"s ligand-binding domain and promoting its transcriptional activity and secondly by upregulation of Nurr1 expression through the CREB signaling pathway.	Chloroquine	12-14	cAMP responsive element binding protein 1	Homo sapiens	240-244
31640289-10	2019	To explore effects of Chemerin on apoptosis, we prevented Chemerin-induced autophagy by pre-adding CQ in BMECs.	Chloroquine	99-101	retinoic acid receptor responder 2	Bos taurus	58-66
31102570-5	2019	In contrast, CQ and AQ were significantly less potent than the bis-indole derivatives and, for some of the NR4A2-regulated genes, CQ and AQ were inactive as inducers.	Chloroquine	130-132	nuclear receptor subfamily 4 group A member 2	Homo sapiens	107-112
31659177-9	2019	Free hemin increased by chloroquine action promoted oxidative reactions resulting in inhibition of proteolysis by three cysteine proteases: papain, ficin and cathepsin B.	Chloroquine	24-35	cathepsin B	Homo sapiens	158-169
31102570-1	2019	Bis-indole derivatives including 1,1-bis(3"-indolyl)-1-(4-chlorophenyl)methane (DIM-C-pPhCl) and substituted quinolines such as chloroquine (CQ) and amodiaquine (AQ) are nuclear receptor 4A2 (NR4A2, Nurr1) ligands, and they exhibit anti-inflammatory activities in mouse and rat models of Parkinson"s disease, respectively.	Chloroquine	128-139	nuclear receptor subfamily 4, group A, member 2	Mus musculus	192-197
31102570-1	2019	Bis-indole derivatives including 1,1-bis(3"-indolyl)-1-(4-chlorophenyl)methane (DIM-C-pPhCl) and substituted quinolines such as chloroquine (CQ) and amodiaquine (AQ) are nuclear receptor 4A2 (NR4A2, Nurr1) ligands, and they exhibit anti-inflammatory activities in mouse and rat models of Parkinson"s disease, respectively.	Chloroquine	128-139	nuclear receptor subfamily 4, group A, member 2	Mus musculus	199-204
31375560-7	2019	Of note, chloroquine-mediated blockade of autophagy increased accumulation of alpha-synuclein inclusions, and rapamycin-induced activation of autophagy, or use of 5"-AMP-activated protein kinase (AMPK) agonists, promoted the clearance of fibril-mediated alpha-synuclein pathology.	Chloroquine	9-20	synuclein alpha	Homo sapiens	78-93
31306655-5	2019	We confirmed a role for cathepsin D through addition of recombinant protein, upregulation of cathepsin D release using chloroquine and knockdown of cathepsin D expression.	Chloroquine	119-130	cathepsin D	Homo sapiens	24-35
31306655-5	2019	We confirmed a role for cathepsin D through addition of recombinant protein, upregulation of cathepsin D release using chloroquine and knockdown of cathepsin D expression.	Chloroquine	119-130	cathepsin D	Homo sapiens	93-104
31306655-5	2019	We confirmed a role for cathepsin D through addition of recombinant protein, upregulation of cathepsin D release using chloroquine and knockdown of cathepsin D expression.	Chloroquine	119-130	cathepsin D	Homo sapiens	93-104
31375560-7	2019	Of note, chloroquine-mediated blockade of autophagy increased accumulation of alpha-synuclein inclusions, and rapamycin-induced activation of autophagy, or use of 5"-AMP-activated protein kinase (AMPK) agonists, promoted the clearance of fibril-mediated alpha-synuclein pathology.	Chloroquine	9-20	synuclein alpha	Homo sapiens	254-269
31284007-11	2019	Treatment of chloroquine (CQ), the inhibitors of the autophagosome, resulted in further accumulation of p62 and LC3-II.	Chloroquine	13-24	nucleoporin 62	Homo sapiens	104-107
31515254-6	2019	On treatment with autophagy inhibitors bafilomycin A1 and chloroquine, ApoL9 is found near swollen mitochondria and on lysosomes/LAMP1-positive compartments.	Chloroquine	58-69	lysosomal-associated membrane protein 1	Mus musculus	129-134
31284007-11	2019	Treatment of chloroquine (CQ), the inhibitors of the autophagosome, resulted in further accumulation of p62 and LC3-II.	Chloroquine	26-28	nucleoporin 62	Homo sapiens	104-107
31477637-6	2019	FoxO3a promoted cell function, which was reversed by the autophagy inhibitor chloroquine.	Chloroquine	77-88	forkhead box O3	Homo sapiens	0-6
31310755-7	2019	Chloroquine and ammonium chloride additionally stimulated the phosphorylation of extracellular signal-regulated kinase (ERK) and c-Jun N-terminal kinase (JNK), respectively, while only bafilomycin increased the phosphorylation of the energy sensor AMP-activated protein kinase (AMPK).	Chloroquine	0-11	mitogen-activated protein kinase 1	Mus musculus	81-118
31310755-7	2019	Chloroquine and ammonium chloride additionally stimulated the phosphorylation of extracellular signal-regulated kinase (ERK) and c-Jun N-terminal kinase (JNK), respectively, while only bafilomycin increased the phosphorylation of the energy sensor AMP-activated protein kinase (AMPK).	Chloroquine	0-11	mitogen-activated protein kinase 1	Mus musculus	120-123
31310755-7	2019	Chloroquine and ammonium chloride additionally stimulated the phosphorylation of extracellular signal-regulated kinase (ERK) and c-Jun N-terminal kinase (JNK), respectively, while only bafilomycin increased the phosphorylation of the energy sensor AMP-activated protein kinase (AMPK).	Chloroquine	0-11	mitogen-activated protein kinase 8	Mus musculus	129-152
31310755-7	2019	Chloroquine and ammonium chloride additionally stimulated the phosphorylation of extracellular signal-regulated kinase (ERK) and c-Jun N-terminal kinase (JNK), respectively, while only bafilomycin increased the phosphorylation of the energy sensor AMP-activated protein kinase (AMPK).	Chloroquine	0-11	mitogen-activated protein kinase 8	Mus musculus	154-157
31310755-9	2019	p38 MAPK inhibitor SB203580 reduced the cytotoxicity of bafilomycin but increased that of chloroquine and ammonium chloride.	Chloroquine	90-101	mitogen-activated protein kinase 14	Mus musculus	0-8
31310755-10	2019	The pharmacological inhibition of ERK1/2, JNK, and AMPK potentiated the cytotoxicity of chloroquine, ammonium chloride, and bafilomycin, respectively.	Chloroquine	88-99	mitogen-activated protein kinase 3	Mus musculus	34-40
31310755-10	2019	The pharmacological inhibition of ERK1/2, JNK, and AMPK potentiated the cytotoxicity of chloroquine, ammonium chloride, and bafilomycin, respectively.	Chloroquine	88-99	mitogen-activated protein kinase 8	Mus musculus	42-45
31077347-11	2019	The protective effects of spermidine on cardiomyocyte apoptosis and cardiac dysfunction were abolished by the autophagy inhibitor chloroquine, indicating that spermidine exerted cardioprotective effects at least partly through promoting autophagic flux, by activating the AMPK/mTOR signalling pathway.	Chloroquine	130-141	protein kinase AMP-activated catalytic subunit alpha 2	Rattus norvegicus	272-276
31077347-11	2019	The protective effects of spermidine on cardiomyocyte apoptosis and cardiac dysfunction were abolished by the autophagy inhibitor chloroquine, indicating that spermidine exerted cardioprotective effects at least partly through promoting autophagic flux, by activating the AMPK/mTOR signalling pathway.	Chloroquine	130-141	mechanistic target of rapamycin kinase	Rattus norvegicus	277-281
31321620-7	2019	Autophagy-related genes, such as LC3, ATG12, and LAMP1, were enhanced upon neural induction, and the number of induced-neural cells decreased when autophagy was suppressed by chloroquine.	Chloroquine	175-186	autophagy related 12	Homo sapiens	38-43
31321620-7	2019	Autophagy-related genes, such as LC3, ATG12, and LAMP1, were enhanced upon neural induction, and the number of induced-neural cells decreased when autophagy was suppressed by chloroquine.	Chloroquine	175-186	lysosomal associated membrane protein 1	Homo sapiens	49-54
31321620-8	2019	The activation of autophagy was found to reduce ROS generation within the induced-neural cells, and the inhibition of autophagy by chloroquine suppressed the expression of antioxidant genes, CATALASE, SOD, and GPX.	Chloroquine	131-142	catalase	Homo sapiens	191-199
31325628-5	2019	Furthermore, addition of chloroquine (CQ) strengthened the basic and Mad-enhanced LC3-II and p62 levels, autophagosome formation and cell apoptosis, whereas pretreatment with rapamycin alleviated the effects in the cells exposed to Mad.	Chloroquine	25-36	nucleoporin 62	Homo sapiens	93-96
31325628-5	2019	Furthermore, addition of chloroquine (CQ) strengthened the basic and Mad-enhanced LC3-II and p62 levels, autophagosome formation and cell apoptosis, whereas pretreatment with rapamycin alleviated the effects in the cells exposed to Mad.	Chloroquine	38-40	nucleoporin 62	Homo sapiens	93-96
31427566-6	2019	Meanwhile, administration of the pharmaceutical inhibitor of autophagy, chloroquine, contributed to the enhanced anti-LUAD efficacy of vismodegib in vivo, probably through overproduction of ROS, acceleration of apoptosis, and suppression of GLI2 in LUAD tissues.	Chloroquine	72-83	GLI family zinc finger 2	Homo sapiens	241-245
32821717-8	2019	In addition, CQ and HCQ inhibit Smad3 phosphorylation and VSMC proliferation induced by transforming growth factor-beta1.	Chloroquine	13-15	SMAD family member 3	Mus musculus	32-37
32821717-8	2019	In addition, CQ and HCQ inhibit Smad3 phosphorylation and VSMC proliferation induced by transforming growth factor-beta1.	Chloroquine	13-15	transforming growth factor, beta 1	Mus musculus	88-120
31439883-4	2019	Because of findings that endolysosome de-acidification with, for example, the weak-base anti-malarial drug chloroquine prevents exogenous Tat degradation and enhances the amount of Tat available to activate HIV-1 LTR, we hypothesize that acidifying endolysosomes may enhance Tat degradation in endolysosomes and restrict LTR transactivation.	Chloroquine	107-118	tyrosine aminotransferase	Homo sapiens	138-141
31439883-4	2019	Because of findings that endolysosome de-acidification with, for example, the weak-base anti-malarial drug chloroquine prevents exogenous Tat degradation and enhances the amount of Tat available to activate HIV-1 LTR, we hypothesize that acidifying endolysosomes may enhance Tat degradation in endolysosomes and restrict LTR transactivation.	Chloroquine	107-118	tyrosine aminotransferase	Homo sapiens	181-184
31439883-4	2019	Because of findings that endolysosome de-acidification with, for example, the weak-base anti-malarial drug chloroquine prevents exogenous Tat degradation and enhances the amount of Tat available to activate HIV-1 LTR, we hypothesize that acidifying endolysosomes may enhance Tat degradation in endolysosomes and restrict LTR transactivation.	Chloroquine	107-118	tyrosine aminotransferase	Homo sapiens	181-184
30362504-9	2019	CQ also binds to the mas-related G protein coupled receptors MrgprA3/MrgprX1 present in a small proportion (4-5%) of dorsal root ganglion neurons and skin.	Chloroquine	0-2	MAS related GPR family member X1	Homo sapiens	69-76
31199479-5	2019	Here, we show that the lysosomal inhibitor chloroquine increases LepRb expression in hippocampal cultures, suggesting that LepRb is degraded in the lysosome.	Chloroquine	43-54	leptin receptor	Mus musculus	123-128
31155706-5	2019	Furthermore, overexpression of TP53INP2 lacking the UIM sensitizes cells to chloroquine treatment.	Chloroquine	76-87	tumor protein p53 inducible nuclear protein 2	Homo sapiens	31-39
31496656-12	2019	Finally, chloroquine can upregulate the protein expression of LC3B and p62, it also can inhibit proliferation in PDGF-induced PASMCs.	Chloroquine	9-20	KH RNA binding domain containing, signal transduction associated 1	Rattus norvegicus	71-74
31199479-5	2019	Here, we show that the lysosomal inhibitor chloroquine increases LepRb expression in hippocampal cultures, suggesting that LepRb is degraded in the lysosome.	Chloroquine	43-54	leptin receptor	Mus musculus	65-70
30362504-12	2019	Central CQ itch occurs via gastrin-related peptide (GRP) and its receptor (GRPR) in the dorsal spinothalamic tracts, as well as glutamic mediated GRP projection to parabrachial nucleus.	Chloroquine	8-10	gastrin releasing peptide	Homo sapiens	27-50
30362504-12	2019	Central CQ itch occurs via gastrin-related peptide (GRP) and its receptor (GRPR) in the dorsal spinothalamic tracts, as well as glutamic mediated GRP projection to parabrachial nucleus.	Chloroquine	8-10	gastrin releasing peptide	Homo sapiens	52-55
30957273-5	2019	Although the inhibition of PI3Kdelta using Idelalisib upregulated the messenger RNA expression of autophagy-related genes in 10058-F4-treated cells, treatment with autophagy inhibitor chloroquine decreased viability of the cells, either as a single agent or in combination with Idelalisib and/or 10058-F4; suggesting that the activation of autophagy in pre-B ALL cells could blunt apoptotic events and attenuate anticancer effect of both c-Myc and PI3K inhibitors.	Chloroquine	184-195	phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit delta	Homo sapiens	27-36
30362504-12	2019	Central CQ itch occurs via gastrin-related peptide (GRP) and its receptor (GRPR) in the dorsal spinothalamic tracts, as well as glutamic mediated GRP projection to parabrachial nucleus.	Chloroquine	8-10	gastrin releasing peptide receptor	Homo sapiens	75-79
30362504-12	2019	Central CQ itch occurs via gastrin-related peptide (GRP) and its receptor (GRPR) in the dorsal spinothalamic tracts, as well as glutamic mediated GRP projection to parabrachial nucleus.	Chloroquine	8-10	gastrin releasing peptide	Homo sapiens	75-78
30957273-5	2019	Although the inhibition of PI3Kdelta using Idelalisib upregulated the messenger RNA expression of autophagy-related genes in 10058-F4-treated cells, treatment with autophagy inhibitor chloroquine decreased viability of the cells, either as a single agent or in combination with Idelalisib and/or 10058-F4; suggesting that the activation of autophagy in pre-B ALL cells could blunt apoptotic events and attenuate anticancer effect of both c-Myc and PI3K inhibitors.	Chloroquine	184-195	MYC proto-oncogene, bHLH transcription factor	Homo sapiens	438-443
31384309-0	2019	Low dose chloroquine decreases insulin resistance in human metabolic syndrome but does not reduce carotid intima-media thickness.	Chloroquine	9-20	insulin	Homo sapiens	31-38
31384309-3	2019	The antimalarial drug chloroquine activates the kinase ataxia telangiectasia mutated (ATM), improves metabolic syndrome and reduces atherosclerosis in mice.	Chloroquine	22-33	ataxia telangiectasia mutated	Mus musculus	86-89
31384309-7	2019	The specific hypothesis: chloroquine improves insulin sensitivity and decreases atherosclerosis.	Chloroquine	25-36	insulin	Homo sapiens	46-53
31384309-14	2019	Chloroquine increased hepatic insulin sensitivity without affecting glucose disposal, and improved serum lipids.	Chloroquine	0-11	insulin	Homo sapiens	30-37
31384309-17	2019	The pre-specified secondary outcomes of blood pressure, lipids, and activation of JNK (a stress kinase implicated in diabetes and atherosclerosis) were decreased by chloroquine.	Chloroquine	165-176	mitogen-activated protein kinase 8	Homo sapiens	82-85
31384309-19	2019	Conclusions: These findings suggest that low dose chloroquine, which improves the metabolic syndrome through ATM-dependent mechanisms in mice, modestly improves components of the metabolic syndrome in humans but is unlikely to be clinically useful in this setting.Trial registration ClinicalTrials.gov (NCT00455325, NCT00455403), both posted 03 April 2007.	Chloroquine	50-61	ataxia telangiectasia mutated	Mus musculus	109-112
31839713-7	2019	A synergistic interaction (CI &lt;1) was identified with combinations of 4-6.5 muM osimertinib with 30-75 muM chloroquine.	Chloroquine	110-121	latexin	Homo sapiens	106-109
31839713-8	2019	Results: A combination of osimertinib (6 muM) with chloroquine (30 muM) resulted in a 6-fold increase of LC3B-II relative to control compared to 2.5-fold increase for either drug alone.	Chloroquine	51-62	latexin	Homo sapiens	67-70
31839713-9	2019	The caspase-3 expression increased 2-fold compared to a 0.5-fold decrease with chloroquine and 1.5-fold increase with osimertinib.	Chloroquine	79-90	caspase 3	Homo sapiens	4-13
30560904-6	2019	Furthermore, experiments using flow cytometry and western blots revealed that Sul reversed the cytotoxic effect stimulated by the autophagy inhibitors 3-methyladenine (3-MA) and chloroquine (CQ), and its cytoprotective effect was almost eliminated when the autophagy-related 5 (Atg5) gene was knocked down.	Chloroquine	178-189	autophagy related 5	Homo sapiens	257-276
31332160-9	2019	Furthermore, ERbeta-mediated decrease in Abeta1-42 was blocked by the autophagy inhibitor chloroquine (CQ) in SH-SY5Y cells and the HEK293T (AbetaPPsw) model.	Chloroquine	90-101	estrogen receptor 1	Homo sapiens	13-19
31332160-9	2019	Furthermore, ERbeta-mediated decrease in Abeta1-42 was blocked by the autophagy inhibitor chloroquine (CQ) in SH-SY5Y cells and the HEK293T (AbetaPPsw) model.	Chloroquine	103-105	estrogen receptor 1	Homo sapiens	13-19
31332160-10	2019	Abeta1-42 or CQ induced cytotoxicity was restored by a selective ERbeta activator diarylpropionitrile (DPN).	Chloroquine	13-15	estrogen receptor 1	Homo sapiens	65-71
31379564-9	2019	Similarly co-incubation with chloroquine or elacridar or in combination of chloroquine and elacridar increased cytotoxic effects of brentuximab vedotin by 2.8- to 21.4-fold on KM-H2 cells that express a specific tumor antigen CD30 and P-gp-MDR1.	Chloroquine	29-40	TNF receptor superfamily member 8	Homo sapiens	226-230
31379564-9	2019	Similarly co-incubation with chloroquine or elacridar or in combination of chloroquine and elacridar increased cytotoxic effects of brentuximab vedotin by 2.8- to 21.4-fold on KM-H2 cells that express a specific tumor antigen CD30 and P-gp-MDR1.	Chloroquine	29-40	ATP binding cassette subfamily B member 1	Canis lupus familiaris	240-244
31379564-9	2019	Similarly co-incubation with chloroquine or elacridar or in combination of chloroquine and elacridar increased cytotoxic effects of brentuximab vedotin by 2.8- to 21.4-fold on KM-H2 cells that express a specific tumor antigen CD30 and P-gp-MDR1.	Chloroquine	75-86	TNF receptor superfamily member 8	Homo sapiens	226-230
31379564-9	2019	Similarly co-incubation with chloroquine or elacridar or in combination of chloroquine and elacridar increased cytotoxic effects of brentuximab vedotin by 2.8- to 21.4-fold on KM-H2 cells that express a specific tumor antigen CD30 and P-gp-MDR1.	Chloroquine	75-86	ATP binding cassette subfamily B member 1	Canis lupus familiaris	240-244
31082369-0	2019	Chloroquine inhibits tumor-related Kv10.1 channel and decreases migration of MDA-MB-231 breast cancer cells in vitro.	Chloroquine	0-11	potassium voltage-gated channel modifier subfamily G member 3	Homo sapiens	35-41
31082369-2	2019	As chloroquine has been shown to inhibits several potassium channels, we decided to study its effect on the tumor-related Kv10.1 channel by using patch-clamp electrophysiology and cell migration assays.	Chloroquine	3-14	potassium voltage-gated channel modifier subfamily G member 3	Homo sapiens	122-128
31082369-3	2019	We found that chloroquine inhibited Kv10.1 channels transiently expressed in HEK-293 cells in a concentration- and voltage-dependent manner acting from the cytoplasmic side of the plasma membrane.	Chloroquine	14-25	potassium voltage-gated channel modifier subfamily G member 3	Homo sapiens	36-42
31082369-4	2019	Chloroquine also inhibited the outward potassium currents from MDA-MB-231 cells, which are mainly carried through Kv10.1 channels as was confirmed using astemizole.	Chloroquine	0-11	potassium voltage-gated channel modifier subfamily G member 3	Homo sapiens	114-120
31082369-6	2019	In conclusion, our data suggest that chloroquine decreases MDA-MB-231 cell migration by inhibiting Kv10.1 channels.	Chloroquine	37-48	potassium voltage-gated channel modifier subfamily G member 3	Homo sapiens	99-105
31082369-7	2019	The inhibition of Kv10.1 channels could represent another mechanism of the antitumoral action of chloroquine, besides autophagy inhibition and tumor vessel normalization.	Chloroquine	97-108	potassium voltage-gated channel modifier subfamily G member 3	Homo sapiens	18-24
31269698-7	2019	When Licochalcone A-induced autophagy was blocked by the autophagy inhibitor chloroquine, the expression of activated caspase-3 and Annexin V positive cells were reduced, and cell viability was rescued in Licochalcone A-treated osteosarcoma cell lines.	Chloroquine	77-88	caspase 3	Homo sapiens	118-127
31269698-7	2019	When Licochalcone A-induced autophagy was blocked by the autophagy inhibitor chloroquine, the expression of activated caspase-3 and Annexin V positive cells were reduced, and cell viability was rescued in Licochalcone A-treated osteosarcoma cell lines.	Chloroquine	77-88	annexin A5	Homo sapiens	132-141
30560904-6	2019	Furthermore, experiments using flow cytometry and western blots revealed that Sul reversed the cytotoxic effect stimulated by the autophagy inhibitors 3-methyladenine (3-MA) and chloroquine (CQ), and its cytoprotective effect was almost eliminated when the autophagy-related 5 (Atg5) gene was knocked down.	Chloroquine	178-189	autophagy related 5	Homo sapiens	278-282
30560904-6	2019	Furthermore, experiments using flow cytometry and western blots revealed that Sul reversed the cytotoxic effect stimulated by the autophagy inhibitors 3-methyladenine (3-MA) and chloroquine (CQ), and its cytoprotective effect was almost eliminated when the autophagy-related 5 (Atg5) gene was knocked down.	Chloroquine	191-193	autophagy related 5	Homo sapiens	257-276
30560904-6	2019	Furthermore, experiments using flow cytometry and western blots revealed that Sul reversed the cytotoxic effect stimulated by the autophagy inhibitors 3-methyladenine (3-MA) and chloroquine (CQ), and its cytoprotective effect was almost eliminated when the autophagy-related 5 (Atg5) gene was knocked down.	Chloroquine	191-193	autophagy related 5	Homo sapiens	278-282
29674007-5	2019	Enhanced mitophagy was observed in Mst1 interfering cardiomyocytes subjected to high glucose treatment using 3-Methyladenine and Chloroquine.	Chloroquine	129-140	macrophage stimulating 1	Homo sapiens	35-39
30967635-0	2019	The anti-malarial drug chloroquine sensitizes oncogenic NOTCH1 driven human T-ALL to gamma-secretase inhibition.	Chloroquine	23-34	notch receptor 1	Homo sapiens	56-62
31934092-9	2019	Beclin-1 protein declined, whereas Cx43 and p-Cx43 levels enhanced in CQ + I/R group compared with the I/R group.	Chloroquine	70-72	beclin 1	Rattus norvegicus	0-8
31934092-9	2019	Beclin-1 protein declined, whereas Cx43 and p-Cx43 levels enhanced in CQ + I/R group compared with the I/R group.	Chloroquine	70-72	gap junction protein, alpha 1	Rattus norvegicus	35-39
31934092-9	2019	Beclin-1 protein declined, whereas Cx43 and p-Cx43 levels enhanced in CQ + I/R group compared with the I/R group.	Chloroquine	70-72	gap junction protein, alpha 1	Rattus norvegicus	46-50
30417365-9	2019	The level of p150 glued , the largest subunit of dynactin, was reduced in CQ-treated RPE1 cells, and depletion of p150 glued resulted in a phenotype reminiscent of CQ-treated cells.	Chloroquine	74-76	chromatin assembly factor 1 subunit A	Homo sapiens	13-17
30417365-10	2019	Thus, CQ treatment reduced the expression of p150 glued , leading to reduced S phase entry and defective microtubule nucleation.	Chloroquine	6-8	chromatin assembly factor 1 subunit A	Homo sapiens	45-49
30980919-8	2019	A proteasome inhibitor and a lysosome inhibitor, MG132 and chloroquine, respectively, partly inhibited DGKdelta degradation, suggesting that myristic acid prevents, at least in part, the degradation of DGKdelta by the ubiquitin-proteasome system and the autophagy-lysosome pathway.	Chloroquine	59-70	diacylglycerol kinase, delta	Mus musculus	103-111
30980919-8	2019	A proteasome inhibitor and a lysosome inhibitor, MG132 and chloroquine, respectively, partly inhibited DGKdelta degradation, suggesting that myristic acid prevents, at least in part, the degradation of DGKdelta by the ubiquitin-proteasome system and the autophagy-lysosome pathway.	Chloroquine	59-70	diacylglycerol kinase, delta	Mus musculus	202-210
31047975-3	2019	Allergen (ovalbumin) injection into the isolated skin of actively sensitized mice strongly stimulated chloroquine (CQ)-sensitive C-fibers (also referred to as "itch" nerves); on the other hand, CQ-insensitive C-fibers were activated only modestly, if at all.	Chloroquine	102-113	serine (or cysteine) peptidase inhibitor, clade B, member 1, pseudogene	Mus musculus	10-19
31047975-3	2019	Allergen (ovalbumin) injection into the isolated skin of actively sensitized mice strongly stimulated chloroquine (CQ)-sensitive C-fibers (also referred to as "itch" nerves); on the other hand, CQ-insensitive C-fibers were activated only modestly, if at all.	Chloroquine	115-117	serine (or cysteine) peptidase inhibitor, clade B, member 1, pseudogene	Mus musculus	10-19
31047975-3	2019	Allergen (ovalbumin) injection into the isolated skin of actively sensitized mice strongly stimulated chloroquine (CQ)-sensitive C-fibers (also referred to as "itch" nerves); on the other hand, CQ-insensitive C-fibers were activated only modestly, if at all.	Chloroquine	194-196	serine (or cysteine) peptidase inhibitor, clade B, member 1, pseudogene	Mus musculus	10-19
30967635-9	2019	CQ also interferes with intracellular trafficking and processing of oncogenic NOTCH1.	Chloroquine	0-2	notch receptor 1	Homo sapiens	78-84
30985881-7	2019	More important, Cd exposure also induced VMP1 expression and autophagy in mouse spleen tissue, and the intraperitoneal injection of the autophagy inhibitor chloroquine (CQ) into mice effectively reduced Cd-induced spleen apoptotic damage.	Chloroquine	156-167	vacuole membrane protein 1	Mus musculus	41-45
30985881-7	2019	More important, Cd exposure also induced VMP1 expression and autophagy in mouse spleen tissue, and the intraperitoneal injection of the autophagy inhibitor chloroquine (CQ) into mice effectively reduced Cd-induced spleen apoptotic damage.	Chloroquine	169-171	vacuole membrane protein 1	Mus musculus	41-45
31186406-7	2019	Addition of late stage autophagy inhibitor, chloroquine (CQ), further enhanced LC3-II and p62 level, as well as increased autophagosome accumulation, suggesting a blockage of autophagic flux by GLP in CRC cells.	Chloroquine	44-55	nucleoporin 62	Homo sapiens	90-93
31227964-11	2021	CQ administration abolished the activation of autophagy flux and the PINK1/ Parkin pathway induced by high-dose of TXL.	Chloroquine	0-2	PTEN induced kinase 1	Rattus norvegicus	69-74
31317028-9	2019	In addition, CQ, Ku, and Rap in combination with RL2 decreased activity of lysosomal protease Cathepsin D.	Chloroquine	13-15	cathepsin D	Homo sapiens	94-105
31059051-11	2019	TEM and CQ inhibited both the phosphorylation of downstream proteins of mTOR and autophagy.	Chloroquine	8-10	mechanistic target of rapamycin kinase	Homo sapiens	72-76
31059051-13	2019	In conclusion, the combination of TEM and CQ increased radiosensitivity in CRC cells through co-inhibition of mTOR and autophagy.	Chloroquine	42-44	mechanistic target of rapamycin kinase	Homo sapiens	110-114
31243942-7	2019	Furthermore, since we found that results are influenced by the type and the dose of the lysosome inhibitor used, the best dose of Chloroquine for LC3 accumulation were set up in either THP-1 cells or PBMC.	Chloroquine	130-141	microtubule associated protein 1 light chain 3 alpha	Homo sapiens	146-149
31234939-12	2019	Besides, it was also seen that the anti-malarial chloroquine causes changes in B1R expression in liver, even after days of parasite clearance.	Chloroquine	49-60	bradykinin receptor, beta 1	Mus musculus	79-82
31187276-6	2019	Features of merit include (a) a wide linear response (in the 0.5 muM to 82 muM CQ concentration range), (b) an electrochemical sensitivity of 0.143-0.90 muA muM-1 cm-2), and a 40-120 nM limit of detection (at S/N = 3).	Chloroquine	79-81	PWWP domain containing 3A, DNA repair factor	Homo sapiens	157-162
31186406-7	2019	Addition of late stage autophagy inhibitor, chloroquine (CQ), further enhanced LC3-II and p62 level, as well as increased autophagosome accumulation, suggesting a blockage of autophagic flux by GLP in CRC cells.	Chloroquine	57-59	nucleoporin 62	Homo sapiens	90-93
30767087-0	2019	Autophagy inhibition with chloroquine reverts paclitaxel resistance and attenuates metastatic potential in human nonsmall lung adenocarcinoma A549 cells via ROS mediated modulation of beta-catenin pathway.	Chloroquine	26-37	catenin beta 1	Homo sapiens	184-196
31244838-14	2019	Conversely, chloroquine and bafilomycin A (inhibitors of autophagy) and betulinic acid (a proteasome activator) effectively reduced LPS-induced pro-IL-1beta protein levels.	Chloroquine	12-23	interleukin 1 beta	Homo sapiens	144-156
30797853-4	2019	The neuroprotective potential of hydroxychloroquine and chloroquine remained controversial until recently a study showed that chloroquine exhibited an antiparkinsonian activity through Nurr1 modulation.	Chloroquine	40-51	nuclear receptor subfamily 4, group A, member 2	Rattus norvegicus	185-190
30951892-8	2019	2</protein-id>: HUVECs treated with arecoline exhibited increased autophagosomes, LC3 expression and reduced p62 expression, when co-treated with chloroquine (CQ), which is a specific autophagy inhibitor, revealed the opposite trend.	Chloroquine	146-157	microtubule associated protein 1 light chain 3 alpha	Homo sapiens	82-85
30951892-8	2019	2</protein-id>: HUVECs treated with arecoline exhibited increased autophagosomes, LC3 expression and reduced p62 expression, when co-treated with chloroquine (CQ), which is a specific autophagy inhibitor, revealed the opposite trend.	Chloroquine	146-157	sequestosome 1	Homo sapiens	109-112
30951892-8	2019	2</protein-id>: HUVECs treated with arecoline exhibited increased autophagosomes, LC3 expression and reduced p62 expression, when co-treated with chloroquine (CQ), which is a specific autophagy inhibitor, revealed the opposite trend.	Chloroquine	159-161	microtubule associated protein 1 light chain 3 alpha	Homo sapiens	82-85
30951892-8	2019	2</protein-id>: HUVECs treated with arecoline exhibited increased autophagosomes, LC3 expression and reduced p62 expression, when co-treated with chloroquine (CQ), which is a specific autophagy inhibitor, revealed the opposite trend.	Chloroquine	159-161	sequestosome 1	Homo sapiens	109-112
30923989-0	2019	Correction to: Autophagy inhibition with chloroquine reverts paclitaxel resistance and attenuates metastatic potential in human nonsmall lung adenocarcinoma A549 cells via ROS mediated modulation of beta-catenin pathway.	Chloroquine	41-52	catenin beta 1	Homo sapiens	199-211
30767087-5	2019	ROS here played a crucial role in modulating Akt activity when autophagy process was hindered by chloroquine, excessive ROS accumulation in the cell inhibited Akt activity.	Chloroquine	97-108	AKT serine/threonine kinase 1	Homo sapiens	45-48
30767087-5	2019	ROS here played a crucial role in modulating Akt activity when autophagy process was hindered by chloroquine, excessive ROS accumulation in the cell inhibited Akt activity.	Chloroquine	97-108	AKT serine/threonine kinase 1	Homo sapiens	159-162
30788651-6	2019	LC3B was up-regulated by combined treatment of zVAD with chloroquine which also revealed that DNA damage was reduced in live cells but enhanced in dead cells indicating the role of autophagy in maintaining cell health.	Chloroquine	57-68	microtubule associated protein 1 light chain 3 beta	Homo sapiens	0-4
30840341-6	2019	Further study revealed that autophagy activated by rapamycin or inhibited by chloroquine influenced the expression and nuclear translocation of Nrf2, thereby controlling the expression of antioxidant proteins and the scavenging of ROS.	Chloroquine	77-88	nuclear factor, erythroid derived 2, like 2	Mus musculus	144-148
31486403-10	2019	Combined dsDNA + chloroquine treatment has a synergistic effect on transcription of only one of the genes tested, with the pro-inflammatory cytokine IFN-beta displaying the strongest fold induction by 24 hours.	Chloroquine	17-28	interferon beta 1	Homo sapiens	149-157
31208693-4	2019	Importantly, they demonstrated that autophagy blockade via chloroquine (CQ) or hydroxychloroquine (HCQ) enhanced the efficacy of MEK-ERK inhibition in various preclinical models of KRAS-driven cancers, providing a rational basis for future clinical evaluation of this combination therapy.	Chloroquine	59-70	mitogen-activated protein kinase kinase 7	Homo sapiens	129-132
31208693-4	2019	Importantly, they demonstrated that autophagy blockade via chloroquine (CQ) or hydroxychloroquine (HCQ) enhanced the efficacy of MEK-ERK inhibition in various preclinical models of KRAS-driven cancers, providing a rational basis for future clinical evaluation of this combination therapy.	Chloroquine	59-70	mitogen-activated protein kinase 1	Homo sapiens	133-136
31208693-4	2019	Importantly, they demonstrated that autophagy blockade via chloroquine (CQ) or hydroxychloroquine (HCQ) enhanced the efficacy of MEK-ERK inhibition in various preclinical models of KRAS-driven cancers, providing a rational basis for future clinical evaluation of this combination therapy.	Chloroquine	72-74	mitogen-activated protein kinase kinase 7	Homo sapiens	129-132
31208693-4	2019	Importantly, they demonstrated that autophagy blockade via chloroquine (CQ) or hydroxychloroquine (HCQ) enhanced the efficacy of MEK-ERK inhibition in various preclinical models of KRAS-driven cancers, providing a rational basis for future clinical evaluation of this combination therapy.	Chloroquine	72-74	mitogen-activated protein kinase 1	Homo sapiens	133-136
31138329-0	2019	ROS-mediated activation and mitochondrial translocation of CaMKII contributes to Drp1-dependent mitochondrial fission and apoptosis in triple-negative breast cancer cells by isorhamnetin and chloroquine.	Chloroquine	191-202	collapsin response mediator protein 1	Mus musculus	81-85
31138329-0	2019	ROS-mediated activation and mitochondrial translocation of CaMKII contributes to Drp1-dependent mitochondrial fission and apoptosis in triple-negative breast cancer cells by isorhamnetin and chloroquine.	Chloroquine	191-202	calcium/calmodulin-dependent protein kinase II, delta	Mus musculus	59-65
30572800-14	2019	The cfDNA-stimulated IL6 release by macrophage cells was suppressed by chloroquine, a Toll-like receptor 9 (TLR9) inhibitor.	Chloroquine	71-82	interleukin 6	Mus musculus	21-24
30572800-14	2019	The cfDNA-stimulated IL6 release by macrophage cells was suppressed by chloroquine, a Toll-like receptor 9 (TLR9) inhibitor.	Chloroquine	71-82	toll-like receptor 9	Mus musculus	86-106
30572800-14	2019	The cfDNA-stimulated IL6 release by macrophage cells was suppressed by chloroquine, a Toll-like receptor 9 (TLR9) inhibitor.	Chloroquine	71-82	toll-like receptor 9	Mus musculus	108-112
32884994-9	2020	Vps34 indeed was subjected to proteasomal or lysosomal degradation, as prolonged treatment of proteasomal inhibitor MG132 or lysosomal inhibitor chloroquine elevated Vps34 protein levels.	Chloroquine	145-156	phosphatidylinositol 3-kinase catalytic subunit type 3	Mus musculus	0-5
31133044-14	2019	We also found that chloroquine, an autophagy inhibitor, suppressed ERK inhibition-induced autophagy and promoted PSC cellular senescence, leading to significantly decreased cell proliferation.	Chloroquine	19-30	mitogen-activated protein kinase 1	Mus musculus	67-70
32884994-9	2020	Vps34 indeed was subjected to proteasomal or lysosomal degradation, as prolonged treatment of proteasomal inhibitor MG132 or lysosomal inhibitor chloroquine elevated Vps34 protein levels.	Chloroquine	145-156	phosphatidylinositol 3-kinase catalytic subunit type 3	Mus musculus	166-171
31091257-7	2019	Depletion of BRUCE alone (without starvation) in human osteosarcoma U2OS cells elevated autophagic activity as indicted by the increased LC3B-II protein and its autophagic puncta as well as further increase of both by chloroquine treatment.	Chloroquine	218-229	baculoviral IAP repeat containing 6	Homo sapiens	13-18
30950489-7	2019	The inhibitory effect of sortilin in cholesterol efflux was partially reversed by treatment with chloroquine, a lysosomal inhibitor.	Chloroquine	97-108	sortilin 1	Mus musculus	25-33
30950489-9	2019	The fecal and biliary cholesterol 3H-sterol from cholesterol-laden mouse peritoneal macrophage was reduced by sortilin overexpression through lentivirus vector (LV)-sortilin in low-density lipoprotein receptor knockout mice, which was prevented by co-treatment with chloroquine.	Chloroquine	266-277	sortilin 1	Mus musculus	110-118
30950489-9	2019	The fecal and biliary cholesterol 3H-sterol from cholesterol-laden mouse peritoneal macrophage was reduced by sortilin overexpression through lentivirus vector (LV)-sortilin in low-density lipoprotein receptor knockout mice, which was prevented by co-treatment with chloroquine.	Chloroquine	266-277	sortilin 1	Mus musculus	165-173
30950489-9	2019	The fecal and biliary cholesterol 3H-sterol from cholesterol-laden mouse peritoneal macrophage was reduced by sortilin overexpression through lentivirus vector (LV)-sortilin in low-density lipoprotein receptor knockout mice, which was prevented by co-treatment with chloroquine.	Chloroquine	266-277	low density lipoprotein receptor	Mus musculus	177-209
30950489-12	2019	These effects of LV-sortilin were partially reversed by chloroquine.	Chloroquine	56-67	sortilin 1	Mus musculus	20-28
31108937-5	2019	Comparing the fluorescence characteristics of these proteins in response to intracellular pH changes induced by chloroquine or bafilomycin A1, we found that pHluorin-BACE1-mCherry is a better pH sensor for BACE1 because its fluorescence intensity responds to pH changes more dramatically and more quickly.	Chloroquine	112-123	beta-secretase 1	Homo sapiens	166-171
31108937-5	2019	Comparing the fluorescence characteristics of these proteins in response to intracellular pH changes induced by chloroquine or bafilomycin A1, we found that pHluorin-BACE1-mCherry is a better pH sensor for BACE1 because its fluorescence intensity responds to pH changes more dramatically and more quickly.	Chloroquine	112-123	beta-secretase 1	Homo sapiens	206-211
30850167-9	2019	Frequencies of T cells (CD3+, CD4+and CD8+) and T regulatory cells (CD4+, CD25 +and FoxP3+) were found to be lower in brain of BBIQ + CQ treated mice as compared to BBIQ alone and CQ alone treated mice on Day 10.	Chloroquine	134-136	interleukin 2 receptor, alpha chain	Mus musculus	74-78
31088402-8	2019	Autophagy inhibitor chloroquine (CQ) was used to study the effects of inhibition at late stage of autophagy on ARHI-induced autophagy and apoptosis.	Chloroquine	20-31	DIRAS family GTPase 3	Homo sapiens	111-115
31088402-8	2019	Autophagy inhibitor chloroquine (CQ) was used to study the effects of inhibition at late stage of autophagy on ARHI-induced autophagy and apoptosis.	Chloroquine	33-35	DIRAS family GTPase 3	Homo sapiens	111-115
31088402-15	2019	And chloroquine (CQ) used as an auxiliary medicine in glioma chemotherapy can enhance the antitumor effect of ARHI, and this study provides a novel mechanistic basis and strategy for glioma therapy.	Chloroquine	4-15	DIRAS family GTPase 3	Homo sapiens	110-114
31088402-15	2019	And chloroquine (CQ) used as an auxiliary medicine in glioma chemotherapy can enhance the antitumor effect of ARHI, and this study provides a novel mechanistic basis and strategy for glioma therapy.	Chloroquine	17-19	DIRAS family GTPase 3	Homo sapiens	110-114
30850167-9	2019	Frequencies of T cells (CD3+, CD4+and CD8+) and T regulatory cells (CD4+, CD25 +and FoxP3+) were found to be lower in brain of BBIQ + CQ treated mice as compared to BBIQ alone and CQ alone treated mice on Day 10.	Chloroquine	134-136	forkhead box P3	Mus musculus	84-89
31024806-9	2019	The LC3B-II/I ratio was significantly reduced by 3-MA treatment and increased by CQ treatment.	Chloroquine	81-83	microtubule associated protein 1 light chain 3 beta	Homo sapiens	4-8
30946009-6	2019	Pharmacological intervention using chloroquine, a lysosomal inhibitor, decreased lysosomal associated protein 2 (LAMP2) and HIF-1alpha levels and modified cytokine production.	Chloroquine	35-46	lysosomal associated membrane protein 2	Homo sapiens	113-118
30946009-6	2019	Pharmacological intervention using chloroquine, a lysosomal inhibitor, decreased lysosomal associated protein 2 (LAMP2) and HIF-1alpha levels and modified cytokine production.	Chloroquine	35-46	hypoxia inducible factor 1 subunit alpha	Homo sapiens	124-134
31003539-5	2019	For example, mouse MrgprA3 responds to chloroquine (an anti-malarial drug), and are responsible for relaying chloroquine-induced scratching in mice.	Chloroquine	39-50	MAS-related GPR, member A3	Mus musculus	19-26
31003539-5	2019	For example, mouse MrgprA3 responds to chloroquine (an anti-malarial drug), and are responsible for relaying chloroquine-induced scratching in mice.	Chloroquine	109-120	MAS-related GPR, member A3	Mus musculus	19-26
31003539-9	2019	Pretreatment with TRPA1 channel antagonist HC-030031 did significantly reduce the magnitude of this hyperalgesia, as well as significantly shortened the time-course of hyperalgesia induced by chloroquine and BAM8-22.	Chloroquine	192-203	transient receptor potential cation channel, subfamily A, member 1	Mus musculus	18-23
30896851-3	2019	We previously reported that in human melanoma and osteosarcoma cells, autophagy inhibitors, such as 3-methyladenine and chloroquine increased the sensitivity to apoptosis induced by tumor necrosis factor-related apoptosis-inducing ligand (TRAIL).	Chloroquine	120-131	TNF superfamily member 10	Homo sapiens	182-237
30896851-3	2019	We previously reported that in human melanoma and osteosarcoma cells, autophagy inhibitors, such as 3-methyladenine and chloroquine increased the sensitivity to apoptosis induced by tumor necrosis factor-related apoptosis-inducing ligand (TRAIL).	Chloroquine	120-131	TNF superfamily member 10	Homo sapiens	239-244
30996359-16	2019	Choloroquine (CQ), an often used autophagic inhibitor, further accumulated rasfonin-induced LC3-II.	Chloroquine	14-16	microtubule associated protein 1 light chain 3 alpha	Homo sapiens	92-95
31024806-10	2019	The expressions of Beclin-1 and Atg5 were significantly reduced by 3-MA or CQ treatment, while expression of p62 was increased in the 3-MA or CQ treated cells.	Chloroquine	75-77	beclin 1	Homo sapiens	19-27
31024806-10	2019	The expressions of Beclin-1 and Atg5 were significantly reduced by 3-MA or CQ treatment, while expression of p62 was increased in the 3-MA or CQ treated cells.	Chloroquine	75-77	autophagy related 5	Homo sapiens	32-36
31024806-10	2019	The expressions of Beclin-1 and Atg5 were significantly reduced by 3-MA or CQ treatment, while expression of p62 was increased in the 3-MA or CQ treated cells.	Chloroquine	142-144	beclin 1	Homo sapiens	19-27
31024806-10	2019	The expressions of Beclin-1 and Atg5 were significantly reduced by 3-MA or CQ treatment, while expression of p62 was increased in the 3-MA or CQ treated cells.	Chloroquine	142-144	nucleoporin 62	Homo sapiens	109-112
31024806-11	2019	The concentration of VEGF was significantly decreased and PEDF increased, thereby the VEGF/PEDF ratio was decreased in the hypoxia + 3-MA group and hypoxia + CQ group compared with that in the hypoxia group.	Chloroquine	158-160	serpin family F member 1	Homo sapiens	91-95
30341573-8	2019	Interestingly, pretreating cells with chloroquine, and also hydroxychloroquine, but not dexamethasone, attenuated poly IC-induced PAI-1 expression in GECs.	Chloroquine	38-49	serpin family E member 1	Homo sapiens	130-135
30710551-11	2019	Chloroquine increased the ratio of LC3II to LC3I, p62 and LDH release in cells subjected to OGD.	Chloroquine	0-11	nucleoporin 62	Homo sapiens	50-53
30922066-10	2019	Finally, autophagic flux assays using short-term chloroquine treatment revealed that autophagy was activated in delta-sarcoglycan-deficient hearts and was further augmented by metformin treatment.	Chloroquine	49-60	sarcoglycan, delta (dystrophin-associated glycoprotein)	Mus musculus	112-129
30341573-0	2019	Chloroquine attenuates TLR3-mediated plasminogen activator inhibitor-1 expression in cultured human glomerular endothelial cells.	Chloroquine	0-11	toll like receptor 3	Homo sapiens	23-27
30341573-9	2019	CONCLUSION: Considering that TLR3 signaling is implicated in LN pathogenesis, our results suggest that chloroquine exert postulated renoprotective effects by inhibiting PAI-1 expression.	Chloroquine	103-114	toll like receptor 3	Homo sapiens	29-33
30341573-0	2019	Chloroquine attenuates TLR3-mediated plasminogen activator inhibitor-1 expression in cultured human glomerular endothelial cells.	Chloroquine	0-11	serpin family E member 1	Homo sapiens	37-70
30341573-9	2019	CONCLUSION: Considering that TLR3 signaling is implicated in LN pathogenesis, our results suggest that chloroquine exert postulated renoprotective effects by inhibiting PAI-1 expression.	Chloroquine	103-114	serpin family E member 1	Homo sapiens	169-174
30447156-4	2019	Chloroquine, a predominant blocker of the potassium channel encoded by the ether-a-go-go related gene (hERG), prolonged DeltaDeltaQTc and DeltaDeltaJ-Tpeak c by &gt;= 10 ms.	Chloroquine	0-11	ETS transcription factor ERG	Homo sapiens	103-107
30320898-9	2019	The inhibition of autophagy with CQ or 3MA also decreased the expression of TGF-beta1 and p-Smad3.	Chloroquine	33-35	transforming growth factor beta 1	Homo sapiens	76-85
30639321-8	2019	Additionally, we found that inhibition of autophagic flux with chloroquine by decreasing autophagosome-lysosome fusion significantly reversed the decreased expressions of neuronal p62/SQSTM1 and apoptosis by EPPS treatment.	Chloroquine	63-74	sequestosome 1	Mus musculus	180-183
30639321-8	2019	Additionally, we found that inhibition of autophagic flux with chloroquine by decreasing autophagosome-lysosome fusion significantly reversed the decreased expressions of neuronal p62/SQSTM1 and apoptosis by EPPS treatment.	Chloroquine	63-74	sequestosome 1	Mus musculus	184-190
30645707-11	2019	Compared with ALI group, Baf and CQ obviously elevated the level of LC3II and Beclin 1, and reduced the LAMP2 and Rab7 expressions in CLP + Baf group and ALI + CQ group.	Chloroquine	33-35	beclin 1, autophagy related	Mus musculus	78-86
30645707-11	2019	Compared with ALI group, Baf and CQ obviously elevated the level of LC3II and Beclin 1, and reduced the LAMP2 and Rab7 expressions in CLP + Baf group and ALI + CQ group.	Chloroquine	33-35	lysosomal-associated membrane protein 2	Mus musculus	104-109
30645707-11	2019	Compared with ALI group, Baf and CQ obviously elevated the level of LC3II and Beclin 1, and reduced the LAMP2 and Rab7 expressions in CLP + Baf group and ALI + CQ group.	Chloroquine	33-35	RAB7, member RAS oncogene family	Mus musculus	114-118
30320898-9	2019	The inhibition of autophagy with CQ or 3MA also decreased the expression of TGF-beta1 and p-Smad3.	Chloroquine	33-35	SMAD family member 3	Homo sapiens	92-97
30935141-9	2019	Furthermore, WST-8 assay revealed that the anti-tumor effect of NCL1 was reinforced when autophagy was inhibited by chloroquine in 22Rv1 cells.	Chloroquine	116-127	calpain 3	Homo sapiens	64-68
30833752-5	2019	Accordingly, we found that the autophagy inhibitor chloroquine and genetic or pharmacologic inhibition of specific autophagy regulators synergistically enhanced the ability of ERK inhibitors to mediate antitumor activity in KRAS-driven PDAC.	Chloroquine	51-62	mitogen-activated protein kinase 1	Homo sapiens	176-179
30833752-5	2019	Accordingly, we found that the autophagy inhibitor chloroquine and genetic or pharmacologic inhibition of specific autophagy regulators synergistically enhanced the ability of ERK inhibitors to mediate antitumor activity in KRAS-driven PDAC.	Chloroquine	51-62	KRAS proto-oncogene, GTPase	Homo sapiens	224-228
30935019-3	2019	Importantly, we found that breast cancer cells with low expression levels of a zinc-finger protein, ZNF143 (MCF7 sh-ZNF143), showed better survival than control cells (MCF7 sh-Control) under starvation, which was compromised with chloroquine, an autophagy inhibitor.	Chloroquine	230-241	zinc finger protein 143	Homo sapiens	100-106
30935019-3	2019	Importantly, we found that breast cancer cells with low expression levels of a zinc-finger protein, ZNF143 (MCF7 sh-ZNF143), showed better survival than control cells (MCF7 sh-Control) under starvation, which was compromised with chloroquine, an autophagy inhibitor.	Chloroquine	230-241	zinc finger protein 143	Homo sapiens	108-122
30949450-7	2019	In the presence of CQ we observed increased expression of the decoy receptor VEGFR1 and of a lower molecular weight form of VEGFR2, suggesting receptor cleavage.	Chloroquine	19-21	FMS-like tyrosine kinase 1	Mus musculus	77-83
31068299-8	2019	CQ treatment significantly inhibited the proliferation of the co-cultured SMMC-7721 cells (P &amp;lt; 0.05), increased the cell apoptosis (P &amp;lt; 0.05) and reduced the Bcl-2/Bax ratio (P &amp;lt; 0.01).	Chloroquine	0-2	BCL2 apoptosis regulator	Homo sapiens	172-177
31068299-8	2019	CQ treatment significantly inhibited the proliferation of the co-cultured SMMC-7721 cells (P &amp;lt; 0.05), increased the cell apoptosis (P &amp;lt; 0.05) and reduced the Bcl-2/Bax ratio (P &amp;lt; 0.01).	Chloroquine	0-2	BCL2 associated X, apoptosis regulator	Homo sapiens	178-181
32254809-5	2019	The results of the role of autophagy in the sensitivity of chemotherapeutic PTX to glioma cells showed that the stemness-associating genes (SOX2, POU5F1 and NANOG) of live glioma cells increased in the presence of PTX, while they dropped sharply with the combination including CQ.	Chloroquine	277-279	SRY-box transcription factor 2	Homo sapiens	140-144
31040926-9	2019	Studies in HCT116 and SW480 cells further confirmed p62/Dclk1 co-localization and Chloroquin/LPS-induced increases in Dclk1 promoter activity.	Chloroquine	82-92	doublecortin like kinase 1	Homo sapiens	118-123
30897708-7	2019	CLE-10 that was pretreated with 3-methyladenine (3-MA) or chloroquine (CQ) weakened the upregulation of the protein expression of p-ULK1, or the downregulation of p62, p-mTOR, and decreased the level of cytotoxicity against MDA-MB-231 cells.	Chloroquine	58-69	unc-51 like autophagy activating kinase 1	Homo sapiens	132-136
30949450-7	2019	In the presence of CQ we observed increased expression of the decoy receptor VEGFR1 and of a lower molecular weight form of VEGFR2, suggesting receptor cleavage.	Chloroquine	19-21	kinase insert domain protein receptor	Mus musculus	124-130
30897708-7	2019	CLE-10 that was pretreated with 3-methyladenine (3-MA) or chloroquine (CQ) weakened the upregulation of the protein expression of p-ULK1, or the downregulation of p62, p-mTOR, and decreased the level of cytotoxicity against MDA-MB-231 cells.	Chloroquine	58-69	nucleoporin 62	Homo sapiens	163-166
30897708-7	2019	CLE-10 that was pretreated with 3-methyladenine (3-MA) or chloroquine (CQ) weakened the upregulation of the protein expression of p-ULK1, or the downregulation of p62, p-mTOR, and decreased the level of cytotoxicity against MDA-MB-231 cells.	Chloroquine	58-69	mechanistic target of rapamycin kinase	Homo sapiens	170-174
30897708-7	2019	CLE-10 that was pretreated with 3-methyladenine (3-MA) or chloroquine (CQ) weakened the upregulation of the protein expression of p-ULK1, or the downregulation of p62, p-mTOR, and decreased the level of cytotoxicity against MDA-MB-231 cells.	Chloroquine	71-73	unc-51 like autophagy activating kinase 1	Homo sapiens	132-136
30949450-8	2019	Consequently, VEGF-A-driven EC spheroid sprouting was reduced by CQ treatment.	Chloroquine	65-67	vascular endothelial growth factor A	Mus musculus	14-20
30897708-7	2019	CLE-10 that was pretreated with 3-methyladenine (3-MA) or chloroquine (CQ) weakened the upregulation of the protein expression of p-ULK1, or the downregulation of p62, p-mTOR, and decreased the level of cytotoxicity against MDA-MB-231 cells.	Chloroquine	71-73	nucleoporin 62	Homo sapiens	163-166
30897708-7	2019	CLE-10 that was pretreated with 3-methyladenine (3-MA) or chloroquine (CQ) weakened the upregulation of the protein expression of p-ULK1, or the downregulation of p62, p-mTOR, and decreased the level of cytotoxicity against MDA-MB-231 cells.	Chloroquine	71-73	mechanistic target of rapamycin kinase	Homo sapiens	170-174
30949450-9	2019	Furthermore, CQ significantly affected the transcription and secretion of platelet-derived growth factor (PDGF)-AB/BB (upregulated) and Endothelin-1 (EDN1, downregulated), both modulators of perivascular cell (PC) behavior.	Chloroquine	13-15	endothelin 1	Mus musculus	136-148
30949450-9	2019	Furthermore, CQ significantly affected the transcription and secretion of platelet-derived growth factor (PDGF)-AB/BB (upregulated) and Endothelin-1 (EDN1, downregulated), both modulators of perivascular cell (PC) behavior.	Chloroquine	13-15	endothelin 1	Mus musculus	150-154
30949450-12	2019	Moreover, upon CQ treatment the tumoral expression of angiopoietin-1 (Angpt1), which retains mural cells, and induces vessel stabilization by binding to the EC-localized cognate receptor (TIE2), was increased thus supporting the vessel normalization function of CQ.	Chloroquine	15-17	angiopoietin 1	Mus musculus	54-68
30949450-12	2019	Moreover, upon CQ treatment the tumoral expression of angiopoietin-1 (Angpt1), which retains mural cells, and induces vessel stabilization by binding to the EC-localized cognate receptor (TIE2), was increased thus supporting the vessel normalization function of CQ.	Chloroquine	15-17	angiopoietin 1	Mus musculus	70-76
30949450-12	2019	Moreover, upon CQ treatment the tumoral expression of angiopoietin-1 (Angpt1), which retains mural cells, and induces vessel stabilization by binding to the EC-localized cognate receptor (TIE2), was increased thus supporting the vessel normalization function of CQ.	Chloroquine	15-17	TEK receptor tyrosine kinase	Mus musculus	188-192
30949450-12	2019	Moreover, upon CQ treatment the tumoral expression of angiopoietin-1 (Angpt1), which retains mural cells, and induces vessel stabilization by binding to the EC-localized cognate receptor (TIE2), was increased thus supporting the vessel normalization function of CQ.	Chloroquine	262-264	angiopoietin 1	Mus musculus	54-68
30949450-12	2019	Moreover, upon CQ treatment the tumoral expression of angiopoietin-1 (Angpt1), which retains mural cells, and induces vessel stabilization by binding to the EC-localized cognate receptor (TIE2), was increased thus supporting the vessel normalization function of CQ.	Chloroquine	262-264	angiopoietin 1	Mus musculus	70-76
30949450-12	2019	Moreover, upon CQ treatment the tumoral expression of angiopoietin-1 (Angpt1), which retains mural cells, and induces vessel stabilization by binding to the EC-localized cognate receptor (TIE2), was increased thus supporting the vessel normalization function of CQ.	Chloroquine	262-264	TEK receptor tyrosine kinase	Mus musculus	188-192
30686534-5	2019	In contrast, genetic ablation (using ATG5-/- or ATG7-/- cells) or pharmacologic inhibition (the administration of bafilomycin A1 or chloroquine) of autophagy was found to block ferroptosis activator-induced HMGB1 release.	Chloroquine	132-143	high mobility group box 1	Homo sapiens	207-212
31182915-6	2019	Additionally, CyclinD1 accumulation was increased in response to chloroquine (CQ) or in MEF Atg7 knockout cells.	Chloroquine	65-76	cyclin D1	Homo sapiens	14-22
31182915-6	2019	Additionally, CyclinD1 accumulation was increased in response to chloroquine (CQ) or in MEF Atg7 knockout cells.	Chloroquine	78-80	cyclin D1	Homo sapiens	14-22
30894853-12	2019	The pIC induction of Atlantic cod viperin was significantly inhibited with 2-Aminopurine, Chloroquine, SB202190, and Ruxolitinib.	Chloroquine	90-101	radical S-adenosyl methionine domain containing 2	Homo sapiens	34-41
30578829-7	2019	This is further supported by the findings that administration of chloroquine (CQ) potentiated the basic and Cd-elevated LC3-II and p62 levels, autophagosome accumulation and cell apoptosis, whereas rapamycin relieved the effects in the cells in response to Cd.	Chloroquine	65-76	annexin A3	Rattus norvegicus	120-123
30578829-7	2019	This is further supported by the findings that administration of chloroquine (CQ) potentiated the basic and Cd-elevated LC3-II and p62 levels, autophagosome accumulation and cell apoptosis, whereas rapamycin relieved the effects in the cells in response to Cd.	Chloroquine	65-76	KH RNA binding domain containing, signal transduction associated 1	Rattus norvegicus	131-134
30578829-7	2019	This is further supported by the findings that administration of chloroquine (CQ) potentiated the basic and Cd-elevated LC3-II and p62 levels, autophagosome accumulation and cell apoptosis, whereas rapamycin relieved the effects in the cells in response to Cd.	Chloroquine	78-80	annexin A3	Rattus norvegicus	120-123
30578829-7	2019	This is further supported by the findings that administration of chloroquine (CQ) potentiated the basic and Cd-elevated LC3-II and p62 levels, autophagosome accumulation and cell apoptosis, whereas rapamycin relieved the effects in the cells in response to Cd.	Chloroquine	78-80	KH RNA binding domain containing, signal transduction associated 1	Rattus norvegicus	131-134
29700990-6	2019	Recently developed CXCR4-targeted polymeric drugs and nanomedicines, including cyclam- and chloroquine-based polymeric CXCR4 antagonists are introduced here and their ability to deliver functional siRNA and miRNA is discussed.	Chloroquine	91-102	C-X-C motif chemokine receptor 4	Homo sapiens	19-24
30548974-7	2019	The role of TLR9/NF-kappaB dependent activity was confirmed by HEK-Blue hTLR9 reporter cell line analysis after coincubation with TLF specimens with predetermined concentrations of NAC or CQ alone or TLR9 inhibitory oligodeoxynucleotide (iODN).	Chloroquine	188-190	TLR9	Sus scrofa	12-16
29700990-6	2019	Recently developed CXCR4-targeted polymeric drugs and nanomedicines, including cyclam- and chloroquine-based polymeric CXCR4 antagonists are introduced here and their ability to deliver functional siRNA and miRNA is discussed.	Chloroquine	91-102	C-X-C motif chemokine receptor 4	Homo sapiens	119-124
30778048-8	2019	Further study showed that inhibition of autophagy by chloroquine or bafilomycin A1 reversed PBK-induced cisplatin resistance.	Chloroquine	53-64	PDZ binding kinase	Homo sapiens	92-95
30899433-7	2019	In addition, chloroquine treatment restored the levels of ACC1 protein reduced by Pin1 siRNA treatment, indicating that Pin1 suppressed ACC1 degradation through the lysosomal pathway.	Chloroquine	13-24	acetyl-CoA carboxylase alpha	Homo sapiens	58-62
30899433-7	2019	In addition, chloroquine treatment restored the levels of ACC1 protein reduced by Pin1 siRNA treatment, indicating that Pin1 suppressed ACC1 degradation through the lysosomal pathway.	Chloroquine	13-24	peptidylprolyl cis/trans isomerase, NIMA-interacting 1	Homo sapiens	82-86
30899433-7	2019	In addition, chloroquine treatment restored the levels of ACC1 protein reduced by Pin1 siRNA treatment, indicating that Pin1 suppressed ACC1 degradation through the lysosomal pathway.	Chloroquine	13-24	peptidylprolyl cis/trans isomerase, NIMA-interacting 1	Homo sapiens	120-124
30899433-7	2019	In addition, chloroquine treatment restored the levels of ACC1 protein reduced by Pin1 siRNA treatment, indicating that Pin1 suppressed ACC1 degradation through the lysosomal pathway.	Chloroquine	13-24	acetyl-CoA carboxylase alpha	Homo sapiens	136-140
30755242-12	2019	Co-administration of anlotinib and chloroquine (CQ) further reduced VEGFA level in the tumor supernatant, compared with that of anlotinib or CQ treatment alone.	Chloroquine	35-46	vascular endothelial growth factor A	Homo sapiens	68-73
30899392-9	2019	The inhibition of autophagy by chloroquine (CQ) contributed to the enhanced anti-tumor effect of Mel, but autophagy induction by RAPA decreased Mel effect in HCC cells.	Chloroquine	31-42	melittin	Apis mellifera	97-100
30899392-9	2019	The inhibition of autophagy by chloroquine (CQ) contributed to the enhanced anti-tumor effect of Mel, but autophagy induction by RAPA decreased Mel effect in HCC cells.	Chloroquine	44-46	melittin	Apis mellifera	97-100
30755242-12	2019	Co-administration of anlotinib and chloroquine (CQ) further reduced VEGFA level in the tumor supernatant, compared with that of anlotinib or CQ treatment alone.	Chloroquine	48-50	vascular endothelial growth factor A	Homo sapiens	68-73
30595379-12	2019	Meanwhile, the effect of 5 mug/ml insulin on receding cellular senescence could be alleviated by autophagy inhibitor chloroquine or reinforced by autophagy activator rapamycin.	Chloroquine	117-128	insulin	Homo sapiens	34-41
30442709-3	2019	Using an in situ photoaffinity pulldown strategy, we identified palmitoyl-protein thioesterase 1 (PPT1) as a molecular target shared across monomeric and dimeric CQ derivatives.	Chloroquine	162-164	palmitoyl-protein thioesterase 1	Homo sapiens	64-96
30711941-4	2019	Effects of chloroquine and/or rapamycin on the mTOR pathway components, autophagy, and apoptosis were investigated by western blot, flow cytometry, and fluorescence microscopy using immunocytochemical staining of LC3 and Annexin V-FITC/propidium iodide.	Chloroquine	11-22	mechanistic target of rapamycin kinase	Homo sapiens	47-51
30442709-3	2019	Using an in situ photoaffinity pulldown strategy, we identified palmitoyl-protein thioesterase 1 (PPT1) as a molecular target shared across monomeric and dimeric CQ derivatives.	Chloroquine	162-164	palmitoyl-protein thioesterase 1	Homo sapiens	98-102
30442709-0	2019	PPT1 Promotes Tumor Growth and Is the Molecular Target of Chloroquine Derivatives in Cancer.	Chloroquine	58-69	palmitoyl-protein thioesterase 1	Homo sapiens	0-4
30442709-5	2019	Knockout of PPT1 in cancer cells using CRISPR/Cas9 editing abrogates autophagy modulation and cytotoxicity of CQ derivatives, and results in significant impairment of tumor growth similar to that observed with DC661.	Chloroquine	110-112	palmitoyl-protein thioesterase 1	Homo sapiens	12-16
30442709-7	2019	Thus, PPT1 represents a new target in cancer that can be inhibited with CQ derivatives.	Chloroquine	72-74	palmitoyl-protein thioesterase 1	Homo sapiens	6-10
30442709-8	2019	SIGNIFICANCE: This study identifies PPT1 as the previously unknown lysosomal molecular target of monomeric and dimeric CQ derivatives.	Chloroquine	119-121	palmitoyl-protein thioesterase 1	Homo sapiens	36-40
30431076-5	2019	The attenuation of the autophagic flux by applying the specific inhibitor of autophagy, chloroquine, significantly suppressed DR5 expression.	Chloroquine	88-99	TNF receptor superfamily member 10b	Homo sapiens	126-129
30411500-6	2019	Furthermore, elevation of p300 expression by Momordica Antiviral Protein 30 Kd (MAP30) or chloroquine reduced HQ-induced autophagy.	Chloroquine	90-101	E1A binding protein p300	Homo sapiens	26-30
30483736-3	2019	The current study identified a potential pathway by revealing that TRAIL and 6-sho or chloroquine acted together to trigger reactive oxygen species (ROS) production, to upregulate tumor-suppressor protein 53 (p53) expression and to change the mitochondrial transmembrane potential (MTP).	Chloroquine	86-97	tumor protein p53	Homo sapiens	209-212
30733719-0	2019	Enhanced Neutrophil Extracellular Trap Formation in Acute Pancreatitis Contributes to Disease Severity and Is Reduced by Chloroquine.	Chloroquine	121-132	signal sequence receptor, delta	Mus musculus	34-38
30414849-8	2019	Applying lentivirus to transfect NP cells, TFEB overexpression restored the TBHP-induced autophagic flux blockage and protected NP cells against apoptosis and senescence; these protections of TFEB are diminished by chloroquine-medicated autophagy inhibition.	Chloroquine	215-226	transcription factor EB	Rattus norvegicus	43-47
30414849-8	2019	Applying lentivirus to transfect NP cells, TFEB overexpression restored the TBHP-induced autophagic flux blockage and protected NP cells against apoptosis and senescence; these protections of TFEB are diminished by chloroquine-medicated autophagy inhibition.	Chloroquine	215-226	transcription factor EB	Rattus norvegicus	192-196
30867824-13	2019	CXCL5 was also induced in RCC by chloroquine and in a model of HER2 positive breast cancer cell lines after acute or chronic treatment with lapatinib.	Chloroquine	33-44	C-X-C motif chemokine ligand 5	Homo sapiens	0-5
31488033-6	2019	Following treatment with chloroquine, the expression of LC3 was enhanced Immunofluorescence also confirmed this result.	Chloroquine	25-36	microtubule associated protein 1 light chain 3 alpha	Homo sapiens	56-59
30641518-6	2019	RE reduced CQ-induced Abeta accumulation, which resulted in decreased formation of rimmed vacuoles and mitochondrial-mediated apoptosis.	Chloroquine	11-13	amyloid beta precursor protein	Rattus norvegicus	22-27
31639786-12	2019	Conversely, cells sorted for high PD-L1 expression had lower sensitivity to both the BRAF inhibitor vemurafenib and the autophagy inhibitor chloroquine.	Chloroquine	140-151	CD274 molecule	Homo sapiens	34-39
31378768-10	2019	CQ might inhibit autophagy by significantly increased p62/LC3 ratio, while AM might have a potential of inducing autophagy by showing an increased gene expression of the autophagy regulator, Atg5.	Chloroquine	0-2	KH RNA binding domain containing, signal transduction associated 1	Rattus norvegicus	54-57
30145802-3	2019	In the presence of the autophagy inhibitor chloroquine, the AZD9291-induced increase in LC3 level was further augmented.	Chloroquine	43-54	microtubule associated protein 1 light chain 3 alpha	Homo sapiens	88-91
29786968-9	2019	The inhibition of autophagy by chloroquine or autophagy-related 7 (Atg7) ribonucleic acid interference counteracted the starvation-induced decrease of IRS-1.	Chloroquine	31-42	insulin receptor substrate 1	Homo sapiens	151-156
31378768-10	2019	CQ might inhibit autophagy by significantly increased p62/LC3 ratio, while AM might have a potential of inducing autophagy by showing an increased gene expression of the autophagy regulator, Atg5.	Chloroquine	0-2	annexin A3	Rattus norvegicus	58-61
31368411-9	2019	Autophagy inhibition by CQ inhibited CD133+ stemness and promoted CDDP efficiency in A549 cells.	Chloroquine	24-26	prominin 1	Mus musculus	37-42
30526602-4	2018	Exogenous TGF-beta1 was administrated and high-mobility group box-1 (HMGB1), autophagy were blocked by siRNA and chloroquine (CQ) respectively to explore the mechanism of the atrophic effect of TGF-beta1 in denervated muscle.	Chloroquine	113-124	high mobility group box 1	Mus musculus	69-74
30025651-9	2018	Furthermore, lysosome inhibitor chloroquine prevented SNX17 silencing-induced reduction of SERCA2a protein level.	Chloroquine	32-43	sorting nexin 17	Rattus norvegicus	54-59
30193956-8	2018	Increased LC3-II and decreased P62 expression both in the presence and absence of chloroquine were observed in Mst1 knockdown cardiomyocytes administered with Ang II.	Chloroquine	82-93	macrophage stimulating 1 (hepatocyte growth factor-like)	Mus musculus	111-115
30337735-9	2018	While 3-MA, an early autophagy inhibitor, reduced the ST-induced cleavage of poly (ADP-ribose) polymerase-1 (PARP-1), a substrate of caspase 3/7 and often used marker of caspase-dependent apoptosis, CQ promoted the ST-dependent PARP-1 cleavage, indicating that the early and late autophagy functioned differentially on the ST-activated apoptotic process.	Chloroquine	199-201	poly(ADP-ribose) polymerase 1	Homo sapiens	109-115
30248419-10	2018	In addition, CQ aggravated the production of mitochondrial reactive oxygen species, the release of cytochrome c release, and the activation of caspase-3.	Chloroquine	13-15	cytochrome c	Sus scrofa	99-111
30248419-10	2018	In addition, CQ aggravated the production of mitochondrial reactive oxygen species, the release of cytochrome c release, and the activation of caspase-3.	Chloroquine	13-15	caspase 3	Sus scrofa	143-152
30318510-5	2018	RESULTS: C1A potently resolved autophagy substrates induced by 3-methyladenine and chloroquine.	Chloroquine	83-94	endogenous retrovirus group K member 1	Homo sapiens	9-12
30134011-6	2018	Inhibition of autophagy by Atg3 and Atg7 knockdown or by chloroquine treatment prevented degradation of PDE4A and activation of cAMP/PKA/CREB signalling, suppressing TGF-beta1 expression, EMT and invasion in hepatocarcinoma cells.	Chloroquine	57-68	phosphodiesterase 4A	Homo sapiens	104-109
30134011-6	2018	Inhibition of autophagy by Atg3 and Atg7 knockdown or by chloroquine treatment prevented degradation of PDE4A and activation of cAMP/PKA/CREB signalling, suppressing TGF-beta1 expression, EMT and invasion in hepatocarcinoma cells.	Chloroquine	57-68	cAMP responsive element binding protein 1	Homo sapiens	137-141
30134011-6	2018	Inhibition of autophagy by Atg3 and Atg7 knockdown or by chloroquine treatment prevented degradation of PDE4A and activation of cAMP/PKA/CREB signalling, suppressing TGF-beta1 expression, EMT and invasion in hepatocarcinoma cells.	Chloroquine	57-68	transforming growth factor beta 1	Homo sapiens	166-175
30482226-8	2018	First, chloroquine and bortezomib prevented C/EBP-beta LIP degradation and activated LIP-dependent CHOP/TRB3/caspase 3 axis in response to doxorubicin.	Chloroquine	7-18	DNA-damage inducible transcript 3	Mus musculus	99-103
30482226-8	2018	First, chloroquine and bortezomib prevented C/EBP-beta LIP degradation and activated LIP-dependent CHOP/TRB3/caspase 3 axis in response to doxorubicin.	Chloroquine	7-18	tribbles pseudokinase 3	Mus musculus	104-108
30482226-8	2018	First, chloroquine and bortezomib prevented C/EBP-beta LIP degradation and activated LIP-dependent CHOP/TRB3/caspase 3 axis in response to doxorubicin.	Chloroquine	7-18	caspase 3	Mus musculus	109-118
30482226-10	2018	Third, chloroquine and bortezomib increased the endogenous production of nitric oxide that further induced C/EBP-beta LIP and inhibited Pgp activity, enhancing doxorubicin"s cytotoxicity.	Chloroquine	7-18	CCAAT/enhancer binding protein (C/EBP), beta	Mus musculus	107-117
30482226-10	2018	Third, chloroquine and bortezomib increased the endogenous production of nitric oxide that further induced C/EBP-beta LIP and inhibited Pgp activity, enhancing doxorubicin"s cytotoxicity.	Chloroquine	7-18	phosphoglycolate phosphatase	Mus musculus	136-139
30482226-11	2018	In orthotopic models of resistant TNBC, intratumor C/EBP-beta LIP induction - achieved by a specific expression vector or by chloroquine and bortezomib - effectively reduced tumor growth and Pgp expression, increased intra-tumor apoptosis and anti-tumor immune-infiltrate, rescuing the efficacy of doxorubicin.	Chloroquine	125-136	CCAAT/enhancer binding protein (C/EBP), beta	Mus musculus	51-61
30425236-9	2018	Biologically, autophagy inhibitor, chloroquine (CQ), or Bafilomycin A1 (BAF A1), significantly induced apoptosis in RPS27L silenced cells, indicating that autophagy is a cellular survival mechanism in response to RPS27L loss.	Chloroquine	35-46	ribosomal protein S27 like	Homo sapiens	116-122
30425236-9	2018	Biologically, autophagy inhibitor, chloroquine (CQ), or Bafilomycin A1 (BAF A1), significantly induced apoptosis in RPS27L silenced cells, indicating that autophagy is a cellular survival mechanism in response to RPS27L loss.	Chloroquine	35-46	ribosomal protein S27 like	Homo sapiens	213-219
30425236-9	2018	Biologically, autophagy inhibitor, chloroquine (CQ), or Bafilomycin A1 (BAF A1), significantly induced apoptosis in RPS27L silenced cells, indicating that autophagy is a cellular survival mechanism in response to RPS27L loss.	Chloroquine	48-50	ribosomal protein S27 like	Homo sapiens	116-122
30425236-9	2018	Biologically, autophagy inhibitor, chloroquine (CQ), or Bafilomycin A1 (BAF A1), significantly induced apoptosis in RPS27L silenced cells, indicating that autophagy is a cellular survival mechanism in response to RPS27L loss.	Chloroquine	48-50	ribosomal protein S27 like	Homo sapiens	213-219
30519584-6	2018	Further, treatment with CQ decreased the levels of active p65, TNF-alpha, MCP-1, and MMP-9 in cells underdesiccation stress.	Chloroquine	24-26	v-rel reticuloendotheliosis viral oncogene homolog A (avian)	Mus musculus	58-61
30519584-6	2018	Further, treatment with CQ decreased the levels of active p65, TNF-alpha, MCP-1, and MMP-9 in cells underdesiccation stress.	Chloroquine	24-26	tumor necrosis factor	Mus musculus	63-72
30519584-6	2018	Further, treatment with CQ decreased the levels of active p65, TNF-alpha, MCP-1, and MMP-9 in cells underdesiccation stress.	Chloroquine	24-26	mast cell protease 1	Mus musculus	74-79
30519584-6	2018	Further, treatment with CQ decreased the levels of active p65, TNF-alpha, MCP-1, and MMP-9 in cells underdesiccation stress.	Chloroquine	24-26	matrix metallopeptidase 9	Mus musculus	85-90
30519584-8	2018	Changes in the phosphorylation levels of MAPKinase and mTOR pathway proteins were found in HCE-T cells under desiccation stress with or without CQ treatment.	Chloroquine	144-146	RNA guanylyltransferase and 5'-phosphatase	Homo sapiens	91-94
30519584-9	2018	Taken together, the data suggests that HCE-T cells under desiccation stress showed NFkappaB mediated inflammation, which was rescued through the anti-inflammatory effect of CQ without altering the autophagy flux.	Chloroquine	173-175	RNA guanylyltransferase and 5'-phosphatase	Homo sapiens	39-42
30591104-9	2018	Results Compared with the model group, the expression of LC3B mRNA increased significantly, and P62 expression decreased in TMZ combined with CQ group.	Chloroquine	142-144	microtubule-associated protein 1 light chain 3 beta	Mus musculus	57-61
30591104-9	2018	Results Compared with the model group, the expression of LC3B mRNA increased significantly, and P62 expression decreased in TMZ combined with CQ group.	Chloroquine	142-144	nucleoporin 62	Mus musculus	96-99
30591104-10	2018	Meanwhile, the levels of TC, FC, CE/TC, and the expression of NLRP3, ASC, caspase-1 in TMZ combined with CQ group were reduced obviously.	Chloroquine	105-107	NLR family, pyrin domain containing 3	Mus musculus	62-67
30591104-10	2018	Meanwhile, the levels of TC, FC, CE/TC, and the expression of NLRP3, ASC, caspase-1 in TMZ combined with CQ group were reduced obviously.	Chloroquine	105-107	steroid sulfatase	Mus musculus	69-72
30591104-10	2018	Meanwhile, the levels of TC, FC, CE/TC, and the expression of NLRP3, ASC, caspase-1 in TMZ combined with CQ group were reduced obviously.	Chloroquine	105-107	caspase 1	Mus musculus	74-83
30015858-9	2018	The use of the lysosomal inhibitors, bafilomycin and chloroquine, resulted in the accumulation of LC3II and Beclin 1, a decrease in the levels of LAMP2 and RAB7, and the exacerbation of allodynia, hyperalgesia and astrocyte activation in rats with neuropathic pain.	Chloroquine	53-64	beclin 1	Rattus norvegicus	108-116
30282964-8	2018	The protective effects of TRPC6 ablation were prevented by autophagy inhibitors Chloroquine and Bafilomycin A1.	Chloroquine	80-91	transient receptor potential cation channel subfamily C member 6	Homo sapiens	26-31
30279493-6	2018	Furthermore, AG1 decreases chloroquine- or diamide-induced oxidative stress in human erythrocytes.	Chloroquine	27-38	NBPF member 10	Homo sapiens	13-16
30315154-4	2018	Inhibition of autophagy with 3-methyl adenine or chloroquine has a remarkable synergistic effect on TNP-1-mediated PTT in triple-negative (4T1), drug-resistant (MCF7/MDR) and patient-derived breast cancer models, achieving a level of efficacy unattainable with TNP-2, the identically-shaped CuPd nanoparticles that have a higher photothermal conversion efficiency but no autophagy-inducing activity.	Chloroquine	49-60	transition protein 1	Homo sapiens	100-105
30315154-4	2018	Inhibition of autophagy with 3-methyl adenine or chloroquine has a remarkable synergistic effect on TNP-1-mediated PTT in triple-negative (4T1), drug-resistant (MCF7/MDR) and patient-derived breast cancer models, achieving a level of efficacy unattainable with TNP-2, the identically-shaped CuPd nanoparticles that have a higher photothermal conversion efficiency but no autophagy-inducing activity.	Chloroquine	49-60	transition protein 2	Homo sapiens	261-266
30015858-9	2018	The use of the lysosomal inhibitors, bafilomycin and chloroquine, resulted in the accumulation of LC3II and Beclin 1, a decrease in the levels of LAMP2 and RAB7, and the exacerbation of allodynia, hyperalgesia and astrocyte activation in rats with neuropathic pain.	Chloroquine	53-64	lysosomal-associated membrane protein 2	Rattus norvegicus	146-151
30015858-9	2018	The use of the lysosomal inhibitors, bafilomycin and chloroquine, resulted in the accumulation of LC3II and Beclin 1, a decrease in the levels of LAMP2 and RAB7, and the exacerbation of allodynia, hyperalgesia and astrocyte activation in rats with neuropathic pain.	Chloroquine	53-64	RAB7A, member RAS oncogene family	Rattus norvegicus	156-160
29717341-10	2018	Then we detected the PPAR-gamma and beta-catenin variation when applied with autophagy inhibitor CQ (chloroquine) and the same way, after Akt selective inhibitor applied in the test, the effect of SrRN was compromised.	Chloroquine	97-99	peroxisome proliferator-activated receptor gamma	Rattus norvegicus	21-31
30337807-0	2018	Korean Red Ginseng extract and ginsenoside Rg3 have anti-pruritic effects on chloroquine-induced itch by inhibition of MrgprA3/TRPA1-mediated pathway.	Chloroquine	77-88	MAS-related GPR, member A3	Mus musculus	119-126
29717341-10	2018	Then we detected the PPAR-gamma and beta-catenin variation when applied with autophagy inhibitor CQ (chloroquine) and the same way, after Akt selective inhibitor applied in the test, the effect of SrRN was compromised.	Chloroquine	97-99	catenin beta 1	Rattus norvegicus	36-48
29717341-10	2018	Then we detected the PPAR-gamma and beta-catenin variation when applied with autophagy inhibitor CQ (chloroquine) and the same way, after Akt selective inhibitor applied in the test, the effect of SrRN was compromised.	Chloroquine	101-112	peroxisome proliferator-activated receptor gamma	Rattus norvegicus	21-31
29717341-10	2018	Then we detected the PPAR-gamma and beta-catenin variation when applied with autophagy inhibitor CQ (chloroquine) and the same way, after Akt selective inhibitor applied in the test, the effect of SrRN was compromised.	Chloroquine	101-112	catenin beta 1	Rattus norvegicus	36-48
30337807-0	2018	Korean Red Ginseng extract and ginsenoside Rg3 have anti-pruritic effects on chloroquine-induced itch by inhibition of MrgprA3/TRPA1-mediated pathway.	Chloroquine	77-88	transient receptor potential cation channel, subfamily A, member 1	Mus musculus	127-132
30337807-5	2018	Results: CQ-induced Ca2+ influx was strongly inhibited by KRGE (10 mug/mL) in MrgprA3/TRPA1, and notably ginsenoside Rg3 dose-dependently suppressed CQ-induced Ca2+ influx in MrgprA3/TRPA1.	Chloroquine	9-11	MAS-related GPR, member A3	Mus musculus	78-85
30337807-5	2018	Results: CQ-induced Ca2+ influx was strongly inhibited by KRGE (10 mug/mL) in MrgprA3/TRPA1, and notably ginsenoside Rg3 dose-dependently suppressed CQ-induced Ca2+ influx in MrgprA3/TRPA1.	Chloroquine	9-11	transient receptor potential cation channel, subfamily A, member 1	Mus musculus	86-91
30337807-5	2018	Results: CQ-induced Ca2+ influx was strongly inhibited by KRGE (10 mug/mL) in MrgprA3/TRPA1, and notably ginsenoside Rg3 dose-dependently suppressed CQ-induced Ca2+ influx in MrgprA3/TRPA1.	Chloroquine	9-11	MAS-related GPR, member A3	Mus musculus	175-182
30337807-5	2018	Results: CQ-induced Ca2+ influx was strongly inhibited by KRGE (10 mug/mL) in MrgprA3/TRPA1, and notably ginsenoside Rg3 dose-dependently suppressed CQ-induced Ca2+ influx in MrgprA3/TRPA1.	Chloroquine	9-11	transient receptor potential cation channel, subfamily A, member 1	Mus musculus	183-188
30337807-5	2018	Results: CQ-induced Ca2+ influx was strongly inhibited by KRGE (10 mug/mL) in MrgprA3/TRPA1, and notably ginsenoside Rg3 dose-dependently suppressed CQ-induced Ca2+ influx in MrgprA3/TRPA1.	Chloroquine	149-151	MAS-related GPR, member A3	Mus musculus	175-182
30337807-5	2018	Results: CQ-induced Ca2+ influx was strongly inhibited by KRGE (10 mug/mL) in MrgprA3/TRPA1, and notably ginsenoside Rg3 dose-dependently suppressed CQ-induced Ca2+ influx in MrgprA3/TRPA1.	Chloroquine	149-151	transient receptor potential cation channel, subfamily A, member 1	Mus musculus	183-188
29959059-13	2018	Lack of efficacy for the third ADC could be restored by neutralizing lysosomal compartments with chloroquine.	Chloroquine	97-108	antizyme inhibitor 2	Homo sapiens	31-34
30200999-10	2018	Maraviroc and chloroquine were used to block the CCL5/CCR5 and autophagy pathway respectively.	Chloroquine	14-25	chemokine (C-C motif) ligand 5	Mus musculus	49-53
29932881-8	2018	After up-regulating Rab7, albumin-induced MMP-2 overactivation was attenuated, which was reversed by chloroquine (CQ; an endocytosis inhibitor).	Chloroquine	101-112	RAB7B, member RAS oncogene family	Homo sapiens	20-24
29932881-8	2018	After up-regulating Rab7, albumin-induced MMP-2 overactivation was attenuated, which was reversed by chloroquine (CQ; an endocytosis inhibitor).	Chloroquine	101-112	matrix metallopeptidase 2	Homo sapiens	42-47
29932881-8	2018	After up-regulating Rab7, albumin-induced MMP-2 overactivation was attenuated, which was reversed by chloroquine (CQ; an endocytosis inhibitor).	Chloroquine	114-116	RAB7B, member RAS oncogene family	Homo sapiens	20-24
29932881-8	2018	After up-regulating Rab7, albumin-induced MMP-2 overactivation was attenuated, which was reversed by chloroquine (CQ; an endocytosis inhibitor).	Chloroquine	114-116	matrix metallopeptidase 2	Homo sapiens	42-47
29665004-5	2018	Combined treatment of thiostrepton and cycloheximide/chloroquine prevented the degradation of mutant p53 protein, reinforcing autophagy as the means of mutant p53 destabilization.	Chloroquine	53-64	tumor protein p53	Homo sapiens	101-104
29665004-5	2018	Combined treatment of thiostrepton and cycloheximide/chloroquine prevented the degradation of mutant p53 protein, reinforcing autophagy as the means of mutant p53 destabilization.	Chloroquine	53-64	tumor protein p53	Homo sapiens	159-162
30295262-3	2018	The effects of luteolin and chloroquine on expression of cleaved-caspase 3 and LC3 in RPMI8826 cells was detected by Western blot.	Chloroquine	28-39	microtubule associated protein 1 light chain 3 alpha	Homo sapiens	79-82
30295262-6	2018	After treatment with lutelin 20micromol/L for 48 h, the expression of cleaved caspase3 and LC3 II/I in RPMI 8826 cells significantly increased; after treatment with chloroquine at the same time, the expression of cleaved-caspase 3 and LC3 II/I significantly decreased.	Chloroquine	165-176	microtubule associated protein 1 light chain 3 alpha	Homo sapiens	91-94
30295262-6	2018	After treatment with lutelin 20micromol/L for 48 h, the expression of cleaved caspase3 and LC3 II/I in RPMI 8826 cells significantly increased; after treatment with chloroquine at the same time, the expression of cleaved-caspase 3 and LC3 II/I significantly decreased.	Chloroquine	165-176	microtubule associated protein 1 light chain 3 alpha	Homo sapiens	235-238
30323820-7	2018	Chloroquine and hydroxychloroquine, anti-inflammatory drugs used to treat rheumatoid arthritis, prevent TRAF3 degradation in osteoclast precursors and inhibit osteoclast formation in vitro.	Chloroquine	0-11	TNF receptor-associated factor 3	Mus musculus	104-109
30206341-3	2018	By examining gene-edited parasites, we report that the ability of the wide-spread Dd2 PfCRT isoform to mediate chloroquine and amodiaquine resistance is substantially reduced by the addition of the PfCRT L272F mutation, which arose under blasticidin selection.	Chloroquine	111-122	aldo-keto reductase family 1 member C2	Homo sapiens	82-85
30200999-10	2018	Maraviroc and chloroquine were used to block the CCL5/CCR5 and autophagy pathway respectively.	Chloroquine	14-25	chemokine (C-C motif) receptor 5	Mus musculus	54-58
30127955-5	2018	Analysis by a polymerase chain reaction (PCR) array and confirmation via quantitative PCR technology indicated that the expression levels of growth arrest and DNA damage 153 [C/EBP homologous protein (CHOP)], a key molecule involved in ER stress-induced apoptosis, and its downstream death receptors were increased following CQ stimulation.	Chloroquine	325-327	DNA damage inducible transcript 3	Homo sapiens	175-199
30256440-7	2018	In addition, chloroquine (as the autophagy/lysosome inhibitor, CQ) or rapamycin (as the autophagy/lysosome inhibitor, Rap) attenuated osteoclast differentiation and bone resorption activity by OPG treatment via AMPK/mTOR/p70S6K signaling pathway.	Chloroquine	13-24	tumor necrosis factor receptor superfamily, member 11b (osteoprotegerin)	Mus musculus	193-196
30256440-7	2018	In addition, chloroquine (as the autophagy/lysosome inhibitor, CQ) or rapamycin (as the autophagy/lysosome inhibitor, Rap) attenuated osteoclast differentiation and bone resorption activity by OPG treatment via AMPK/mTOR/p70S6K signaling pathway.	Chloroquine	13-24	mechanistic target of rapamycin kinase	Mus musculus	216-220
30256440-7	2018	In addition, chloroquine (as the autophagy/lysosome inhibitor, CQ) or rapamycin (as the autophagy/lysosome inhibitor, Rap) attenuated osteoclast differentiation and bone resorption activity by OPG treatment via AMPK/mTOR/p70S6K signaling pathway.	Chloroquine	13-24	ribosomal protein S6 kinase, polypeptide 1	Mus musculus	221-227
29859188-6	2018	Furthermore, chloroquine or bafilomycin A1 treatment was able to restore TSG101-mediated AR expression reduction.	Chloroquine	13-24	tumor susceptibility 101	Homo sapiens	73-79
29859188-6	2018	Furthermore, chloroquine or bafilomycin A1 treatment was able to restore TSG101-mediated AR expression reduction.	Chloroquine	13-24	androgen receptor	Homo sapiens	89-91
29901280-7	2018	In the NPDFs, TLR9 showed intracellular localization and expression of TLR9 was increased after treatment with CpG A. CpG A increased production of alpha-smooth muscle actin (alpha-SMA), fibronectin, and matrix metalloproteinases (MMPs) (MMP1, MMP2, and MMP9) in the NPDFs, while MyD88 inhibitor and chloroquine, which are known to block the TLR9 signaling pathway, inhibited their production.	Chloroquine	300-311	toll like receptor 9	Homo sapiens	14-18
29901280-7	2018	In the NPDFs, TLR9 showed intracellular localization and expression of TLR9 was increased after treatment with CpG A. CpG A increased production of alpha-smooth muscle actin (alpha-SMA), fibronectin, and matrix metalloproteinases (MMPs) (MMP1, MMP2, and MMP9) in the NPDFs, while MyD88 inhibitor and chloroquine, which are known to block the TLR9 signaling pathway, inhibited their production.	Chloroquine	300-311	toll like receptor 9	Homo sapiens	71-75
29901280-7	2018	In the NPDFs, TLR9 showed intracellular localization and expression of TLR9 was increased after treatment with CpG A. CpG A increased production of alpha-smooth muscle actin (alpha-SMA), fibronectin, and matrix metalloproteinases (MMPs) (MMP1, MMP2, and MMP9) in the NPDFs, while MyD88 inhibitor and chloroquine, which are known to block the TLR9 signaling pathway, inhibited their production.	Chloroquine	300-311	toll like receptor 9	Homo sapiens	71-75
30127018-7	2018	These effects were mediated in part by differential expression of the transcriptional regulator ID4 (inhibitor of DNA binding 4); depletion of ID4 both promoted in vitro CQ sensitivity and restored lung colonization and metastasis of CQ-resistant cells.	Chloroquine	170-172	inhibitor of DNA binding 4, HLH protein	Homo sapiens	96-99
30127018-7	2018	These effects were mediated in part by differential expression of the transcriptional regulator ID4 (inhibitor of DNA binding 4); depletion of ID4 both promoted in vitro CQ sensitivity and restored lung colonization and metastasis of CQ-resistant cells.	Chloroquine	170-172	inhibitor of DNA binding 4, HLH protein	Homo sapiens	101-127
30127018-7	2018	These effects were mediated in part by differential expression of the transcriptional regulator ID4 (inhibitor of DNA binding 4); depletion of ID4 both promoted in vitro CQ sensitivity and restored lung colonization and metastasis of CQ-resistant cells.	Chloroquine	170-172	inhibitor of DNA binding 4, HLH protein	Homo sapiens	143-146
30127018-7	2018	These effects were mediated in part by differential expression of the transcriptional regulator ID4 (inhibitor of DNA binding 4); depletion of ID4 both promoted in vitro CQ sensitivity and restored lung colonization and metastasis of CQ-resistant cells.	Chloroquine	234-236	inhibitor of DNA binding 4, HLH protein	Homo sapiens	96-99
30127018-7	2018	These effects were mediated in part by differential expression of the transcriptional regulator ID4 (inhibitor of DNA binding 4); depletion of ID4 both promoted in vitro CQ sensitivity and restored lung colonization and metastasis of CQ-resistant cells.	Chloroquine	234-236	inhibitor of DNA binding 4, HLH protein	Homo sapiens	101-127
30127018-7	2018	These effects were mediated in part by differential expression of the transcriptional regulator ID4 (inhibitor of DNA binding 4); depletion of ID4 both promoted in vitro CQ sensitivity and restored lung colonization and metastasis of CQ-resistant cells.	Chloroquine	234-236	inhibitor of DNA binding 4, HLH protein	Homo sapiens	143-146
29909287-9	2018	Furthermore, we found that glutamine, lysomototropic agents - namely chloroquine and NH4Cl - as well as inhibition of v-ATPase, interfere with the intracellular transport of CD98hc.	Chloroquine	69-80	solute carrier family 3 member 2	Homo sapiens	174-180
29929000-7	2018	Furthermore, using chloroquine and siATG5 significantly enhances ROS production and application of the ROS scavenger N-acetyl-cysteine (NAC) rescues the cells undergoing apoptosis by abrogating the expression of DR5 and finally the caspase cascade.	Chloroquine	19-30	TNF receptor superfamily member 10b	Homo sapiens	212-215
30127955-5	2018	Analysis by a polymerase chain reaction (PCR) array and confirmation via quantitative PCR technology indicated that the expression levels of growth arrest and DNA damage 153 [C/EBP homologous protein (CHOP)], a key molecule involved in ER stress-induced apoptosis, and its downstream death receptors were increased following CQ stimulation.	Chloroquine	325-327	DNA damage inducible transcript 3	Homo sapiens	201-205
30127955-6	2018	It was considered that the upregulation of CHOP may mediate CQ-induced extrinsic pathways and autophagy-dependent apoptosis; therefore, the role of autophagy in cholangiocarcinoma treatment was elucidated based on the data demonstrating that CQ regulates the ER-autophagy network in tumor cells.	Chloroquine	60-62	DNA damage inducible transcript 3	Homo sapiens	43-47
30127955-6	2018	It was considered that the upregulation of CHOP may mediate CQ-induced extrinsic pathways and autophagy-dependent apoptosis; therefore, the role of autophagy in cholangiocarcinoma treatment was elucidated based on the data demonstrating that CQ regulates the ER-autophagy network in tumor cells.	Chloroquine	242-244	DNA damage inducible transcript 3	Homo sapiens	43-47
29530536-4	2018	Itch responses were evoked by histamine, chloroquine, and dinitrochlorobenzene-induced contact dermatitis (CD).	Chloroquine	41-52	itchy E3 ubiquitin protein ligase	Rattus norvegicus	0-4
33601758-0	2018	The anti-malarial chloroquine modulated cytokine levels and increased animal survivability via Akt-mediated inhibition of GSK3beta in Burkholderia pseudomalleiinfected mice.	Chloroquine	18-29	thymoma viral proto-oncogene 1	Mus musculus	95-98
33601758-0	2018	The anti-malarial chloroquine modulated cytokine levels and increased animal survivability via Akt-mediated inhibition of GSK3beta in Burkholderia pseudomalleiinfected mice.	Chloroquine	18-29	glycogen synthase kinase 3 alpha	Mus musculus	122-130
33601758-5	2018	The anti-malarial drug, chloroquine is a novel activator of Akt, and can elicit inhibition of GSK3beta via PI3K/Akt signalling.	Chloroquine	24-35	thymoma viral proto-oncogene 1	Mus musculus	60-63
33601758-5	2018	The anti-malarial drug, chloroquine is a novel activator of Akt, and can elicit inhibition of GSK3beta via PI3K/Akt signalling.	Chloroquine	24-35	glycogen synthase kinase 3 alpha	Mus musculus	94-102
33601758-5	2018	The anti-malarial drug, chloroquine is a novel activator of Akt, and can elicit inhibition of GSK3beta via PI3K/Akt signalling.	Chloroquine	24-35	thymoma viral proto-oncogene 1	Mus musculus	112-115
33601758-7	2018	Here we determined the effects of chloroquine administration on animal survivability, cytokine levels and phosphorylation states of GSK3beta (Ser9), Akt (Ser473) and NF-kappaB p65 (Ser536) in a murine model of acute melioidosis infection.	Chloroquine	34-45	glycogen synthase kinase 3 alpha	Mus musculus	132-140
33601758-13	2018	Findings from this study demonstrate that the increased survivability of B. pseudomalleiinfected mice after chloroquine administration is at least in part due to its cytokine-modulating effects elicited via Akt-mediated inhibition of GSK3beta that resulted in inhibition of NF-kappaB activation.	Chloroquine	108-119	thymoma viral proto-oncogene 1	Mus musculus	207-210
33601758-13	2018	Findings from this study demonstrate that the increased survivability of B. pseudomalleiinfected mice after chloroquine administration is at least in part due to its cytokine-modulating effects elicited via Akt-mediated inhibition of GSK3beta that resulted in inhibition of NF-kappaB activation.	Chloroquine	108-119	glycogen synthase kinase 3 alpha	Mus musculus	234-242
33601758-13	2018	Findings from this study demonstrate that the increased survivability of B. pseudomalleiinfected mice after chloroquine administration is at least in part due to its cytokine-modulating effects elicited via Akt-mediated inhibition of GSK3beta that resulted in inhibition of NF-kappaB activation.	Chloroquine	108-119	nuclear factor of kappa light polypeptide gene enhancer in B cells 1, p105	Mus musculus	274-283
30154423-5	2018	Applying lentivirus to transfect chondrocytes, we found that TFEB overexpression rescues the TBHP-induced the autophagic flux damage, lysosome dysfunction and protects chondrocyte against TBHP induced apoptosis and senescence; these protections of TFEB are diminished by chloroquine-medicated autophagy inhibition.	Chloroquine	271-282	transcription factor EB	Mus musculus	61-65
30092789-6	2018	CCK-8, Edu, and clone formation assays; wound healing and Transwell assays; PCR; immunohistochemistry; immunofluorescence; and western blotting were used to investigated the responses in TSSC3-overexpressing osteosarcoma cell lines, and in xenografts and metastasis in vivo models, with or without autophagy deficiency caused by chloroquine or ATG5 silencing.	Chloroquine	329-340	pleckstrin homology like domain family A member 2	Homo sapiens	187-192
29960010-0	2018	Chloroquine in combination with aptamer-modified nanocomplexes for tumor vessel normalization and efficient erlotinib/Survivin shRNA co-delivery to overcome drug resistance in EGFR-mutated non-small cell lung cancer.	Chloroquine	0-11	epidermal growth factor receptor	Homo sapiens	176-180
29530536-6	2018	GRK2 knockdown using small interfering RNA enhanced itch responses evoked by histamine, chloroquine, and dinitrochlorobenzene-induced CD, whereas GRK2 overexpression using GRK2-expressing adenovirus reduced the itch responses.	Chloroquine	88-99	G protein-coupled receptor kinase 2	Rattus norvegicus	0-4
29530536-6	2018	GRK2 knockdown using small interfering RNA enhanced itch responses evoked by histamine, chloroquine, and dinitrochlorobenzene-induced CD, whereas GRK2 overexpression using GRK2-expressing adenovirus reduced the itch responses.	Chloroquine	88-99	itchy E3 ubiquitin protein ligase	Rattus norvegicus	52-56
30441573-3	2018	This study used in silico modelling to gain mechanistic insights into the actions of anti-malarial drug chloroquine (CQ) in the setting of SQTI and SQT3.	Chloroquine	104-115	potassium inwardly rectifying channel subfamily J member 2	Homo sapiens	148-152
29530536-7	2018	Glutamine reduced all itch evoked by histamine, chloroquine, and dinitrochlorobenzene-induced CD.	Chloroquine	48-59	itchy E3 ubiquitin protein ligase	Rattus norvegicus	22-26
30112111-2	2018	Autophagy flux, as measured by LC3-I and -II in the presence of Chloroquine, showed a variable level in PCC and CAFs.	Chloroquine	64-75	T-box transcription factor 1	Homo sapiens	112-116
30112111-6	2018	In conclusion, this work clearly shows a heterogeneity in the effect of Chloroquine and highlights a role of CAFs autophagy in sensitizing tumors to treatments.	Chloroquine	72-83	T-box transcription factor 1	Homo sapiens	109-113
29986726-15	2018	Sunitinib, gemcitabine and chloroquine treated mice showed a significant reduction of GRP78 expression, reduced cell proliferation and increased apoptosis in pancreas, compatible with a tumor response.	Chloroquine	27-38	heat shock protein 5	Mus musculus	86-91
30034390-4	2018	In systemic lupus erythematosus (SLE), the inhibitory effect of chloroquine (CQ) on TLR9 is limited.	Chloroquine	64-75	toll like receptor 9	Homo sapiens	84-88
30034390-4	2018	In systemic lupus erythematosus (SLE), the inhibitory effect of chloroquine (CQ) on TLR9 is limited.	Chloroquine	77-79	toll like receptor 9	Homo sapiens	84-88
30034390-6	2018	Treatment with CQ for SLE has been proven to be useful, in part by interfering with HLA-antigen coupling and with TLR9 ligand recognition.	Chloroquine	15-17	toll like receptor 9	Homo sapiens	114-118
30034390-8	2018	The data presented here provide the basic information that could be useful for other clinical researchers to design studies that will have an impact in achieving a chronotherapeutic effect by defining the ideal time for CQ administration in SLE patients, consequently reducing the pathological effects that follow the activation of TLR9.	Chloroquine	220-222	toll like receptor 9	Homo sapiens	332-336
30441573-8	2018	At the single cells, CQ prolonged the AP duration (APD) under both the SQTI and SQT3 conditions; at the multi-cell strand level, CQ prolonged the QT intervals and declined the T-wave amplitude under both conditions.	Chloroquine	21-23	potassium inwardly rectifying channel subfamily J member 2	Homo sapiens	80-84
30441573-9	2018	CONCLUSIONS: This computational study provides novel insights into the efficacy of CQ in the setting of SQTI and SQT3 variants, and indicates that CQ is a useful drug in the treatment of SQTS.	Chloroquine	83-85	potassium inwardly rectifying channel subfamily J member 2	Homo sapiens	113-117
30441573-9	2018	CONCLUSIONS: This computational study provides novel insights into the efficacy of CQ in the setting of SQTI and SQT3 variants, and indicates that CQ is a useful drug in the treatment of SQTS.	Chloroquine	147-149	potassium inwardly rectifying channel subfamily J member 2	Homo sapiens	113-117
30186567-6	2018	In addition, CQ could dramatically reduce particle-induced soluble RANKL expression.	Chloroquine	13-15	TNF superfamily member 11	Homo sapiens	67-72
30084802-9	2018	ART induced LDH release, whereas CQ activated caspase 3, confirming induction of necrotic and apoptotic cell deaths by ART and CQ, respectively.	Chloroquine	33-35	caspase 3	Homo sapiens	46-55
30441573-3	2018	This study used in silico modelling to gain mechanistic insights into the actions of anti-malarial drug chloroquine (CQ) in the setting of SQTI and SQT3.	Chloroquine	117-119	potassium inwardly rectifying channel subfamily J member 2	Homo sapiens	148-152
29749472-9	2018	CD133 was localized to autophagosomes, and was suppressed by 3-MA or chloroquine (CQ) after iRFA treatment.	Chloroquine	69-80	prominin 1	Homo sapiens	0-5
29572810-0	2018	Chloroquine-treated dendritic cells require STAT1 signaling for their tolerogenic activity.	Chloroquine	0-11	signal transducer and activator of transcription 1	Homo sapiens	44-49
29572810-4	2018	Here, we show that STAT 1 is necessary for CQ-induced tolerogenic DCs (tolDCs) to efficiently suppress EAE.	Chloroquine	43-45	signal transducer and activator of transcription 1	Homo sapiens	19-25
29572810-5	2018	We observed that CQ induces phosphorylation of STAT1 in DCs in vivo and in vitro.	Chloroquine	17-19	signal transducer and activator of transcription 1	Homo sapiens	47-52
29572810-6	2018	Genetic blockage of STAT1 abrogated the suppressive activity of CQ-treated DCs.	Chloroquine	64-66	signal transducer and activator of transcription 1	Homo sapiens	20-25
29572810-7	2018	Opposed to its WT counterparts, CQ-treated STAT1-/- BMDCs were unable to suppress Th17 cells and increased EAE severity.	Chloroquine	32-34	signal transducer and activator of transcription 1	Homo sapiens	43-48
29572810-8	2018	Our findings show that STAT1 is a major signaling pathway in CQ-induced tolDCs and may shed light on new therapeutic avenues for the induction of tolDCs in autoimmune diseases such as MS.	Chloroquine	61-63	signal transducer and activator of transcription 1	Homo sapiens	23-28
29602802-5	2018	Furthermore, we measured radioresistance by clonogenic survival assay after treatment with autophagy inhibitor (Chloroquine) and ROS inhibitor (N-acetyl-l-cysteine) in SMAD4-depleted pancreatic cancer cells.	Chloroquine	112-123	SMAD family member 4	Homo sapiens	168-173
29976399-8	2018	The direct influence of autophagic flux on development of cellular senescence and insulin resistance was confirmed by blockage of autophagic flux with chloroquine.	Chloroquine	151-162	insulin	Homo sapiens	82-89
29749472-9	2018	CD133 was localized to autophagosomes, and was suppressed by 3-MA or chloroquine (CQ) after iRFA treatment.	Chloroquine	82-84	prominin 1	Homo sapiens	0-5
29749510-8	2018	Moreover, inhibition of GRP78 mitigated the combined TMZ and chloroquine effect.	Chloroquine	61-72	heat shock protein family A (Hsp70) member 5	Homo sapiens	24-29
29929491-12	2018	The NET inhibitor chloroquine reduces platelet aggregation, reduces circulating tissue factor and decreases hypercoagulability on TEG.	Chloroquine	18-29	coagulation factor III	Mus musculus	80-93
29316847-7	2018	In addition, CQ significantly inhibits the degradation of ubiquitinated I-kappaBalpha and blocks the nuclear translocation of nuclear factor kappa B p65 and expression of inflammatory factors.	Chloroquine	13-15	NFKB inhibitor alpha	Rattus norvegicus	72-85
29316847-7	2018	In addition, CQ significantly inhibits the degradation of ubiquitinated I-kappaBalpha and blocks the nuclear translocation of nuclear factor kappa B p65 and expression of inflammatory factors.	Chloroquine	13-15	synaptotagmin 1	Rattus norvegicus	149-152
29574131-2	2018	D/PSP@CQ/CaP was prepared by coprecipitating chloroquine phosphate (CQ) with calcium chloride, in the form of chloroquine-calcium phosphate coprecipitate (CQ/CaP), onto the surface of a deep-tumor-penetrating doxorubicine (DOX)-loading core particle (named as "D/PSP").	Chloroquine	45-56	persephin	Mus musculus	2-5
29884802-5	2018	Treatment with CQ or AQ abolished high-glucose-induced phospho-AMPK and phosph-PGC1alpha down-regulation in HKC8 cells.	Chloroquine	15-17	PPARG coactivator 1 alpha	Homo sapiens	79-88
29867114-7	2018	In HCT116 cells, SNX10 knockout resulted in the increase of CMA and mTOR activation, which could be abolished by chloroquine treatment or reversed by SNX10 overexpression.	Chloroquine	113-124	sorting nexin 10	Homo sapiens	17-22
29867114-7	2018	In HCT116 cells, SNX10 knockout resulted in the increase of CMA and mTOR activation, which could be abolished by chloroquine treatment or reversed by SNX10 overexpression.	Chloroquine	113-124	mechanistic target of rapamycin kinase	Homo sapiens	68-72
29917191-11	2018	In addition, 5-fluorouracil and chloroquine both increased the expression of Notch1 in gastric CSCs.	Chloroquine	32-43	notch receptor 1	Homo sapiens	77-83
29331314-7	2018	The hypoxia-induced cytochrome c release, cleaved caspase 3 and cleaved caspase 9 were aggravated by CQ.	Chloroquine	101-103	caspase 9	Rattus norvegicus	72-81
29597147-8	2018	The CAPE (10 muM)-induced decrease in claudin-2 expression was inhibited by chloroquine, a lysosomal inhibitor.	Chloroquine	76-87	claudin 2	Homo sapiens	38-47
29653411-4	2018	In addition, oxalate-induced p38 phosphorylation was significantly attenuated by chloroquine pretreatment but was markedly enhanced by rapamycin pretreatment, whereas the protective effect of chloroquine on rat renal tubular cell oxidative injury was partly reversed by a p38 protein kinase activator anisomycin.	Chloroquine	81-92	mitogen activated protein kinase 14	Rattus norvegicus	29-32
29658606-6	2018	CQ-mediated growth inhibition in A549 cells was characterized by the targeting of the PI3K/AKT pathway, thus, inducing mitochondria-mediated apoptosis at relatively higher concentrations by downregulating Bcl-2 expression, increasing the expression level of Bax, decreasing mitochondrial membrane potential, releasing cytochrome c from the mitochondria into the cytosol, activating caspase-3 and cleaving PARP.	Chloroquine	0-2	AKT serine/threonine kinase 1	Homo sapiens	91-94
29658606-6	2018	CQ-mediated growth inhibition in A549 cells was characterized by the targeting of the PI3K/AKT pathway, thus, inducing mitochondria-mediated apoptosis at relatively higher concentrations by downregulating Bcl-2 expression, increasing the expression level of Bax, decreasing mitochondrial membrane potential, releasing cytochrome c from the mitochondria into the cytosol, activating caspase-3 and cleaving PARP.	Chloroquine	0-2	BCL2 apoptosis regulator	Homo sapiens	205-210
29658606-6	2018	CQ-mediated growth inhibition in A549 cells was characterized by the targeting of the PI3K/AKT pathway, thus, inducing mitochondria-mediated apoptosis at relatively higher concentrations by downregulating Bcl-2 expression, increasing the expression level of Bax, decreasing mitochondrial membrane potential, releasing cytochrome c from the mitochondria into the cytosol, activating caspase-3 and cleaving PARP.	Chloroquine	0-2	BCL2 associated X, apoptosis regulator	Homo sapiens	258-261
29658606-6	2018	CQ-mediated growth inhibition in A549 cells was characterized by the targeting of the PI3K/AKT pathway, thus, inducing mitochondria-mediated apoptosis at relatively higher concentrations by downregulating Bcl-2 expression, increasing the expression level of Bax, decreasing mitochondrial membrane potential, releasing cytochrome c from the mitochondria into the cytosol, activating caspase-3 and cleaving PARP.	Chloroquine	0-2	cytochrome c, somatic	Homo sapiens	318-330
29658606-6	2018	CQ-mediated growth inhibition in A549 cells was characterized by the targeting of the PI3K/AKT pathway, thus, inducing mitochondria-mediated apoptosis at relatively higher concentrations by downregulating Bcl-2 expression, increasing the expression level of Bax, decreasing mitochondrial membrane potential, releasing cytochrome c from the mitochondria into the cytosol, activating caspase-3 and cleaving PARP.	Chloroquine	0-2	caspase 3	Homo sapiens	382-391
29658606-6	2018	CQ-mediated growth inhibition in A549 cells was characterized by the targeting of the PI3K/AKT pathway, thus, inducing mitochondria-mediated apoptosis at relatively higher concentrations by downregulating Bcl-2 expression, increasing the expression level of Bax, decreasing mitochondrial membrane potential, releasing cytochrome c from the mitochondria into the cytosol, activating caspase-3 and cleaving PARP.	Chloroquine	0-2	collagen type XI alpha 2 chain	Homo sapiens	405-409
29928199-5	2018	While on chloroquine she developed extensive classic vitiligo.	Chloroquine	9-20	VAMAS6	Homo sapiens	53-61
29992145-10	2018	Treating the HeLa cells with EAEG together with Chloroquine (CQ) further accelerated LC3 conversion and p62 clearance, indicating that EAEG induced complete autophagy flux.	Chloroquine	48-59	microtubule associated protein 1 light chain 3 alpha	Homo sapiens	85-88
29992145-10	2018	Treating the HeLa cells with EAEG together with Chloroquine (CQ) further accelerated LC3 conversion and p62 clearance, indicating that EAEG induced complete autophagy flux.	Chloroquine	48-59	nucleoporin 62	Homo sapiens	104-107
29992145-10	2018	Treating the HeLa cells with EAEG together with Chloroquine (CQ) further accelerated LC3 conversion and p62 clearance, indicating that EAEG induced complete autophagy flux.	Chloroquine	61-63	microtubule associated protein 1 light chain 3 alpha	Homo sapiens	85-88
29992145-10	2018	Treating the HeLa cells with EAEG together with Chloroquine (CQ) further accelerated LC3 conversion and p62 clearance, indicating that EAEG induced complete autophagy flux.	Chloroquine	61-63	nucleoporin 62	Homo sapiens	104-107
29772762-9	2018	In humans, chloroquine treatment did not affect viremia or clinical parameters during the acute stage of the disease (D1 to D14), but affected the levels of C-reactive Protein (CRP), IFNalpha, IL-6, and MCP1 over time (D1 to D16).	Chloroquine	11-22	C-reactive protein	Homo sapiens	157-175
29772762-9	2018	In humans, chloroquine treatment did not affect viremia or clinical parameters during the acute stage of the disease (D1 to D14), but affected the levels of C-reactive Protein (CRP), IFNalpha, IL-6, and MCP1 over time (D1 to D16).	Chloroquine	11-22	C-reactive protein	Homo sapiens	177-180
29772762-9	2018	In humans, chloroquine treatment did not affect viremia or clinical parameters during the acute stage of the disease (D1 to D14), but affected the levels of C-reactive Protein (CRP), IFNalpha, IL-6, and MCP1 over time (D1 to D16).	Chloroquine	11-22	interferon alpha 1	Homo sapiens	183-191
29772762-9	2018	In humans, chloroquine treatment did not affect viremia or clinical parameters during the acute stage of the disease (D1 to D14), but affected the levels of C-reactive Protein (CRP), IFNalpha, IL-6, and MCP1 over time (D1 to D16).	Chloroquine	11-22	interleukin 6	Homo sapiens	193-197
29724354-9	2018	Trehalose administration to mice overexpressing GFP-tagged LC3 significantly increased the number of GFP-LC3 dots, both in the presence and absence of chloroquine administration.	Chloroquine	151-162	microtubule-associated protein 1 light chain 3 alpha	Mus musculus	59-62
29772762-9	2018	In humans, chloroquine treatment did not affect viremia or clinical parameters during the acute stage of the disease (D1 to D14), but affected the levels of C-reactive Protein (CRP), IFNalpha, IL-6, and MCP1 over time (D1 to D16).	Chloroquine	11-22	C-C motif chemokine ligand 2	Homo sapiens	203-207
30603055-1	2018	Chloroquine and hydroxychloroquine (HCQ) are robust inducers of the tumor suppressor Par-4 secretion from normal cells.	Chloroquine	0-11	Prader Willi/Angelman region RNA 4	Homo sapiens	85-90
29717979-3	2018	Here, we demonstrate that ATM-centered DNA damage response (DDR) progressively declines with senescence and age, while low dose of chloroquine (CQ) activates ATM, promotes DNA damage clearance, rescues age-related metabolic shift, and prolongs replicative lifespan.	Chloroquine	131-142	ataxia telangiectasia mutated	Mus musculus	158-161
29717979-3	2018	Here, we demonstrate that ATM-centered DNA damage response (DDR) progressively declines with senescence and age, while low dose of chloroquine (CQ) activates ATM, promotes DNA damage clearance, rescues age-related metabolic shift, and prolongs replicative lifespan.	Chloroquine	144-146	ataxia telangiectasia mutated	Mus musculus	158-161
29559198-4	2018	Indeed, CQ modifies amyloid precursor protein (APP) metabolism by precluding the release of amyloid-beta peptides (Abeta), which accumulate in the brain of Alzheimer patients to form the so-called amyloid plaques.	Chloroquine	8-10	amyloid beta precursor protein	Homo sapiens	20-45
29559198-4	2018	Indeed, CQ modifies amyloid precursor protein (APP) metabolism by precluding the release of amyloid-beta peptides (Abeta), which accumulate in the brain of Alzheimer patients to form the so-called amyloid plaques.	Chloroquine	8-10	amyloid beta precursor protein	Homo sapiens	115-120
29278657-8	2018	JAK2/STAT3 pathway was suppressed by PEITC, and further inhibited by 3-MA and CQ or Beclin-1 knock down, as a result of decreased expression of p-JAK2 and p-STAT3.	Chloroquine	78-80	Janus kinase 2	Homo sapiens	0-4
29735440-0	2018	[Chloroquine induces apoptosis of human hepatocellular carcinoma cells in vitro by miR-26b-mediated regulation of Mcl-1].	Chloroquine	1-12	microRNA 26b	Homo sapiens	83-90
29735440-0	2018	[Chloroquine induces apoptosis of human hepatocellular carcinoma cells in vitro by miR-26b-mediated regulation of Mcl-1].	Chloroquine	1-12	MCL1 apoptosis regulator, BCL2 family member	Homo sapiens	114-119
29735440-8	2018	At 80 micromol/L, chloroquine significantly increased the expression of miR-26b and down-regulated the expression of Mcl-1 in HepG2 cells, and the application of the miR-26b inhibitor increased the cellular expression of Mcl-1.	Chloroquine	18-29	microRNA 26b	Homo sapiens	72-79
29735440-8	2018	At 80 micromol/L, chloroquine significantly increased the expression of miR-26b and down-regulated the expression of Mcl-1 in HepG2 cells, and the application of the miR-26b inhibitor increased the cellular expression of Mcl-1.	Chloroquine	18-29	MCL1 apoptosis regulator, BCL2 family member	Homo sapiens	117-122
29735440-8	2018	At 80 micromol/L, chloroquine significantly increased the expression of miR-26b and down-regulated the expression of Mcl-1 in HepG2 cells, and the application of the miR-26b inhibitor increased the cellular expression of Mcl-1.	Chloroquine	18-29	MCL1 apoptosis regulator, BCL2 family member	Homo sapiens	221-226
29735440-9	2018	CONCLUSION: s Chloroquine can inhibit the cell proliferation, reduce ATP level and induce apoptosis in HepG2 cells possibly through miR-26b-mediated regulation of Mcl-1.	Chloroquine	14-25	microRNA 26b	Homo sapiens	132-139
29735440-9	2018	CONCLUSION: s Chloroquine can inhibit the cell proliferation, reduce ATP level and induce apoptosis in HepG2 cells possibly through miR-26b-mediated regulation of Mcl-1.	Chloroquine	14-25	MCL1 apoptosis regulator, BCL2 family member	Homo sapiens	163-168
29576625-2	2018	Previous studies suggest an increased dependency on glutaminolysis in IDH1/2 mutant cells, which resulted in clinical trials with the drugs CB-839, metformin and chloroquine.	Chloroquine	162-173	isocitrate dehydrogenase (NADP(+)) 1	Homo sapiens	70-74
29576625-9	2018	CONCLUSION: Targeting glutaminolysis with CB-839, metformin, phenformin or chloroquine is a potential therapeutic strategy for a subset of high-grade chondrosarcomas, irrespective of the presence or absence of an IDH1/2 mutation.	Chloroquine	75-86	isocitrate dehydrogenase (NADP(+)) 1	Homo sapiens	213-219
28884630-7	2018	The IL6 response was significantly inhibited by chloroquine (10 mug/mL), thereby confirming the important role for TLR9 in the response by macrophage cells.	Chloroquine	48-59	interleukin 6	Mus musculus	4-7
28884630-7	2018	The IL6 response was significantly inhibited by chloroquine (10 mug/mL), thereby confirming the important role for TLR9 in the response by macrophage cells.	Chloroquine	48-59	toll-like receptor 9	Mus musculus	115-119
29278657-8	2018	JAK2/STAT3 pathway was suppressed by PEITC, and further inhibited by 3-MA and CQ or Beclin-1 knock down, as a result of decreased expression of p-JAK2 and p-STAT3.	Chloroquine	78-80	signal transducer and activator of transcription 3	Homo sapiens	5-10
29278657-8	2018	JAK2/STAT3 pathway was suppressed by PEITC, and further inhibited by 3-MA and CQ or Beclin-1 knock down, as a result of decreased expression of p-JAK2 and p-STAT3.	Chloroquine	78-80	Janus kinase 2	Homo sapiens	146-150
29278657-8	2018	JAK2/STAT3 pathway was suppressed by PEITC, and further inhibited by 3-MA and CQ or Beclin-1 knock down, as a result of decreased expression of p-JAK2 and p-STAT3.	Chloroquine	78-80	signal transducer and activator of transcription 3	Homo sapiens	157-162
29128746-1	2018	Interactions between eight in-house synthesized aminoquinolines, along with well-known chloroquine, and human serum albumin (HSA) have been studied by fluorescence spectroscopy.	Chloroquine	87-98	albumin	Homo sapiens	110-123
29476739-5	2018	Furthermore, suppression of autophagy with chloroquine (CQ) or 3-MA could significantly attenuate the enhanced osteoclastogenesis by a low level of IL-17A.	Chloroquine	43-54	interleukin 17A	Homo sapiens	148-154
29476739-5	2018	Furthermore, suppression of autophagy with chloroquine (CQ) or 3-MA could significantly attenuate the enhanced osteoclastogenesis by a low level of IL-17A.	Chloroquine	56-58	interleukin 17A	Homo sapiens	148-154
29330041-5	2018	Western blot analysis showed a significant decrease of total KCa2.2 protein content in GZ-treated slices which could be rescued by concomitant incubation with MG132 and CQ.	Chloroquine	169-171	potassium calcium-activated channel subfamily N member 2	Homo sapiens	61-67
29330041-7	2018	We then recorded epileptiform afterdischarges at hippocampal Schaffer collateral-CA1 synapses and confirmed that the GZ-induced increase was significantly attenuated by both MG132 and CQ, with MG132 being significantly more effective than CQ.	Chloroquine	184-186	carbonic anhydrase 1	Homo sapiens	81-84
29513749-0	2018	Chloroquine augments TRAIL-induced apoptosis and induces G2/M phase arrest in human pancreatic cancer cells.	Chloroquine	0-11	TNF superfamily member 10	Homo sapiens	21-26
29513749-10	2018	Also, CQ increased the p21 level but reduced that of cyclin B1.	Chloroquine	6-8	H3 histone pseudogene 16	Homo sapiens	23-26
29513749-10	2018	Also, CQ increased the p21 level but reduced that of cyclin B1.	Chloroquine	6-8	cyclin B1	Homo sapiens	53-62
29061481-6	2018	Inhibiting autophagy with chloroquine (CQ) and 3-Methyladenine (3-MA) significantly augmented palmitate-induced PBMCs apoptotic death as demonstrated by increased cleaved PARP level and increased the percentage of apoptotic (YO-PRO-1 positive and PI negative) cells.	Chloroquine	26-37	collagen type XI alpha 2 chain	Homo sapiens	171-175
29061481-6	2018	Inhibiting autophagy with chloroquine (CQ) and 3-Methyladenine (3-MA) significantly augmented palmitate-induced PBMCs apoptotic death as demonstrated by increased cleaved PARP level and increased the percentage of apoptotic (YO-PRO-1 positive and PI negative) cells.	Chloroquine	26-37	lamin A/C	Homo sapiens	228-233
29061481-6	2018	Inhibiting autophagy with chloroquine (CQ) and 3-Methyladenine (3-MA) significantly augmented palmitate-induced PBMCs apoptotic death as demonstrated by increased cleaved PARP level and increased the percentage of apoptotic (YO-PRO-1 positive and PI negative) cells.	Chloroquine	39-41	collagen type XI alpha 2 chain	Homo sapiens	171-175
29061481-6	2018	Inhibiting autophagy with chloroquine (CQ) and 3-Methyladenine (3-MA) significantly augmented palmitate-induced PBMCs apoptotic death as demonstrated by increased cleaved PARP level and increased the percentage of apoptotic (YO-PRO-1 positive and PI negative) cells.	Chloroquine	39-41	lamin A/C	Homo sapiens	228-233
29061481-7	2018	Furthermore, CQ pretreatment exacerbated palmitate-induced TNF-alpha and IL-6 mRNA expression in PBMCs.	Chloroquine	13-15	tumor necrosis factor	Homo sapiens	59-68
29061481-7	2018	Furthermore, CQ pretreatment exacerbated palmitate-induced TNF-alpha and IL-6 mRNA expression in PBMCs.	Chloroquine	13-15	interleukin 6	Homo sapiens	73-77
28259568-0	2018	Chloroquine improves the response to ischemic muscle injury and increases HMGB1 after arterial ligation.	Chloroquine	0-11	high mobility group box 1	Mus musculus	74-79
29874341-0	2018	Inhibitory effect of chloroquine derivatives on presenilin 1 and ubiquilin 1 expression in Alzheimer"s disease [Retraction].	Chloroquine	21-32	presenilin 1	Homo sapiens	48-60
29874341-0	2018	Inhibitory effect of chloroquine derivatives on presenilin 1 and ubiquilin 1 expression in Alzheimer"s disease [Retraction].	Chloroquine	21-32	ubiquilin 1	Homo sapiens	65-76
28259568-4	2018	Specifically, we investigated how chloroquine (CQ), a commonly employed disease-modifying antirheumatic drug, promotes HMGB1 release from muscle.	Chloroquine	34-45	high mobility group box 1	Mus musculus	119-124
28259568-4	2018	Specifically, we investigated how chloroquine (CQ), a commonly employed disease-modifying antirheumatic drug, promotes HMGB1 release from muscle.	Chloroquine	47-49	high mobility group box 1	Mus musculus	119-124
28259568-5	2018	We hypothesized that CQ could increase HMGB1 locally and systemically, allowing it to mediate recovery from ischemic injury.	Chloroquine	21-23	high mobility group box 1	Mus musculus	39-44
28259568-16	2018	CQ-treated mice had elevated serum HMGB1 and diffuse HMGB1 staining in muscle (P &lt; .01).	Chloroquine	0-2	high mobility group box 1	Mus musculus	35-40
28259568-16	2018	CQ-treated mice had elevated serum HMGB1 and diffuse HMGB1 staining in muscle (P &lt; .01).	Chloroquine	0-2	high mobility group box 1	Mus musculus	53-58
28259568-18	2018	In cultured myoblasts, CQ induced autophagosome accumulation, inhibited p62/SQSTM-1 degradation, and activated caspase-1.	Chloroquine	23-25	sequestosome 1	Mus musculus	72-75
28259568-18	2018	In cultured myoblasts, CQ induced autophagosome accumulation, inhibited p62/SQSTM-1 degradation, and activated caspase-1.	Chloroquine	23-25	sequestosome 1	Mus musculus	76-83
28259568-18	2018	In cultured myoblasts, CQ induced autophagosome accumulation, inhibited p62/SQSTM-1 degradation, and activated caspase-1.	Chloroquine	23-25	caspase 1	Mus musculus	111-120
28259568-20	2018	Our in vivo data suggest that HMGB1 mobilization into the sarcoplasm and serum can be increased with CQ, possibly through caspase-1-mediated pathways.	Chloroquine	101-103	high mobility group box 1	Mus musculus	30-35
28259568-20	2018	Our in vivo data suggest that HMGB1 mobilization into the sarcoplasm and serum can be increased with CQ, possibly through caspase-1-mediated pathways.	Chloroquine	101-103	caspase 1	Mus musculus	122-131
29435010-5	2018	The inhibition of autophagy by CQ enhanced sunitinib-induced apoptosis, which was characterized by the activation of caspase-3, caspase-9, Bcl-2 and p53.	Chloroquine	31-33	caspase 3	Homo sapiens	117-126
29286127-6	2018	Furthermore, it was demonstrated that autophagy activation enhanced the TGF-beta2-induced EMT process in ARPE-19 cells, and inhibition of autophagy by chloroquine administration attenuated TGF-beta2-induced EMT, which was determined by analyzing the expression of mesenchymal and epithelial markers by reverse transcription-quantitative polymerase chain reaction and/or western blotting.	Chloroquine	151-162	transforming growth factor beta 2	Homo sapiens	189-198
29435951-7	2018	Autophagy was up-regulated while inhibition of lysosomal functions by chloroquine impaired the genistein-mediated degradation of the mutated huntingtin aggregates.	Chloroquine	70-81	huntingtin	Homo sapiens	141-151
29435010-5	2018	The inhibition of autophagy by CQ enhanced sunitinib-induced apoptosis, which was characterized by the activation of caspase-3, caspase-9, Bcl-2 and p53.	Chloroquine	31-33	caspase 9	Homo sapiens	128-137
29435010-5	2018	The inhibition of autophagy by CQ enhanced sunitinib-induced apoptosis, which was characterized by the activation of caspase-3, caspase-9, Bcl-2 and p53.	Chloroquine	31-33	BCL2 apoptosis regulator	Homo sapiens	139-144
29435010-5	2018	The inhibition of autophagy by CQ enhanced sunitinib-induced apoptosis, which was characterized by the activation of caspase-3, caspase-9, Bcl-2 and p53.	Chloroquine	31-33	tumor protein p53	Homo sapiens	149-152
29435010-6	2018	Additionally, the exposure of OS-RC-2 cells to CQ and sunitinib resulted in the inhibition of AKT, tuberous sclerosis complex 2, mechanistic target of rapamycin and p70 ribosomal S6 kinase, which are associated with cell proliferation.	Chloroquine	47-49	AKT serine/threonine kinase 1	Homo sapiens	94-97
29445224-10	2018	The experiments inferred that the combination of NBT and CQ significantly promoted MCF-7 cell mitochondria to divide and Cyt C to be released from mitochondria to the cytoplasm, resulting in an increased apoptosis rate.	Chloroquine	57-59	cytochrome c, somatic	Homo sapiens	121-126
29491374-3	2018	Mechanistically, CQ increases macrophage lysosomal pH, causing Ca2+ release via the lysosomal Ca2+ channel mucolipin-1 (Mcoln1), which induces the activation of p38 and NF-kappaB, thus polarizing TAMs to M1 phenotype.	Chloroquine	17-19	mucolipin TRP cation channel 1	Homo sapiens	107-118
29491374-3	2018	Mechanistically, CQ increases macrophage lysosomal pH, causing Ca2+ release via the lysosomal Ca2+ channel mucolipin-1 (Mcoln1), which induces the activation of p38 and NF-kappaB, thus polarizing TAMs to M1 phenotype.	Chloroquine	17-19	mucolipin TRP cation channel 1	Homo sapiens	120-126
29491374-3	2018	Mechanistically, CQ increases macrophage lysosomal pH, causing Ca2+ release via the lysosomal Ca2+ channel mucolipin-1 (Mcoln1), which induces the activation of p38 and NF-kappaB, thus polarizing TAMs to M1 phenotype.	Chloroquine	17-19	mitogen-activated protein kinase 14	Homo sapiens	161-164
29491374-3	2018	Mechanistically, CQ increases macrophage lysosomal pH, causing Ca2+ release via the lysosomal Ca2+ channel mucolipin-1 (Mcoln1), which induces the activation of p38 and NF-kappaB, thus polarizing TAMs to M1 phenotype.	Chloroquine	17-19	nuclear factor kappa B subunit 1	Homo sapiens	169-178
31805001-8	2018	RESULTS: IL-17A production was enhanced from mouse PBMCs cultured with EBV DNA; pre-incubation of PBMCs with chloroquine significantly reduced its production.	Chloroquine	109-120	interleukin 17A	Mus musculus	9-15
29449537-10	2018	In addition, in vivo experiments demonstrated that AMPK activation status was negatively related to HCC occurrence and blocking autophagy by chloroquine counteracted the protective effect of AMPK phosphorylation.	Chloroquine	141-152	protein kinase AMP-activated catalytic subunit alpha 1	Homo sapiens	191-195
29416002-5	2018	Moreover, when compared with counterparts, chloroquine alone, or chloroquine with rapamycin treatment led to more LC3II accumulation in EZH2 inhibited or knockdown VSMCs, which indicated that EZH2 negatively regulated autophagosome formation.	Chloroquine	43-54	enhancer of zeste 2 polycomb repressive complex 2 subunit	Homo sapiens	136-140
29416002-5	2018	Moreover, when compared with counterparts, chloroquine alone, or chloroquine with rapamycin treatment led to more LC3II accumulation in EZH2 inhibited or knockdown VSMCs, which indicated that EZH2 negatively regulated autophagosome formation.	Chloroquine	43-54	enhancer of zeste 2 polycomb repressive complex 2 subunit	Homo sapiens	192-196
29416002-5	2018	Moreover, when compared with counterparts, chloroquine alone, or chloroquine with rapamycin treatment led to more LC3II accumulation in EZH2 inhibited or knockdown VSMCs, which indicated that EZH2 negatively regulated autophagosome formation.	Chloroquine	65-76	enhancer of zeste 2 polycomb repressive complex 2 subunit	Homo sapiens	136-140
29416002-5	2018	Moreover, when compared with counterparts, chloroquine alone, or chloroquine with rapamycin treatment led to more LC3II accumulation in EZH2 inhibited or knockdown VSMCs, which indicated that EZH2 negatively regulated autophagosome formation.	Chloroquine	65-76	enhancer of zeste 2 polycomb repressive complex 2 subunit	Homo sapiens	192-196
29212659-5	2018	We highlight the physiological significance of this pathway with the demonstration that an increase in plasma levels of FABP4 is inhibited by chloroquine treatment of mice.	Chloroquine	142-153	fatty acid binding protein 4, adipocyte	Mus musculus	120-125
29926670-10	2018	Compared with ethanol group, addition of CQ increased furtherthe level of LC3-IIexpression, and TG amount, serum AST and ALT activities, and the expression of NF-kappaB p65, TNF-alphaand IL-6.	Chloroquine	41-43	microtubule-associated protein 1 light chain 3 alpha	Mus musculus	74-77
29926670-10	2018	Compared with ethanol group, addition of CQ increased furtherthe level of LC3-IIexpression, and TG amount, serum AST and ALT activities, and the expression of NF-kappaB p65, TNF-alphaand IL-6.	Chloroquine	41-43	solute carrier family 17 (anion/sugar transporter), member 5	Mus musculus	113-116
29926670-10	2018	Compared with ethanol group, addition of CQ increased furtherthe level of LC3-IIexpression, and TG amount, serum AST and ALT activities, and the expression of NF-kappaB p65, TNF-alphaand IL-6.	Chloroquine	41-43	glutamic pyruvic transaminase, soluble	Mus musculus	121-124
29926670-10	2018	Compared with ethanol group, addition of CQ increased furtherthe level of LC3-IIexpression, and TG amount, serum AST and ALT activities, and the expression of NF-kappaB p65, TNF-alphaand IL-6.	Chloroquine	41-43	nuclear factor of kappa light polypeptide gene enhancer in B cells 1, p105	Mus musculus	159-168
29926670-10	2018	Compared with ethanol group, addition of CQ increased furtherthe level of LC3-IIexpression, and TG amount, serum AST and ALT activities, and the expression of NF-kappaB p65, TNF-alphaand IL-6.	Chloroquine	41-43	v-rel reticuloendotheliosis viral oncogene homolog A (avian)	Mus musculus	169-172
29926670-10	2018	Compared with ethanol group, addition of CQ increased furtherthe level of LC3-IIexpression, and TG amount, serum AST and ALT activities, and the expression of NF-kappaB p65, TNF-alphaand IL-6.	Chloroquine	41-43	interleukin 6	Mus musculus	187-191
29100748-6	2018	Notably, inhibition of autophagy in NaF-treated SH-SY5Y cells with Wortmannin or Chloroquine decreased, while induction of autophagy by Rapamycin increased the cell viability.	Chloroquine	81-92	C-X-C motif chemokine ligand 8	Homo sapiens	36-39
29496180-18	2018	The early LC3 lipidation induced by d-limonene is associated with inhibition of clonogenic capacity which is reverted by the autophagy inhibitor chloroquine.	Chloroquine	145-156	microtubule associated protein 1 light chain 3 alpha	Homo sapiens	10-13
28518408-6	2018	We also evaluated the combination of AdoMet and the autophagy inhibitor chloroquine (CLC) showing that autophagy block is synergistic in inducing both growth inhibition and apoptosis.	Chloroquine	72-83	Charcot-Leyden crystal galectin	Homo sapiens	85-88
28815720-3	2018	Chloroquine stimulates neuronal nitric oxide synthase (nNOS) activity to over-producing NO in the skin.	Chloroquine	0-11	nitric oxide synthase 1, neuronal	Mus musculus	55-59
28815720-11	2018	Intraperitoneal and intradermal sumatriptan attenuates CQ-induced itch which reversed by GR-127935, the selective 5-HTR1b and 5-HTR1d antagonist.	Chloroquine	55-57	5-hydroxytryptamine (serotonin) receptor 1D	Mus musculus	128-133
28815720-15	2018	We concluded that sumatriptan suppresses CQ-induced itch most likely by activating 5-HT1b/1d receptors.	Chloroquine	41-43	5-hydroxytryptamine (serotonin) receptor 1B	Mus musculus	83-89
29133031-0	2018	Chloroquine upregulates TRAIL/TRAILR2 expression and potentiates doxorubicin anti-tumor activity in thioacetamide-induced hepatocellular carcinoma model.	Chloroquine	0-11	TNF superfamily member 10	Rattus norvegicus	24-29
29352194-8	2018	3-methyladenine (3-MA) and chloroquine (CQ)-mediated inhibition of autophagy partially reversed the anti-senescent and anti-apoptotic effects of sirt6, which regulated the expression of degeneration-associated proteins.	Chloroquine	27-38	sirtuin 6	Homo sapiens	145-150
29352194-8	2018	3-methyladenine (3-MA) and chloroquine (CQ)-mediated inhibition of autophagy partially reversed the anti-senescent and anti-apoptotic effects of sirt6, which regulated the expression of degeneration-associated proteins.	Chloroquine	40-42	sirtuin 6	Homo sapiens	145-150
29133031-3	2018	This study aimed to evaluate chloroquine"s (CQ) ability to trigger TRAIL/TRAILR2 apoptotic pathway in thioacetamide (TAA)-induced hepatocellular carcinoma (HCC) either alone or in combination with doxorubicin (DOX).	Chloroquine	29-40	TNF superfamily member 10	Rattus norvegicus	67-72
29133031-3	2018	This study aimed to evaluate chloroquine"s (CQ) ability to trigger TRAIL/TRAILR2 apoptotic pathway in thioacetamide (TAA)-induced hepatocellular carcinoma (HCC) either alone or in combination with doxorubicin (DOX).	Chloroquine	44-46	TNF superfamily member 10	Rattus norvegicus	67-72
29133031-11	2018	CQ improved liver functions, reduced AFP level and attenuated HCC progression.	Chloroquine	0-2	alpha-fetoprotein	Rattus norvegicus	37-40
29133031-12	2018	CQ induced apoptosis via upregulation of TRAIL/TRAILR2, caspase-8, caspase-3 and caspase-8 genes and downregulation of BCL-2 gene.	Chloroquine	0-2	TNF superfamily member 10	Rattus norvegicus	41-46
29133031-12	2018	CQ induced apoptosis via upregulation of TRAIL/TRAILR2, caspase-8, caspase-3 and caspase-8 genes and downregulation of BCL-2 gene.	Chloroquine	0-2	caspase 8	Rattus norvegicus	56-65
29133031-12	2018	CQ induced apoptosis via upregulation of TRAIL/TRAILR2, caspase-8, caspase-3 and caspase-8 genes and downregulation of BCL-2 gene.	Chloroquine	0-2	caspase 3	Rattus norvegicus	67-76
29133031-12	2018	CQ induced apoptosis via upregulation of TRAIL/TRAILR2, caspase-8, caspase-3 and caspase-8 genes and downregulation of BCL-2 gene.	Chloroquine	0-2	caspase 8	Rattus norvegicus	81-90
29133031-12	2018	CQ induced apoptosis via upregulation of TRAIL/TRAILR2, caspase-8, caspase-3 and caspase-8 genes and downregulation of BCL-2 gene.	Chloroquine	0-2	BCL2, apoptosis regulator	Rattus norvegicus	119-124
29316551-12	2018	A combination of radiation and chloroquine enhanced the apoptosis rate of EJ and T24 cells and down-regulated the expression of Bcl-2 while up-regulating the expression of caspase-3.	Chloroquine	31-42	BCL2 apoptosis regulator	Homo sapiens	128-133
29552291-6	2018	And, inhibition of autophagy by Chloroquine attenuates excessive inflammatory response in the DSS-induced colitis mouse model of Erbin deletion.	Chloroquine	32-43	Erbb2 interacting protein	Mus musculus	129-134
29316551-12	2018	A combination of radiation and chloroquine enhanced the apoptosis rate of EJ and T24 cells and down-regulated the expression of Bcl-2 while up-regulating the expression of caspase-3.	Chloroquine	31-42	caspase 3	Homo sapiens	172-181
28945004-6	2018	The results of transfection with a tandem mRFP-GFP-LC3 adenovirus and use of an autophagic flux inhibitor chloroquine both suggested that TLR3 in cardiomyocytes promotes autophagy induction without affecting autophagic flux.	Chloroquine	106-117	toll-like receptor 3	Mus musculus	138-142
29066501-4	2018	Interestingly, the autophagy blocker chloroquine enhanced cisplatin in BRCA2-silenced cells accompanied by an increase in apoptotic cells, which did not occur in BRCA2-intact cells; chloroquine enhanced the efficacy of cisplatin against BRCA2-silenced CAOV-3 tumors in vivo, with an increase in LC3-II level in tumor tissues.	Chloroquine	37-48	BRCA2 DNA repair associated	Homo sapiens	71-76
29066501-5	2018	Sensitization of cisplatin was also observed in BRCA2-silenced CAOV-3 cells after inhibiting ATG7, confirming that chloroquine modulated the sensitivity via the autophagy pathway.	Chloroquine	115-126	BRCA2 DNA repair associated	Homo sapiens	48-53
29066501-5	2018	Sensitization of cisplatin was also observed in BRCA2-silenced CAOV-3 cells after inhibiting ATG7, confirming that chloroquine modulated the sensitivity via the autophagy pathway.	Chloroquine	115-126	autophagy related 7	Homo sapiens	93-97
28776937-2	2018	Systematic evaluation is performed to test the hypothesis that presence of chloroquine (CQ) in the PDC structure will improve miRNA delivery due to enhanced endosomal escape while simultaneously contribute to anticancer activity of PDC/miRNA polyplexes through inhibition of cancer cell migration.	Chloroquine	75-86	phosducin	Homo sapiens	99-102
28569402-10	2018	In addition, we also observed that autophagy was activated in LRWD1 deficient cells and inhibition of autophagy by chloroquine or bafilomycin A1 promoted cell death when LRWD1 was depleted.	Chloroquine	115-126	leucine rich repeats and WD repeat domain containing 1	Homo sapiens	170-175
28776937-2	2018	Systematic evaluation is performed to test the hypothesis that presence of chloroquine (CQ) in the PDC structure will improve miRNA delivery due to enhanced endosomal escape while simultaneously contribute to anticancer activity of PDC/miRNA polyplexes through inhibition of cancer cell migration.	Chloroquine	75-86	phosducin	Homo sapiens	232-235
28776937-2	2018	Systematic evaluation is performed to test the hypothesis that presence of chloroquine (CQ) in the PDC structure will improve miRNA delivery due to enhanced endosomal escape while simultaneously contribute to anticancer activity of PDC/miRNA polyplexes through inhibition of cancer cell migration.	Chloroquine	88-90	phosducin	Homo sapiens	99-102
28776937-2	2018	Systematic evaluation is performed to test the hypothesis that presence of chloroquine (CQ) in the PDC structure will improve miRNA delivery due to enhanced endosomal escape while simultaneously contribute to anticancer activity of PDC/miRNA polyplexes through inhibition of cancer cell migration.	Chloroquine	88-90	phosducin	Homo sapiens	232-235
29422973-7	2018	Protein expression of the endogenous autophagy markers LC3-II and p62 was elevated subsequent to CQ treatment, whereas the expression of proteins from the protein kinase B/mechanistic target of rapamycin target of rapamycin pathway was inhibited.	Chloroquine	97-99	nucleoporin 62	Homo sapiens	66-69
28986232-5	2017	Here, we demonstrate that rifampicin pretreatment alleviated rotenone induced release of IL-1beta and IL-6, and its effects were suppressed when autophagy was inhibited by chloroquine.	Chloroquine	172-183	interleukin 6	Mus musculus	102-106
28649025-5	2017	Most importantly, CQ probe displays unambiguous selectivity towards Abeta aggregates compared to other toxic protein aggregates such as tau, alpha-synuclein (alpha-Syn) and islet amyloid polypeptide (IAPP).	Chloroquine	18-20	synuclein alpha	Homo sapiens	158-167
28649025-5	2017	Most importantly, CQ probe displays unambiguous selectivity towards Abeta aggregates compared to other toxic protein aggregates such as tau, alpha-synuclein (alpha-Syn) and islet amyloid polypeptide (IAPP).	Chloroquine	18-20	islet amyloid polypeptide	Homo sapiens	200-204
29064954-0	2017	MrgprA3 shows sensitization to chloroquine in an acetone-ether-water mice model.	Chloroquine	31-42	MAS-related GPR, member A3	Mus musculus	0-7
29064954-7	2017	The results showed that the scratching bouts induced by chloroquine increased significantly under the AEW condition; the density of MrgprA3 sensory fibers in the AEW-treated skin area and the number of MrgprA3 neurons in dorsal root ganglia from the AEW model mice also increased significantly.	Chloroquine	56-67	MAS-related GPR, member A3	Mus musculus	202-209
29174535-8	2017	Furthermore, the CVs of AUC/Dose of the CYP2C8 substrates loperamide and chloroquine, which are affected by renal clearance, were also successfully predicted.	Chloroquine	73-84	cytochrome P450 family 2 subfamily C member 8	Homo sapiens	40-46
29290967-0	2017	Modelling the effects of chloroquine on KCNJ2-linked short QT syndrome.	Chloroquine	25-36	potassium inwardly rectifying channel subfamily J member 2	Homo sapiens	40-45
29128812-11	2017	Our finding of qRT-PCR analysis also show that the expression of Kcnj8 is decreased after CQ injection.	Chloroquine	90-92	potassium inwardly-rectifying channel, subfamily J, member 8	Mus musculus	65-70
29382424-5	2017	The apoptotic protease caspase-3 and substrate PARP were obviously degraded, which could be enhanced by 3-MA but inhibited by CQ.	Chloroquine	126-128	caspase 3	Homo sapiens	23-32
29382424-5	2017	The apoptotic protease caspase-3 and substrate PARP were obviously degraded, which could be enhanced by 3-MA but inhibited by CQ.	Chloroquine	126-128	poly(ADP-ribose) polymerase 1	Homo sapiens	47-51
29290967-2	2017	Anti-malarial drug chloroquine was reported as an effective inhibitor of Kir2.1 channels.	Chloroquine	19-30	potassium inwardly rectifying channel subfamily J member 2	Homo sapiens	73-79
29290967-3	2017	Using biophysically-detailed human ventricle computer models, this study assessed the effects of chloroquine on SQT3.	Chloroquine	97-108	potassium inwardly rectifying channel subfamily J member 2	Homo sapiens	112-116
29290967-9	2017	It was shown that chloroquine caused a dose-dependent reduction in IK1, prolonged APD, and decreased the maximum voltage heterogeneity.	Chloroquine	18-29	IKAROS family zinc finger 1	Homo sapiens	67-70
29290967-13	2017	In conclusion, the results of this study provide new evidence that the anti-arrhythmic effects of chloroquine on SQT3 and, by extension, to the possibility that chloroquine may be a potential therapeutic agent for SQT3 treatment.	Chloroquine	98-109	potassium inwardly rectifying channel subfamily J member 2	Homo sapiens	113-117
29290967-13	2017	In conclusion, the results of this study provide new evidence that the anti-arrhythmic effects of chloroquine on SQT3 and, by extension, to the possibility that chloroquine may be a potential therapeutic agent for SQT3 treatment.	Chloroquine	98-109	potassium inwardly rectifying channel subfamily J member 2	Homo sapiens	214-218
29290967-13	2017	In conclusion, the results of this study provide new evidence that the anti-arrhythmic effects of chloroquine on SQT3 and, by extension, to the possibility that chloroquine may be a potential therapeutic agent for SQT3 treatment.	Chloroquine	161-172	potassium inwardly rectifying channel subfamily J member 2	Homo sapiens	214-218
28757413-12	2017	MiR-30a expression was found to downregulate Beclin1 expression and inhibit autophagy in the medulloblastoma cell lines as judged by downregulation of LC3B expression and its turnover upon chloroquine treatment and starvation induced autophagy induction.	Chloroquine	189-200	microRNA 30a	Homo sapiens	0-7
28150518-7	2017	CONCLUSION: These results suggest that chloroquine attenuates mesangial TLR3 signaling in the early phase of NF-kappaB activation.	Chloroquine	39-50	toll like receptor 3	Homo sapiens	72-76
28150518-7	2017	CONCLUSION: These results suggest that chloroquine attenuates mesangial TLR3 signaling in the early phase of NF-kappaB activation.	Chloroquine	39-50	nuclear factor kappa B subunit 1	Homo sapiens	109-118
29200947-10	2017	HSPB8 overexpression can partly rescue the blocking of the autophagy flux with chloroquine through the reduction of p62 expression level.	Chloroquine	79-90	heat shock protein 8	Mus musculus	0-5
29200947-10	2017	HSPB8 overexpression can partly rescue the blocking of the autophagy flux with chloroquine through the reduction of p62 expression level.	Chloroquine	79-90	nucleoporin 62	Mus musculus	116-119
28978341-5	2017	METHODS: MDR1 antibody-modified chitosan nanoparticles loading gefitinib and autophagy inhibitor chloroquine were prepared by ionic crosslinking and electrostatic attracting method.	Chloroquine	97-108	ATP binding cassette subfamily B member 1	Homo sapiens	9-13
28978341-8	2017	RESULTS: mAb MDR1-modified CS NPs, when combined with the co-delivery of gefitinib and chloroquine, showed targeting and therapeutic potential on enhancing the delivery of anticancer drugs and inducing significant cell apoptosis against acquired EGFR-TKI resistance through the modulation of autophagy and while blocking the activity of the MDR1 receptor.	Chloroquine	87-98	ATP binding cassette subfamily B member 1	Homo sapiens	13-17
28978341-8	2017	RESULTS: mAb MDR1-modified CS NPs, when combined with the co-delivery of gefitinib and chloroquine, showed targeting and therapeutic potential on enhancing the delivery of anticancer drugs and inducing significant cell apoptosis against acquired EGFR-TKI resistance through the modulation of autophagy and while blocking the activity of the MDR1 receptor.	Chloroquine	87-98	epidermal growth factor receptor	Homo sapiens	246-250
28978341-8	2017	RESULTS: mAb MDR1-modified CS NPs, when combined with the co-delivery of gefitinib and chloroquine, showed targeting and therapeutic potential on enhancing the delivery of anticancer drugs and inducing significant cell apoptosis against acquired EGFR-TKI resistance through the modulation of autophagy and while blocking the activity of the MDR1 receptor.	Chloroquine	87-98	ATP binding cassette subfamily B member 1	Homo sapiens	341-345
28973192-8	2017	Addition of CQ to low-dose CAB blocked normal autophagic cycles and induced apoptosis, evidenced by the further accumulation of p62/caspase-8/LC3-II.	Chloroquine	12-14	nucleoporin 62	Homo sapiens	128-131
28973192-8	2017	Addition of CQ to low-dose CAB blocked normal autophagic cycles and induced apoptosis, evidenced by the further accumulation of p62/caspase-8/LC3-II.	Chloroquine	12-14	caspase 8	Homo sapiens	132-141
28757323-4	2017	H9c2s cells were incubated with purified mtDNA or nuclear DNA with or without pretreatment by chloroquine, an inhibitor of Toll-like receptor 9(TLR9).	Chloroquine	94-105	toll-like receptor 9	Rattus norvegicus	144-148
28945807-10	2017	Notably, chloroquine activated the mitochondrial cell death pathway as indicated by increase in caspase 9 activity.	Chloroquine	9-20	caspase 9	Homo sapiens	96-105
28649695-8	2017	A few aromatase neurons express Fos after cheek injection of capsaicin, formalin, or chloroquine.	Chloroquine	85-96	cytochrome P450 family 19 subfamily A member 1	Homo sapiens	6-15
28649695-8	2017	A few aromatase neurons express Fos after cheek injection of capsaicin, formalin, or chloroquine.	Chloroquine	85-96	Fos proto-oncogene, AP-1 transcription factor subunit	Homo sapiens	32-35
28150518-0	2017	Chloroquine attenuates TLR3/IFN-beta signaling in cultured normal human mesangial cells: A possible protective effect against renal damage in lupus nephritis.	Chloroquine	0-11	toll like receptor 3	Homo sapiens	23-27
28150518-0	2017	Chloroquine attenuates TLR3/IFN-beta signaling in cultured normal human mesangial cells: A possible protective effect against renal damage in lupus nephritis.	Chloroquine	0-11	interferon beta 1	Homo sapiens	28-36
28150518-3	2017	METHODS: We examined chloroquine effect on the representative TLR3/IFN-beta-signaling axis, TLR3/IFN-beta/retinoic acid-inducible gene-I (RIG-I)/CCL5 in MCs treated with polyinosinic-polycytidylic acid (poly IC), a synthetic viral dsRNA analog and analyzed the expression of these molecules using reverse transcriptase-polymerase chain reaction and enzyme-linked immunosorbent assay (ELISA).	Chloroquine	21-32	toll like receptor 3	Homo sapiens	62-66
28150518-3	2017	METHODS: We examined chloroquine effect on the representative TLR3/IFN-beta-signaling axis, TLR3/IFN-beta/retinoic acid-inducible gene-I (RIG-I)/CCL5 in MCs treated with polyinosinic-polycytidylic acid (poly IC), a synthetic viral dsRNA analog and analyzed the expression of these molecules using reverse transcriptase-polymerase chain reaction and enzyme-linked immunosorbent assay (ELISA).	Chloroquine	21-32	interferon beta 1	Homo sapiens	67-75
28150518-5	2017	RESULTS: Pretreatment of cells with chloroquine attenuated IFN-beta, RIG-I and CCL5 expression and phosphorylation of STAT1 induced by poly IC, but not IFN-beta-induced phosphorylation of STAT1 and RIG-I expression induced by IFN-beta.	Chloroquine	36-47	interferon beta 1	Homo sapiens	59-67
28150518-5	2017	RESULTS: Pretreatment of cells with chloroquine attenuated IFN-beta, RIG-I and CCL5 expression and phosphorylation of STAT1 induced by poly IC, but not IFN-beta-induced phosphorylation of STAT1 and RIG-I expression induced by IFN-beta.	Chloroquine	36-47	DExD/H-box helicase 58	Homo sapiens	69-74
28150518-5	2017	RESULTS: Pretreatment of cells with chloroquine attenuated IFN-beta, RIG-I and CCL5 expression and phosphorylation of STAT1 induced by poly IC, but not IFN-beta-induced phosphorylation of STAT1 and RIG-I expression induced by IFN-beta.	Chloroquine	36-47	C-C motif chemokine ligand 5	Homo sapiens	79-83
28150518-5	2017	RESULTS: Pretreatment of cells with chloroquine attenuated IFN-beta, RIG-I and CCL5 expression and phosphorylation of STAT1 induced by poly IC, but not IFN-beta-induced phosphorylation of STAT1 and RIG-I expression induced by IFN-beta.	Chloroquine	36-47	signal transducer and activator of transcription 1	Homo sapiens	118-123
28150518-5	2017	RESULTS: Pretreatment of cells with chloroquine attenuated IFN-beta, RIG-I and CCL5 expression and phosphorylation of STAT1 induced by poly IC, but not IFN-beta-induced phosphorylation of STAT1 and RIG-I expression induced by IFN-beta.	Chloroquine	36-47	signal transducer and activator of transcription 1	Homo sapiens	188-193
28150518-5	2017	RESULTS: Pretreatment of cells with chloroquine attenuated IFN-beta, RIG-I and CCL5 expression and phosphorylation of STAT1 induced by poly IC, but not IFN-beta-induced phosphorylation of STAT1 and RIG-I expression induced by IFN-beta.	Chloroquine	36-47	DExD/H-box helicase 58	Homo sapiens	198-203
28150518-6	2017	Knockdown of p65 inhibited the poly IC-induced IFN-beta expression, and chloroquine pretreatment decreased the nuclear poly IC-induced translocation of NF-kappaB p65 in MCs.	Chloroquine	72-83	nuclear factor kappa B subunit 1	Homo sapiens	152-161
28150518-6	2017	Knockdown of p65 inhibited the poly IC-induced IFN-beta expression, and chloroquine pretreatment decreased the nuclear poly IC-induced translocation of NF-kappaB p65 in MCs.	Chloroquine	72-83	RELA proto-oncogene, NF-kB subunit	Homo sapiens	162-165
28849182-8	2017	Chloroquine also disrupted the cell cycle, resulting in the cell cycle arrest of CAL27 and SCC25 cells at G0/G1 phase, via downregulation of cyclin D1.	Chloroquine	0-11	cyclin D1	Homo sapiens	141-150
29078276-6	2017	Similar to BECN1, targeting other autophagy genes, such as ATG5, p62/SQSTM1, or inhibiting autophagy pharmacologically by chloroquine, also induced the expression of CCL5 in melanoma cells.	Chloroquine	122-133	C-C motif chemokine ligand 5	Homo sapiens	166-170
28597984-8	2017	Conversely, blocking the autophagic flux with chloroquine or with ATG5-siRNA overactivated TrkB/BDNF signaling.	Chloroquine	46-57	neurotrophic receptor tyrosine kinase 2	Homo sapiens	91-95
28597984-8	2017	Conversely, blocking the autophagic flux with chloroquine or with ATG5-siRNA overactivated TrkB/BDNF signaling.	Chloroquine	46-57	brain derived neurotrophic factor	Homo sapiens	96-100
28842279-5	2017	Disruption of itch signal transmission by depletion of peripheral sensory fibers expressing TRPV1 (transient receptor potential vanilloid subfamily, member 1) attenuated chloroquine-induced CPA.	Chloroquine	170-181	itchy, E3 ubiquitin protein ligase	Mus musculus	14-18
28842279-5	2017	Disruption of itch signal transmission by depletion of peripheral sensory fibers expressing TRPV1 (transient receptor potential vanilloid subfamily, member 1) attenuated chloroquine-induced CPA.	Chloroquine	170-181	transient receptor potential cation channel, subfamily V, member 1	Mus musculus	92-97
28751111-4	2017	We discovered that two molecular sensors, GR22e and GR33a, act as chloroquine receptors, and found that chloroquine-mediated activation of GRNs occurs through S-type sensilla.	Chloroquine	66-77	Gustatory receptor 22e	Drosophila melanogaster	42-47
28906492-5	2017	Meanwhile, CA-4 or CQ could increase the expression of NDRG1 independently.	Chloroquine	19-21	N-myc downstream regulated 1	Homo sapiens	55-60
28906492-6	2017	We further performed mechanistic study to explore how CA-4 and CQ regulate the expression of NDRG1.	Chloroquine	63-65	N-myc downstream regulated 1	Homo sapiens	93-98
28906492-7	2017	Using luciferase reporter assay, we found that CA-4 transcriptionally upregulated NDRG1 expression, whereas CQ triggered colocalization of NDRG1 and lysosome, which subsequently prevented lysosome-dependent degradation of NDRG1.	Chloroquine	108-110	N-myc downstream regulated 1	Homo sapiens	139-144
28906492-7	2017	Using luciferase reporter assay, we found that CA-4 transcriptionally upregulated NDRG1 expression, whereas CQ triggered colocalization of NDRG1 and lysosome, which subsequently prevented lysosome-dependent degradation of NDRG1.	Chloroquine	108-110	N-myc downstream regulated 1	Homo sapiens	139-144
28906492-9	2017	Moreover, NDRG1 inhibition increased apoptosis in response to combination treatment with CA-4 and CQ.	Chloroquine	98-100	N-myc downstream regulated 1	Homo sapiens	10-15
28559440-5	2017	In isolated single mouse myometrial cells, a phenotypical bitter tastant (chloroquine, ChQ) reverses the rise in intracellular Ca2+ concentration ([Ca2+]i) and cell shortening induced by uterotonics, and this reversal effect is inhibited by pertussis toxin and by genetic deletion of alpha-gustducin.	Chloroquine	74-85	guanine nucleotide binding protein, alpha transducing 3	Mus musculus	284-299
28812437-6	2017	Treatment with chloroquine, or knockdown of the autophagy gene ATG5, inhibited the formation of VM and KDR phosphorylation in GSCs.	Chloroquine	15-26	kinase insert domain receptor	Homo sapiens	103-106
28592636-10	2017	Pretreatment with IL-6 renders beta cells resistant to apoptosis induced by proinflammatory cytokines, and inhibition of autophagy with chloroquine prevents the ability of IL-6 to protect from apoptosis.	Chloroquine	136-147	interleukin 6	Homo sapiens	172-176
28751111-4	2017	We discovered that two molecular sensors, GR22e and GR33a, act as chloroquine receptors, and found that chloroquine-mediated activation of GRNs occurs through S-type sensilla.	Chloroquine	66-77	Gustatory receptor 33a	Drosophila melanogaster	52-57
28817115-11	2017	Furthermore, our in vivo study demonstrated that the FSH-induced increase in weight was significantly reduced after effectively inhibiting autophagy with chloroquine, which was correlated with incomplete mitophagy process through the PINK1-Parkin pathway, delayed cell cycle, and reduced cell proliferation rate.	Chloroquine	154-165	follicle stimulating hormone beta	Mus musculus	53-56
28655725-7	2017	siRNA-mediated knockdown of Atg7 and presence of autophagy inhibitors, 3-MA and chloroquine, resulted in the decrease in lipid-lowering effect of 4-PBA, suggesting that 4-PBA mediates its lipid-lowering effect via autophagy.	Chloroquine	80-91	autophagy related 7	Homo sapiens	28-32
28759800-7	2017	Moreover, autophagy inhibitor chloroquine (CQ) or 3-Methyladenine (3MA) treatment significantly suppressed phosphorylation and consequently degradation of NF-kappaB inhibitor I-kappaBalpha, reduced MM-MSCs-mediate activation of NF-kappaB and prevented MM-MSCs-induced resistance.	Chloroquine	30-41	nuclear factor kappa B subunit 1	Homo sapiens	155-164
28759800-7	2017	Moreover, autophagy inhibitor chloroquine (CQ) or 3-Methyladenine (3MA) treatment significantly suppressed phosphorylation and consequently degradation of NF-kappaB inhibitor I-kappaBalpha, reduced MM-MSCs-mediate activation of NF-kappaB and prevented MM-MSCs-induced resistance.	Chloroquine	30-41	NFKB inhibitor alpha	Homo sapiens	175-188
28759800-7	2017	Moreover, autophagy inhibitor chloroquine (CQ) or 3-Methyladenine (3MA) treatment significantly suppressed phosphorylation and consequently degradation of NF-kappaB inhibitor I-kappaBalpha, reduced MM-MSCs-mediate activation of NF-kappaB and prevented MM-MSCs-induced resistance.	Chloroquine	30-41	nuclear factor kappa B subunit 1	Homo sapiens	228-237
28759800-7	2017	Moreover, autophagy inhibitor chloroquine (CQ) or 3-Methyladenine (3MA) treatment significantly suppressed phosphorylation and consequently degradation of NF-kappaB inhibitor I-kappaBalpha, reduced MM-MSCs-mediate activation of NF-kappaB and prevented MM-MSCs-induced resistance.	Chloroquine	43-45	nuclear factor kappa B subunit 1	Homo sapiens	155-164
28759800-7	2017	Moreover, autophagy inhibitor chloroquine (CQ) or 3-Methyladenine (3MA) treatment significantly suppressed phosphorylation and consequently degradation of NF-kappaB inhibitor I-kappaBalpha, reduced MM-MSCs-mediate activation of NF-kappaB and prevented MM-MSCs-induced resistance.	Chloroquine	43-45	NFKB inhibitor alpha	Homo sapiens	175-188
28837152-9	2017	Indeed, CQ treatment led to marked lysosomal swelling and recruitment of Galectin3 to sites of membrane damage.	Chloroquine	8-10	galectin 3	Homo sapiens	73-82
28759800-7	2017	Moreover, autophagy inhibitor chloroquine (CQ) or 3-Methyladenine (3MA) treatment significantly suppressed phosphorylation and consequently degradation of NF-kappaB inhibitor I-kappaBalpha, reduced MM-MSCs-mediate activation of NF-kappaB and prevented MM-MSCs-induced resistance.	Chloroquine	43-45	nuclear factor kappa B subunit 1	Homo sapiens	228-237
28414310-6	2017	In ESCC xenograft tumours, pharmacological autophagy inhibition with chloroquine derivatives depletes cells with high CD44 expression while promoting oxidative stress.	Chloroquine	69-80	CD44 molecule (Indian blood group)	Homo sapiens	118-122
28817115-11	2017	Furthermore, our in vivo study demonstrated that the FSH-induced increase in weight was significantly reduced after effectively inhibiting autophagy with chloroquine, which was correlated with incomplete mitophagy process through the PINK1-Parkin pathway, delayed cell cycle, and reduced cell proliferation rate.	Chloroquine	154-165	PTEN induced putative kinase 1	Mus musculus	234-239
29069774-6	2017	Further functional investigations carried out on PHOX2B mRNA levels and biological consequences, such as neuroblastoma cell apoptosis and growth, showed that chloroquine and mycophenolate mofetil are most promising agents for neuroblastoma therapy based on down-regulation of PHOX2B expression.	Chloroquine	158-169	paired like homeobox 2B	Homo sapiens	49-55
28687604-8	2017	Cotreatment with the autophagy inhibitor chloroquine blocked the decrease in human ataxin-3 levels and the improved movement produced by calpeptin treatment.	Chloroquine	41-52	ataxin 3	Homo sapiens	83-91
29152091-6	2017	Chloroquine, an autophagic flux inhibitor, caused a further increase in p62/SQSTM1, indicating intact autophagic flux in the FGF-2-treated groups.	Chloroquine	0-11	sequestosome 1	Homo sapiens	72-75
29152091-6	2017	Chloroquine, an autophagic flux inhibitor, caused a further increase in p62/SQSTM1, indicating intact autophagic flux in the FGF-2-treated groups.	Chloroquine	0-11	sequestosome 1	Homo sapiens	76-82
29152091-6	2017	Chloroquine, an autophagic flux inhibitor, caused a further increase in p62/SQSTM1, indicating intact autophagic flux in the FGF-2-treated groups.	Chloroquine	0-11	fibroblast growth factor 2	Homo sapiens	125-130
29069774-6	2017	Further functional investigations carried out on PHOX2B mRNA levels and biological consequences, such as neuroblastoma cell apoptosis and growth, showed that chloroquine and mycophenolate mofetil are most promising agents for neuroblastoma therapy based on down-regulation of PHOX2B expression.	Chloroquine	158-169	paired like homeobox 2B	Homo sapiens	276-282
28751541-5	2017	In cultured vascular smooth muscle cells (VSMCs), Cavin-1 was downregulated after inhibition of protein synthesis by cycloheximide, which was distinctly prevented by pretreatment with proteasome inhibitor MG132 but not by lysosomal inhibitor chloroquine, suggesting that proteasomal degradation resulted in Cavin-1 downregulation.	Chloroquine	242-253	caveolae associated protein 1	Homo sapiens	50-57
29147611-0	2017	Chloroquine supplementation increases the cytotoxic effect of curcumin against Her2/neu overexpressing breast cancer cells in vitro and in vivo in nude mice while counteracts it in immune competent mice.	Chloroquine	0-11	erb-b2 receptor tyrosine kinase 2	Mus musculus	79-87
29147611-6	2017	Immunohistochemistry analysis revealed the presence of a remarkable FoxP3 T cell infiltrate within the tumors in CUR/CQ treated mice and a reduction of T cytotoxic cells, as compared with single CUR treatment.	Chloroquine	117-119	forkhead box P3	Mus musculus	68-73
27783328-5	2017	We found that systemic administration of NAC or PBN significantly alleviated compound 48/80- and chloroquine-induced acute itch in a dose-dependent manner, attenuated dry skin-induced chronic itch, and suppressed oxidative stress in the affected skin.	Chloroquine	97-108	itchy, E3 ubiquitin protein ligase	Mus musculus	123-127
28753653-7	2017	This Sphk1 induction was also observed when cells were treated with chloroquine, a lysosomotropic amine impacting lysosome function.	Chloroquine	68-79	sphingosine kinase 1	Mus musculus	5-10
28726776-9	2017	Moreover, the inhibition of autophagosome-lysosome fusion by chloroquine significantly aggravated neuronal death in CA1, indicating that AP maturation contributes to HPC-induced neuroprotection against neuronal injury after tGCI.	Chloroquine	61-72	carbonic anhydrase 1	Rattus norvegicus	116-119
28363601-5	2017	Autophagy inhibition with bafilomycin or chloroquine prevented the decrease in Trx1 and Glo2 at 6 and 18h after MGO treatment.	Chloroquine	41-52	thioredoxin 1	Mus musculus	79-83
28575583-10	2017	In addition, pretreatment with chloroquine aggravated LPS-induced lipid accumulation and inflammation in C57BL6 mouse livers.	Chloroquine	31-42	toll-like receptor 4	Mus musculus	54-57
28537904-9	2017	Sub G1 population was increased in CNOT2-depleted H1299 cells by late autophagy inhibitors, ammonium chloride and chloroquine compared to 3-methyladenine.	Chloroquine	114-125	CCR4-NOT transcription complex subunit 2	Homo sapiens	35-40
28392425-7	2017	T-cadherin upregulation on SMCs conferred a survival advantage during prolonged serum-starvation which was sensitive to inhibition of MEK1/2/Erk1/2 by PD98059 or UO126 and to blockade of autophagy by chloroquine.	Chloroquine	200-211	cadherin 13	Rattus norvegicus	0-10
28363601-5	2017	Autophagy inhibition with bafilomycin or chloroquine prevented the decrease in Trx1 and Glo2 at 6 and 18h after MGO treatment.	Chloroquine	41-52	hydroxyacyl glutathione hydrolase	Mus musculus	88-92
28433888-4	2017	However, the effect could be blocked by chloroquine (CQ), a TLR9 inhibitor.	Chloroquine	40-51	toll like receptor 9	Homo sapiens	60-64
28433888-4	2017	However, the effect could be blocked by chloroquine (CQ), a TLR9 inhibitor.	Chloroquine	53-55	toll like receptor 9	Homo sapiens	60-64
28438834-8	2017	TRAF6-/- OC precursors that overexpressed TRAF3 or were treated with the autophagolysosome inhibitor chloroquine formed significantly fewer OCs in response to TNF alone or in combination with RANKL.	Chloroquine	101-112	TNF receptor-associated factor 6	Mus musculus	0-5
28560460-8	2017	In the cell lines showing autophagy, which was induced by CDK4 inhibitor, the combination of CDK4 inhibitor and autophagy inhibition by either chloroquine (CQ) or knockdown of ATG5 or BECN1 induced apoptosis.	Chloroquine	143-154	cyclin dependent kinase 4	Homo sapiens	58-62
28560460-8	2017	In the cell lines showing autophagy, which was induced by CDK4 inhibitor, the combination of CDK4 inhibitor and autophagy inhibition by either chloroquine (CQ) or knockdown of ATG5 or BECN1 induced apoptosis.	Chloroquine	143-154	cyclin dependent kinase 4	Homo sapiens	93-97
28824303-12	2017	In addition, administration autophagy inhibitor chloroquine (CQ) did not block the effect of metformin on Cx43 expression while increasing Cx43 content, together with an increased apoptosis.	Chloroquine	61-63	gap junction protein, alpha 1	Rattus norvegicus	139-143
28438834-8	2017	TRAF6-/- OC precursors that overexpressed TRAF3 or were treated with the autophagolysosome inhibitor chloroquine formed significantly fewer OCs in response to TNF alone or in combination with RANKL.	Chloroquine	101-112	tumor necrosis factor	Mus musculus	159-162
28438834-8	2017	TRAF6-/- OC precursors that overexpressed TRAF3 or were treated with the autophagolysosome inhibitor chloroquine formed significantly fewer OCs in response to TNF alone or in combination with RANKL.	Chloroquine	101-112	tumor necrosis factor (ligand) superfamily, member 11	Mus musculus	192-197
28438834-10	2017	These findings suggest that preventing TRAF3 degradation with drugs like chloroquine could reduce excessive OC formation in diseases in which bone resorption is increased in response to elevated production of these cytokines.	Chloroquine	73-84	TNF receptor-associated factor 3	Mus musculus	39-44
28450109-3	2017	We investigated whether T-type calcium channels expressed within primary sensory fibers of mouse skin, especially Cav3.2 subtype, involve in chloroquine-, endothelin-1- and histamine-evoked acute itch using pharmacological, neuronal imaging and behavioral analyses.	Chloroquine	141-152	calcium channel, voltage-dependent, T type, alpha 1H subunit	Mus musculus	114-120
28619113-10	2017	Experiments with epoxomicin and chloroquine showed that proteasomal targeting of insoluble Ser129-phosphorylated alpha-synuclein was enhanced under lysosome inhibition and it reduced accumulation of insoluble total alpha-synuclein.	Chloroquine	32-43	synuclein alpha	Rattus norvegicus	113-128
28410268-3	2017	Pretreatment of intradermal BoNT/A exerted long-term inhibitory effects on compound 48/80-induced and chloroquine-induced acute itch on days 1, 3, 7, and 14, but not on day 21, in mice.	Chloroquine	102-113	itchy, E3 ubiquitin protein ligase	Mus musculus	128-132
28498820-3	2017	We report here that inhibition of lysosomal function using chloroquine (CQ) upregulates cholesterol homeostasis genes in TSC2-deficient cells.	Chloroquine	59-70	TSC complex subunit 2	Homo sapiens	121-125
28498820-3	2017	We report here that inhibition of lysosomal function using chloroquine (CQ) upregulates cholesterol homeostasis genes in TSC2-deficient cells.	Chloroquine	72-74	TSC complex subunit 2	Homo sapiens	121-125
28498820-5	2017	Unexpectedly, engaging this CQ-induced cholesterol uptake pathway together with inhibition of de novo cholesterol synthesis allows survival of TSC2-deficient, but not TSC2-expressing cells.	Chloroquine	28-30	TSC complex subunit 2	Homo sapiens	143-147
28592712-10	2017	Using A549 human lung adenocarcinoma cell line, we demonstrated that an autophagy inhibitor, chloroquine, could inhibit the HDGF secretion, while quercetin, an autophagy inducer derived from a traditional Chinese drug, could facilitate HDGF secretion.	Chloroquine	93-104	heparin binding growth factor	Homo sapiens	124-128
28601826-0	2017	Study protocol of a phase IB/II clinical trial of metformin and chloroquine in patients with IDH1-mutated or IDH2-mutated solid tumours.	Chloroquine	64-75	isocitrate dehydrogenase (NADP(+)) 1	Homo sapiens	93-97
28601826-0	2017	Study protocol of a phase IB/II clinical trial of metformin and chloroquine in patients with IDH1-mutated or IDH2-mutated solid tumours.	Chloroquine	64-75	isocitrate dehydrogenase (NADP(+)) 2	Homo sapiens	109-113
28601826-4	2017	IDH1/2-mutated cancer cells produce the oncometabolite D-2-hydroxyglutarate (D-2HG) and are metabolically vulnerable to treatment with the oral antidiabetic metformin and the oral antimalarial drug chloroquine.	Chloroquine	198-209	isocitrate dehydrogenase (NADP(+)) 1	Homo sapiens	0-4
28217875-1	2017	KEY POINTS: Chloroquine (CQ) stimulates itch nerves and causes intense scratching in mice by activating the G-protein coupled receptor (GPCR) MrgprA3; it is not known how stimulation of MrgprA3 (or other GPCRs) leads to activation of the itch nerve terminals in the skin, but previous studies have found that transient receptor potential A1 (TRPA1) gene deletion blocks CQ-induced scratching.	Chloroquine	12-23	MAS-related GPR, member A3	Mus musculus	142-149
28217875-1	2017	KEY POINTS: Chloroquine (CQ) stimulates itch nerves and causes intense scratching in mice by activating the G-protein coupled receptor (GPCR) MrgprA3; it is not known how stimulation of MrgprA3 (or other GPCRs) leads to activation of the itch nerve terminals in the skin, but previous studies have found that transient receptor potential A1 (TRPA1) gene deletion blocks CQ-induced scratching.	Chloroquine	12-23	transient receptor potential cation channel, subfamily A, member 1	Mus musculus	309-340
28217875-1	2017	KEY POINTS: Chloroquine (CQ) stimulates itch nerves and causes intense scratching in mice by activating the G-protein coupled receptor (GPCR) MrgprA3; it is not known how stimulation of MrgprA3 (or other GPCRs) leads to activation of the itch nerve terminals in the skin, but previous studies have found that transient receptor potential A1 (TRPA1) gene deletion blocks CQ-induced scratching.	Chloroquine	12-23	transient receptor potential cation channel, subfamily A, member 1	Mus musculus	342-347
28217875-1	2017	KEY POINTS: Chloroquine (CQ) stimulates itch nerves and causes intense scratching in mice by activating the G-protein coupled receptor (GPCR) MrgprA3; it is not known how stimulation of MrgprA3 (or other GPCRs) leads to activation of the itch nerve terminals in the skin, but previous studies have found that transient receptor potential A1 (TRPA1) gene deletion blocks CQ-induced scratching.	Chloroquine	25-27	MAS-related GPR, member A3	Mus musculus	142-149
28217875-1	2017	KEY POINTS: Chloroquine (CQ) stimulates itch nerves and causes intense scratching in mice by activating the G-protein coupled receptor (GPCR) MrgprA3; it is not known how stimulation of MrgprA3 (or other GPCRs) leads to activation of the itch nerve terminals in the skin, but previous studies have found that transient receptor potential A1 (TRPA1) gene deletion blocks CQ-induced scratching.	Chloroquine	25-27	MAS-related GPR, member A3	Mus musculus	186-193
28217875-1	2017	KEY POINTS: Chloroquine (CQ) stimulates itch nerves and causes intense scratching in mice by activating the G-protein coupled receptor (GPCR) MrgprA3; it is not known how stimulation of MrgprA3 (or other GPCRs) leads to activation of the itch nerve terminals in the skin, but previous studies have found that transient receptor potential A1 (TRPA1) gene deletion blocks CQ-induced scratching.	Chloroquine	25-27	transient receptor potential cation channel, subfamily A, member 1	Mus musculus	309-340
28217875-1	2017	KEY POINTS: Chloroquine (CQ) stimulates itch nerves and causes intense scratching in mice by activating the G-protein coupled receptor (GPCR) MrgprA3; it is not known how stimulation of MrgprA3 (or other GPCRs) leads to activation of the itch nerve terminals in the skin, but previous studies have found that transient receptor potential A1 (TRPA1) gene deletion blocks CQ-induced scratching.	Chloroquine	25-27	transient receptor potential cation channel, subfamily A, member 1	Mus musculus	342-347
28217875-9	2017	The response to CQ, but not histamine, was largely absent in mrgpr-cluster Delta-/- mice, supporting the hypothesis that CQ evokes itch largely via stimulation of MrgprA3 receptors.	Chloroquine	121-123	MAS-related GPR, member A3	Mus musculus	163-170
28217875-13	2017	A selective inhibitor of the calcium-activated chloride channel TMEM16A, N-((4-methoxy)-2-naphthyl)-5-nitroanthranilic acid (MONNA), inhibited CQ-induced action potential discharge at itch nerve terminals and bouts of scratching by about 50%.	Chloroquine	143-145	anoctamin 1, calcium activated chloride channel	Mus musculus	64-71
28592712-10	2017	Using A549 human lung adenocarcinoma cell line, we demonstrated that an autophagy inhibitor, chloroquine, could inhibit the HDGF secretion, while quercetin, an autophagy inducer derived from a traditional Chinese drug, could facilitate HDGF secretion.	Chloroquine	93-104	heparin binding growth factor	Homo sapiens	236-240
28546857-7	2017	CONCLUSIONS: These results indicate that chloroquine inhibits Ca2+ elevations in splenic B cells through inhibiting Ca2+ permeable IP3R and TRPC3 and/or STIM/Orai channels.	Chloroquine	41-52	inositol 1,4,5-trisphosphate receptor 1	Mus musculus	131-135
29771045-2	2017	Method:Establish the EMT model induced by TGF-beta1 in the SCCHN in time/concentration, and the expression of autophagy related protein microtubule associated protein 1 light chain3 (LC3) detected by western blot; Autophagy inhibitor chloroquine (CQ), depressing autophagy, the expression of E-cadherin, cytokeratin, Vimentin and LC3 were examined by Western blot.	Chloroquine	247-249	microtubule associated protein 1 light chain 3 alpha	Homo sapiens	183-186
28535645-3	2017	Results: Either of them, rapamycin or chloroquine had an antitumor effect in vitro (RAPA: IC50=1.5 nmol/L; CQ: IC50=400 mumol/L).	Chloroquine	38-49	transcriptional regulating factor 1	Homo sapiens	84-88
29771045-2	2017	Method:Establish the EMT model induced by TGF-beta1 in the SCCHN in time/concentration, and the expression of autophagy related protein microtubule associated protein 1 light chain3 (LC3) detected by western blot; Autophagy inhibitor chloroquine (CQ), depressing autophagy, the expression of E-cadherin, cytokeratin, Vimentin and LC3 were examined by Western blot.	Chloroquine	234-245	microtubule associated protein 1 light chain 3 alpha	Homo sapiens	183-186
28546857-7	2017	CONCLUSIONS: These results indicate that chloroquine inhibits Ca2+ elevations in splenic B cells through inhibiting Ca2+ permeable IP3R and TRPC3 and/or STIM/Orai channels.	Chloroquine	41-52	transient receptor potential cation channel, subfamily C, member 3	Mus musculus	140-145
28903368-3	2017	Functional autophagy was demonstrated in CC cell lines (LoVo; HT-29) showing a dose-dependent increase of the autophagy markers LC3B, p62 and autophagic vesciles upon increasing concentrations of the autophagy inhibitor chloroquine, which was demonstrated by immunoblotting, immunofluorescence and electron microscopy.	Chloroquine	220-231	microtubule associated protein 1 light chain 3 beta	Homo sapiens	128-132
28903368-3	2017	Functional autophagy was demonstrated in CC cell lines (LoVo; HT-29) showing a dose-dependent increase of the autophagy markers LC3B, p62 and autophagic vesciles upon increasing concentrations of the autophagy inhibitor chloroquine, which was demonstrated by immunoblotting, immunofluorescence and electron microscopy.	Chloroquine	220-231	nucleoporin 62	Homo sapiens	134-137
28119997-0	2017	Peripheral NMDA Receptor/NO System Blockage Inhibits Itch Responses Induced by Chloroquine in Mice.	Chloroquine	79-90	itchy, E3 ubiquitin protein ligase	Mus musculus	53-57
28119997-2	2017	Chloroquine-induced itch is histamine-independent and we have reported that the nitric oxide (NO)/cyclic guanosine monophosphate (cGMP) pathway is involved in CQ-induced scratching behavior in mice.	Chloroquine	0-11	itchy, E3 ubiquitin protein ligase	Mus musculus	20-24
28119997-2	2017	Chloroquine-induced itch is histamine-independent and we have reported that the nitric oxide (NO)/cyclic guanosine monophosphate (cGMP) pathway is involved in CQ-induced scratching behavior in mice.	Chloroquine	159-161	itchy, E3 ubiquitin protein ligase	Mus musculus	20-24
28119997-4	2017	Here we show that NMDAR antagonists significantly decrease CQ-induced scratching in mice while a non-effective dose of an NMDAR agonist potentiates the scratching behavior provoked by sub-effective doses of CQ.	Chloroquine	59-61	glutamate receptor, ionotropic, NMDA1 (zeta 1)	Mus musculus	18-23
28119997-4	2017	Here we show that NMDAR antagonists significantly decrease CQ-induced scratching in mice while a non-effective dose of an NMDAR agonist potentiates the scratching behavior provoked by sub-effective doses of CQ.	Chloroquine	207-209	glutamate receptor, ionotropic, NMDA1 (zeta 1)	Mus musculus	122-127
28119997-5	2017	In contrast, combined pre-treatment with sub-effective doses of an NMDAR antagonist, MK-801, and the NO synthase inhibitor, L-N-nitro arginine methyl ester (L-NAME), decreases CQ-induced scrat-ching behavior.	Chloroquine	176-178	glutamate receptor, ionotropic, NMDA1 (zeta 1)	Mus musculus	67-72
28464945-8	2017	In the Lao PDR, approximately 9 in 10 anti-malarials distributed in the private sector were second-line treatments-typically locally manufactured chloroquine.	Chloroquine	146-157	interleukin 4 induced 1	Homo sapiens	7-10
28134560-2	2017	Chloroquine (CQ) has been shown to affect LPS-TLR4 colocalization and inhibit both MyD88-dependent and TRAM/TRIF-dependent pathways, though the mechanism involved is still poorly understood.	Chloroquine	0-11	toll like receptor 4	Homo sapiens	46-50
28118027-6	2017	Isolated tracheal rings from gelsolin knockout (KO) mice showed impaired relaxation to both a beta-agonist and chloroquine, a bitter taste receptor agonist, which relaxes ASM, despite inducing transiently increased [Ca2+]i.	Chloroquine	111-122	gelsolin	Mus musculus	29-37
28118027-10	2017	Gelsolin KO ASM cells also showed an attenuated decrease in cell stiffness to chloroquine and flufenamic acid.	Chloroquine	78-89	gelsolin	Mus musculus	0-8
28134560-0	2017	Chloroquine attenuates lipopolysaccharide-induced inflammatory responses through upregulation of USP25.	Chloroquine	0-11	ubiquitin specific peptidase 25	Homo sapiens	97-102
28134560-2	2017	Chloroquine (CQ) has been shown to affect LPS-TLR4 colocalization and inhibit both MyD88-dependent and TRAM/TRIF-dependent pathways, though the mechanism involved is still poorly understood.	Chloroquine	0-11	MYD88 innate immune signal transduction adaptor	Homo sapiens	83-88
28134560-2	2017	Chloroquine (CQ) has been shown to affect LPS-TLR4 colocalization and inhibit both MyD88-dependent and TRAM/TRIF-dependent pathways, though the mechanism involved is still poorly understood.	Chloroquine	0-11	TIR domain containing adaptor molecule 2	Homo sapiens	103-107
28134560-2	2017	Chloroquine (CQ) has been shown to affect LPS-TLR4 colocalization and inhibit both MyD88-dependent and TRAM/TRIF-dependent pathways, though the mechanism involved is still poorly understood.	Chloroquine	0-11	TIR domain containing adaptor molecule 1	Homo sapiens	108-112
28134560-2	2017	Chloroquine (CQ) has been shown to affect LPS-TLR4 colocalization and inhibit both MyD88-dependent and TRAM/TRIF-dependent pathways, though the mechanism involved is still poorly understood.	Chloroquine	13-15	toll like receptor 4	Homo sapiens	46-50
28134560-2	2017	Chloroquine (CQ) has been shown to affect LPS-TLR4 colocalization and inhibit both MyD88-dependent and TRAM/TRIF-dependent pathways, though the mechanism involved is still poorly understood.	Chloroquine	13-15	MYD88 innate immune signal transduction adaptor	Homo sapiens	83-88
28134560-2	2017	Chloroquine (CQ) has been shown to affect LPS-TLR4 colocalization and inhibit both MyD88-dependent and TRAM/TRIF-dependent pathways, though the mechanism involved is still poorly understood.	Chloroquine	13-15	TIR domain containing adaptor molecule 2	Homo sapiens	103-107
28134560-2	2017	Chloroquine (CQ) has been shown to affect LPS-TLR4 colocalization and inhibit both MyD88-dependent and TRAM/TRIF-dependent pathways, though the mechanism involved is still poorly understood.	Chloroquine	13-15	TIR domain containing adaptor molecule 1	Homo sapiens	108-112
28134560-8	2017	Taken together, our data demonstrated a new possible regulator of LPS-induced macrophage activation mediated by CQ, through upregulation of USP25.	Chloroquine	112-114	ubiquitin specific peptidase 25	Homo sapiens	140-145
28181145-9	2017	Chloroquine suppressed autophagy and reversed the downregulation of connexin43.	Chloroquine	0-11	gap junction protein, alpha 1	Rattus norvegicus	68-78
28157489-7	2017	The inhibition of cysteine cathepsins by specific proteinase inhibitors or chloroquine, which raises cellular pH, restored HDAC4.	Chloroquine	75-86	histone deacetylase 4	Homo sapiens	123-128
28249220-7	2017	In addition, the inflammatory responses induced by paraquat were inhibited after treatment with chloroquine, as indicated by the decreased number of leukocytes, the reduced levels of TNF-alpha, IL-1beta and IL-6 in the bronchoalveolar lavage fluid, the reduced NO content, and downregulation of iNOS expression in lung tissues.	Chloroquine	96-107	tumor necrosis factor	Mus musculus	183-192
28249220-7	2017	In addition, the inflammatory responses induced by paraquat were inhibited after treatment with chloroquine, as indicated by the decreased number of leukocytes, the reduced levels of TNF-alpha, IL-1beta and IL-6 in the bronchoalveolar lavage fluid, the reduced NO content, and downregulation of iNOS expression in lung tissues.	Chloroquine	96-107	interleukin 1 beta	Mus musculus	194-202
28249220-7	2017	In addition, the inflammatory responses induced by paraquat were inhibited after treatment with chloroquine, as indicated by the decreased number of leukocytes, the reduced levels of TNF-alpha, IL-1beta and IL-6 in the bronchoalveolar lavage fluid, the reduced NO content, and downregulation of iNOS expression in lung tissues.	Chloroquine	96-107	interleukin 6	Mus musculus	207-211
28249220-7	2017	In addition, the inflammatory responses induced by paraquat were inhibited after treatment with chloroquine, as indicated by the decreased number of leukocytes, the reduced levels of TNF-alpha, IL-1beta and IL-6 in the bronchoalveolar lavage fluid, the reduced NO content, and downregulation of iNOS expression in lung tissues.	Chloroquine	96-107	nitric oxide synthase 2, inducible	Mus musculus	295-299
28249220-10	2017	The expressions of the anti-oxidative proteins, Nrf2, HO-1 and NQO1, were also upregulated by chloroquine treatment.	Chloroquine	94-105	nuclear factor, erythroid derived 2, like 2	Mus musculus	48-52
28249220-10	2017	The expressions of the anti-oxidative proteins, Nrf2, HO-1 and NQO1, were also upregulated by chloroquine treatment.	Chloroquine	94-105	heme oxygenase 1	Mus musculus	54-58
28249220-10	2017	The expressions of the anti-oxidative proteins, Nrf2, HO-1 and NQO1, were also upregulated by chloroquine treatment.	Chloroquine	94-105	NAD(P)H dehydrogenase, quinone 1	Mus musculus	63-67
28249220-13	2017	Immunohistochemistry staining showed that the expressions of the pro-fibrotic proteins TGF-beta and alpha-SMA were downregulated after treatment with chloroquine.	Chloroquine	150-161	transforming growth factor, beta 1	Mus musculus	87-95
28249220-13	2017	Immunohistochemistry staining showed that the expressions of the pro-fibrotic proteins TGF-beta and alpha-SMA were downregulated after treatment with chloroquine.	Chloroquine	150-161	actin alpha 2, smooth muscle, aorta	Mus musculus	100-109
28320515-3	2017	Here we report that overexpression of HMGCS2 decreased levels of APP and related CTFs (carboxy-terminal fragments), which was largely prevented by an autophagic inhibitor chloroquine.	Chloroquine	171-182	3-hydroxy-3-methylglutaryl-CoA synthase 2	Homo sapiens	38-44
28491035-7	2017	Long-term exposure to 5-AZA induced the reduction of the autophagic marker SQSTM1/p62, reversible by CQ or leupeptin exposure.	Chloroquine	101-103	sequestosome 1	Homo sapiens	75-81
28491035-7	2017	Long-term exposure to 5-AZA induced the reduction of the autophagic marker SQSTM1/p62, reversible by CQ or leupeptin exposure.	Chloroquine	101-103	sequestosome 1	Homo sapiens	82-85
28420430-14	2017	We found that inhibition of autophagy by chloroquine promoted cell detachment and modulated CD99 expression level whereas incorporation of CD99 recombinant protein into the cells suppressed autophagy.	Chloroquine	41-52	CD99 molecule (Xg blood group)	Homo sapiens	92-96
28216048-0	2017	Chloroquine blocks the Kir4.1 channels by an open-pore blocking mechanism.	Chloroquine	0-11	potassium inwardly rectifying channel subfamily J member 10	Homo sapiens	23-29
28216048-3	2017	Chloroquine (CQ) is an amino quinolone derivative known to inhibit Kir2.1 and Kir6.2 channels with different action mechanism and binding site.	Chloroquine	0-11	potassium inwardly rectifying channel subfamily J member 2	Homo sapiens	67-73
28216048-3	2017	Chloroquine (CQ) is an amino quinolone derivative known to inhibit Kir2.1 and Kir6.2 channels with different action mechanism and binding site.	Chloroquine	0-11	potassium inwardly rectifying channel subfamily J member 11	Homo sapiens	78-84
28216048-3	2017	Chloroquine (CQ) is an amino quinolone derivative known to inhibit Kir2.1 and Kir6.2 channels with different action mechanism and binding site.	Chloroquine	13-15	potassium inwardly rectifying channel subfamily J member 2	Homo sapiens	67-73
28216048-3	2017	Chloroquine (CQ) is an amino quinolone derivative known to inhibit Kir2.1 and Kir6.2 channels with different action mechanism and binding site.	Chloroquine	13-15	potassium inwardly rectifying channel subfamily J member 11	Homo sapiens	78-84
28216048-4	2017	Here, we employed patch-clamp methods, mutagenesis analysis, and molecular modeling to characterize the molecular pharmacology of Kir4.1 inhibition by CQ.	Chloroquine	151-153	potassium inwardly rectifying channel subfamily J member 10	Homo sapiens	130-136
28373150-5	2017	At day 4 post-injury, the extent of co-localization between LC3 and Cx40 was greatly enhanced, and the reduction of Cx40 was rescued by the administration of an autophagy inhibitor chloroquine.	Chloroquine	181-192	annexin A3	Rattus norvegicus	60-63
28373150-5	2017	At day 4 post-injury, the extent of co-localization between LC3 and Cx40 was greatly enhanced, and the reduction of Cx40 was rescued by the administration of an autophagy inhibitor chloroquine.	Chloroquine	181-192	gap junction protein, alpha 5	Rattus norvegicus	68-72
28373150-5	2017	At day 4 post-injury, the extent of co-localization between LC3 and Cx40 was greatly enhanced, and the reduction of Cx40 was rescued by the administration of an autophagy inhibitor chloroquine.	Chloroquine	181-192	gap junction protein, alpha 5	Rattus norvegicus	116-120
28433067-6	2017	Moreover, bladder cancer cells treated with CQ and HCQ underwent apoptosis, resulting in increased caspase 3/7 activities, increased level of cleaved poly(ADP-ribose) polymerase (PARP), caspase 3, and DNA fragmentation.	Chloroquine	44-46	caspase 3	Homo sapiens	99-108
28433067-6	2017	Moreover, bladder cancer cells treated with CQ and HCQ underwent apoptosis, resulting in increased caspase 3/7 activities, increased level of cleaved poly(ADP-ribose) polymerase (PARP), caspase 3, and DNA fragmentation.	Chloroquine	44-46	poly(ADP-ribose) polymerase 1	Homo sapiens	150-177
28433067-6	2017	Moreover, bladder cancer cells treated with CQ and HCQ underwent apoptosis, resulting in increased caspase 3/7 activities, increased level of cleaved poly(ADP-ribose) polymerase (PARP), caspase 3, and DNA fragmentation.	Chloroquine	44-46	poly(ADP-ribose) polymerase 1	Homo sapiens	179-183
28433067-6	2017	Moreover, bladder cancer cells treated with CQ and HCQ underwent apoptosis, resulting in increased caspase 3/7 activities, increased level of cleaved poly(ADP-ribose) polymerase (PARP), caspase 3, and DNA fragmentation.	Chloroquine	44-46	caspase 3	Homo sapiens	186-195
28350133-7	2017	Furthermore, the level of p62 decreased when autophagy was induced by rapamycin, and increased when autophagy was inhibited by chloroquine (CQ), which indicated that LSS may serve an important role in inducing autophagy flux.	Chloroquine	127-138	nucleoporin 62	Homo sapiens	26-29
28350133-7	2017	Furthermore, the level of p62 decreased when autophagy was induced by rapamycin, and increased when autophagy was inhibited by chloroquine (CQ), which indicated that LSS may serve an important role in inducing autophagy flux.	Chloroquine	140-142	nucleoporin 62	Homo sapiens	26-29
28350133-9	2017	Pretreatment of HUVECs with CQ markedly increased LSS-induced apoptosis, which was associated with an increased expression of Bax and a decreased expression of Bcl-2.	Chloroquine	28-30	BCL2 associated X, apoptosis regulator	Homo sapiens	126-129
28350133-9	2017	Pretreatment of HUVECs with CQ markedly increased LSS-induced apoptosis, which was associated with an increased expression of Bax and a decreased expression of Bcl-2.	Chloroquine	28-30	BCL2 apoptosis regulator	Homo sapiens	160-165
28301876-6	2017	Through the detection of autophagy substrates p62 and LC3, found that QBC939 cells have a higher flow of autophagy, autophagy inhibitor chloroquine can significantly increase the sensitivity of cisplatin in cholangiocarcinoma cells compared with hepatocellular carcinoma HepG2 cells.	Chloroquine	136-147	nucleoporin 62	Homo sapiens	46-49
28199887-0	2017	Killing colon cancer cells through PCD pathways by a novel hyaluronic acid-modified shell-core nanoparticle loaded with RIP3 in combination with chloroquine.	Chloroquine	145-156	ATP/GTP binding protein 1	Mus musculus	35-38
28199887-3	2017	In this study, chloroquine (CQ) was found to significantly upregulate receptor-interacting protein kinase 3 (RIP3) expression, and RIP3 were involved in CQ-related autophagy.	Chloroquine	15-26	receptor-interacting serine-threonine kinase 3	Mus musculus	70-107
28199887-3	2017	In this study, chloroquine (CQ) was found to significantly upregulate receptor-interacting protein kinase 3 (RIP3) expression, and RIP3 were involved in CQ-related autophagy.	Chloroquine	15-26	receptor-interacting serine-threonine kinase 3	Mus musculus	109-113
28199887-3	2017	In this study, chloroquine (CQ) was found to significantly upregulate receptor-interacting protein kinase 3 (RIP3) expression, and RIP3 were involved in CQ-related autophagy.	Chloroquine	28-30	receptor-interacting serine-threonine kinase 3	Mus musculus	70-107
28199887-3	2017	In this study, chloroquine (CQ) was found to significantly upregulate receptor-interacting protein kinase 3 (RIP3) expression, and RIP3 were involved in CQ-related autophagy.	Chloroquine	28-30	receptor-interacting serine-threonine kinase 3	Mus musculus	109-113
28199887-3	2017	In this study, chloroquine (CQ) was found to significantly upregulate receptor-interacting protein kinase 3 (RIP3) expression, and RIP3 were involved in CQ-related autophagy.	Chloroquine	153-155	receptor-interacting serine-threonine kinase 3	Mus musculus	131-135
28199887-5	2017	mRIP3 overexpression in combination with CQ markedly increased the inhibition rate relative to that observed in the CQ-treatment group.	Chloroquine	116-118	receptor-interacting serine-threonine kinase 3	Mus musculus	0-5
28199887-6	2017	Several experiments, including Hoechst staining, transmission electron microscopy (TEM) observation, the high-mobility group box 1 (HMGB1) release assay, Annexin V/PI staining and immunoblotting of proteins included in PCD pathways, verified that mRIP3 overexpression in combination with CQ induced lysosomal membrane permeabilization (LMP) and necroptosis of cancer cells, leading to cancer cell death.	Chloroquine	288-290	receptor-interacting serine-threonine kinase 3	Mus musculus	247-252
28199887-8	2017	The nanoparticles exhibited ideal biocompatibility and good tumor-targeting efficiency, and the tumor inhibition rate of HA-Lip-PEI-mRIP3-PLGA-NPs + CQ was 80.2% in the CT26 mouse model.	Chloroquine	149-151	receptor-interacting serine-threonine kinase 3	Mus musculus	132-137
28323983-8	2017	Mechanistic studies revealed that the reduction in COL1A1 but not COL1A2 protein by cortisol was blocked by lysosome inhibitor chloroquine or small interfering RNA (siRNA)-mediated knockdown of autophagy-related protein 7, an essential protein for autophagy, whereas the proteasome inhibitors MG132 and bortezomib were ineffective.	Chloroquine	127-138	collagen type I alpha 1 chain	Homo sapiens	51-57
28337019-6	2017	Treatment with autophagy inhibitors wortmannin and chloroquine compromised this effect, substantiating the involvement of autophagy-lysosomal system on the degradation of beta-catenin during Wnt signaling through inhibition of the AKT/mTOR signaling pathway.	Chloroquine	51-62	catenin beta 1	Homo sapiens	171-183
28337019-6	2017	Treatment with autophagy inhibitors wortmannin and chloroquine compromised this effect, substantiating the involvement of autophagy-lysosomal system on the degradation of beta-catenin during Wnt signaling through inhibition of the AKT/mTOR signaling pathway.	Chloroquine	51-62	AKT serine/threonine kinase 1	Homo sapiens	231-234
28337019-6	2017	Treatment with autophagy inhibitors wortmannin and chloroquine compromised this effect, substantiating the involvement of autophagy-lysosomal system on the degradation of beta-catenin during Wnt signaling through inhibition of the AKT/mTOR signaling pathway.	Chloroquine	51-62	mechanistic target of rapamycin kinase	Homo sapiens	235-239
28301876-6	2017	Through the detection of autophagy substrates p62 and LC3, found that QBC939 cells have a higher flow of autophagy, autophagy inhibitor chloroquine can significantly increase the sensitivity of cisplatin in cholangiocarcinoma cells compared with hepatocellular carcinoma HepG2 cells.	Chloroquine	136-147	microtubule associated protein 1 light chain 3 alpha	Homo sapiens	54-57
28259152-10	2017	As chloroquine is the chemoprophylactic drug recommended for travellers to India by the Anti Malaria Campaign of Sri Lanka, the costs of chemoprophylaxis for travellers for a 1-, 2- and 4-weeks stay in India on average are US$ 41,604, 48,538 and 62,407, respectively.	Chloroquine	3-14	sorcin	Homo sapiens	113-116
28062485-3	2017	In anesthetized spontaneously breathing rats, intratracheal instillation of T2R agonist chloroquine (10 mM, 0.1 ml) significantly augmented chemoreflexes evoked by right-atrial injection of capsaicin, a specific activator for transient receptor potential vanilloid receptor 1 (TRPV1), whereas intravenous infusion of chloroquine failed to significantly affect capsaicin-evoked reflexes.	Chloroquine	88-99	transient receptor potential cation channel, subfamily V, member 1	Rattus norvegicus	226-275
28062485-3	2017	In anesthetized spontaneously breathing rats, intratracheal instillation of T2R agonist chloroquine (10 mM, 0.1 ml) significantly augmented chemoreflexes evoked by right-atrial injection of capsaicin, a specific activator for transient receptor potential vanilloid receptor 1 (TRPV1), whereas intravenous infusion of chloroquine failed to significantly affect capsaicin-evoked reflexes.	Chloroquine	88-99	transient receptor potential cation channel, subfamily V, member 1	Rattus norvegicus	277-282
28062485-4	2017	In patch-clamp recordings with isolated rat vagal pulmonary sensory neurons, pretreatment with chloroquine (1-1,000 microM, 90 s) concentration dependently potentiated capsaicin-induced TRPV1-mediated inward currents.	Chloroquine	95-106	transient receptor potential cation channel, subfamily V, member 1	Rattus norvegicus	186-191
28263085-5	2017	CONCLUSION: Four hHDAC6 inhibitors showed submicromolar potency against both a chloroquine-sensitive and a chloroquine-resistant strain of Plasmodium falciparum with high selectivity indices, pointing to the relevance of exploring hHDAC6 inhibitors as potential new antiplasmodial agents.	Chloroquine	79-90	histone deacetylase 6	Homo sapiens	17-23
28131902-0	2017	CQ synergistically sensitizes human colorectal cancer cells to SN-38/CPT-11 through lysosomal and mitochondrial apoptotic pathway via p53-ROS cross-talk.	Chloroquine	0-2	tumor protein p53	Homo sapiens	134-137
28131902-4	2017	Notably, another autophagy inhibitor chloroquine (CQ) synergistically enhanced the anti-tumor activity of SN-38 in CRC cells with wild type (WT) p53.	Chloroquine	37-48	tumor protein p53	Homo sapiens	145-148
28131902-4	2017	Notably, another autophagy inhibitor chloroquine (CQ) synergistically enhanced the anti-tumor activity of SN-38 in CRC cells with wild type (WT) p53.	Chloroquine	50-52	tumor protein p53	Homo sapiens	145-148
28131902-5	2017	Subsequently, we identified a potential mechanism of this cooperative interaction by showing that CQ and SN-38 acted together to trigger reactive oxygen species (ROS) burst, upregulate p53 expression, elicit the loss of lysosomal membrane potential (LMP) and mitochondrial membrane potential ( psim).	Chloroquine	98-100	tumor protein p53	Homo sapiens	185-188
28263085-5	2017	CONCLUSION: Four hHDAC6 inhibitors showed submicromolar potency against both a chloroquine-sensitive and a chloroquine-resistant strain of Plasmodium falciparum with high selectivity indices, pointing to the relevance of exploring hHDAC6 inhibitors as potential new antiplasmodial agents.	Chloroquine	107-118	histone deacetylase 6	Homo sapiens	17-23
28131902-6	2017	In addition, ROS induced by CQ plus SN-38 upregulated p53 levels by activating p38, conversely, p53 stimulated ROS.	Chloroquine	28-30	tumor protein p53	Homo sapiens	54-57
28197638-10	2017	Interestingly, pretreatment with 3-MA and chloroquine remarkably suppressed CoCl2-induced caspase-3 activation and cell apoptosis.	Chloroquine	42-53	caspase 3	Homo sapiens	90-99
28131902-6	2017	In addition, ROS induced by CQ plus SN-38 upregulated p53 levels by activating p38, conversely, p53 stimulated ROS.	Chloroquine	28-30	mitogen-activated protein kinase 14	Homo sapiens	79-82
28131902-9	2017	Altogether, all results suggested that CQ synergistically sensitized human CRC cells with WT p53 to SN-38 through lysosomal and mitochondrial apoptotic pathway via p53-ROS cross-talk.	Chloroquine	39-41	tumor protein p53	Homo sapiens	93-96
28131902-9	2017	Altogether, all results suggested that CQ synergistically sensitized human CRC cells with WT p53 to SN-38 through lysosomal and mitochondrial apoptotic pathway via p53-ROS cross-talk.	Chloroquine	39-41	tumor protein p53	Homo sapiens	164-167
28367822-8	2017	In addition, inhibition of the autophagic flux with chloroquine inhibits the KRAS pro-tumor effect in the pancreas.	Chloroquine	52-63	KRAS proto-oncogene, GTPase	Homo sapiens	77-81
28179028-7	2017	Furthermore, VLP entry is dependent on low pH and cytoskeleton, demonstrated by inhibitor (chloroquine, ammonia chloride, cytochalasin D, wiskostatin, and nocodazole) perturbation.	Chloroquine	91-102	VHL like	Homo sapiens	13-16
28249048-4	2017	Specifically, chloroquine utilizes ataxia telangiectasia mutated (ATM) to phosphorylate the universal transcriptional corepressor Kruppel-associated Box-associated protein 1/tripartite motif-containing protein 28 (KAP1/TRIM28) at serine 824 -a mechanism that typically facilitates repair of double-strand breaks in heterochromatin, to instead activate EBV.	Chloroquine	14-25	ATM serine/threonine kinase	Homo sapiens	66-69
28249048-6	2017	These findings i) clarify chloroquine"s effect on EBV replication, ii) should energize field investigations into the connection between chloroquine and endemic Burkitt lymphoma and iii) provide a unique context in which ATM modifies KAP1 to regulate persistence of a herpesvirus in humans.	Chloroquine	26-37	ATM serine/threonine kinase	Homo sapiens	220-223
28082672-0	2017	NF-kappaB Signaling Activation Induced by Chloroquine Requires Autophagosome, p62 Protein, and c-Jun N-terminal Kinase (JNK) Signaling and Promotes Tumor Cell Resistance.	Chloroquine	42-53	nuclear factor kappa B subunit 1	Homo sapiens	0-9
28082672-0	2017	NF-kappaB Signaling Activation Induced by Chloroquine Requires Autophagosome, p62 Protein, and c-Jun N-terminal Kinase (JNK) Signaling and Promotes Tumor Cell Resistance.	Chloroquine	42-53	nucleoporin 62	Homo sapiens	78-81
28082672-0	2017	NF-kappaB Signaling Activation Induced by Chloroquine Requires Autophagosome, p62 Protein, and c-Jun N-terminal Kinase (JNK) Signaling and Promotes Tumor Cell Resistance.	Chloroquine	42-53	mitogen-activated protein kinase 8	Homo sapiens	95-118
28082672-0	2017	NF-kappaB Signaling Activation Induced by Chloroquine Requires Autophagosome, p62 Protein, and c-Jun N-terminal Kinase (JNK) Signaling and Promotes Tumor Cell Resistance.	Chloroquine	42-53	mitogen-activated protein kinase 8	Homo sapiens	120-123
28082672-5	2017	We show here that in both squamous cell carcinoma cells and melanoma tumor cells, CQ induced NF-kappaB activation and the expression of its target genes HIF-1alpha, IL-8, BCL-2, and BCL-XL through the accumulation of autophagosomes, p62, and JNK signaling.	Chloroquine	82-84	nuclear factor kappa B subunit 1	Homo sapiens	93-102
28082672-5	2017	We show here that in both squamous cell carcinoma cells and melanoma tumor cells, CQ induced NF-kappaB activation and the expression of its target genes HIF-1alpha, IL-8, BCL-2, and BCL-XL through the accumulation of autophagosomes, p62, and JNK signaling.	Chloroquine	82-84	hypoxia inducible factor 1 subunit alpha	Homo sapiens	153-163
28082672-5	2017	We show here that in both squamous cell carcinoma cells and melanoma tumor cells, CQ induced NF-kappaB activation and the expression of its target genes HIF-1alpha, IL-8, BCL-2, and BCL-XL through the accumulation of autophagosomes, p62, and JNK signaling.	Chloroquine	82-84	C-X-C motif chemokine ligand 8	Homo sapiens	165-169
28082672-5	2017	We show here that in both squamous cell carcinoma cells and melanoma tumor cells, CQ induced NF-kappaB activation and the expression of its target genes HIF-1alpha, IL-8, BCL-2, and BCL-XL through the accumulation of autophagosomes, p62, and JNK signaling.	Chloroquine	82-84	BCL2 apoptosis regulator	Homo sapiens	171-176
28082672-5	2017	We show here that in both squamous cell carcinoma cells and melanoma tumor cells, CQ induced NF-kappaB activation and the expression of its target genes HIF-1alpha, IL-8, BCL-2, and BCL-XL through the accumulation of autophagosomes, p62, and JNK signaling.	Chloroquine	82-84	BCL2 like 1	Homo sapiens	182-188
28082672-5	2017	We show here that in both squamous cell carcinoma cells and melanoma tumor cells, CQ induced NF-kappaB activation and the expression of its target genes HIF-1alpha, IL-8, BCL-2, and BCL-XL through the accumulation of autophagosomes, p62, and JNK signaling.	Chloroquine	82-84	nucleoporin 62	Homo sapiens	233-236
28082672-5	2017	We show here that in both squamous cell carcinoma cells and melanoma tumor cells, CQ induced NF-kappaB activation and the expression of its target genes HIF-1alpha, IL-8, BCL-2, and BCL-XL through the accumulation of autophagosomes, p62, and JNK signaling.	Chloroquine	82-84	mitogen-activated protein kinase 8	Homo sapiens	242-245
28082672-7	2017	Either genetic knockdown of p62 or inhibition of NF-kappaB sensitized tumor cells to CQ, resulting in increased apoptotic cell death following treatment.	Chloroquine	85-87	nucleoporin 62	Homo sapiens	28-31
28082672-7	2017	Either genetic knockdown of p62 or inhibition of NF-kappaB sensitized tumor cells to CQ, resulting in increased apoptotic cell death following treatment.	Chloroquine	85-87	nuclear factor kappa B subunit 1	Homo sapiens	49-58
28110817-6	2017	CQ and BQ could statically quench the fluorescence spectra by formation of an inhibitor-alpha-glucosidase complex.	Chloroquine	0-2	sucrase-isomaltase	Homo sapiens	88-105
28110817-7	2017	The interaction between CQ and alpha-glucosidase depended on hydrogen bonds, electrostatic and hydrophobic force, while the driving force of the binding between BQ and the enzyme was hydrophobic.	Chloroquine	24-26	sucrase-isomaltase	Homo sapiens	31-48
28110817-8	2017	The docking results showed that BQ was less active than CQ against alpha-glucosidase because of its weaker interaction with the enzyme.	Chloroquine	56-58	sucrase-isomaltase	Homo sapiens	67-84
28092859-3	2017	Chloroquine is a molecule with a confirmed safety history for use with pregnant women, and has been found to exhibit anti-ZIKV activity at concentrations around 10 muM.	Chloroquine	0-11	latexin	Homo sapiens	164-167
28243469-5	2017	We found that inhibition of NOS1 increased cell death resulting from siRNA or the use of pharmacologic agents; and this effect was reversed by the autophagy inhibitor, chloroquine.	Chloroquine	168-179	nitric oxide synthase 1	Homo sapiens	28-32
28218663-7	2017	Chloroquine (CQ) could further promote the expression of LC3 II/I and p62, increase the accumulation of autophagic vacuoles and promote cell injury induced by AGEs.	Chloroquine	0-11	microtubule associated protein 1 light chain 3 alpha	Homo sapiens	57-60
28218663-7	2017	Chloroquine (CQ) could further promote the expression of LC3 II/I and p62, increase the accumulation of autophagic vacuoles and promote cell injury induced by AGEs.	Chloroquine	0-11	nucleoporin 62	Homo sapiens	70-73
28218663-7	2017	Chloroquine (CQ) could further promote the expression of LC3 II/I and p62, increase the accumulation of autophagic vacuoles and promote cell injury induced by AGEs.	Chloroquine	13-15	microtubule associated protein 1 light chain 3 alpha	Homo sapiens	57-60
28218663-7	2017	Chloroquine (CQ) could further promote the expression of LC3 II/I and p62, increase the accumulation of autophagic vacuoles and promote cell injury induced by AGEs.	Chloroquine	13-15	nucleoporin 62	Homo sapiens	70-73
28070729-7	2017	Co-treatment with CI radiation and CQ could block autophagy through the IRE1/JNK/Beclin-1 axis and enhance apoptotic cell death via the activation of C/EBP homologous protein (CHOP) by the IRE1 pathway rather than PERK in vitro and in vivo.	Chloroquine	35-37	endoplasmic reticulum (ER) to nucleus signalling 2	Mus musculus	72-76
27623761-4	2017	Therefore, we hypothesized that lysosomotropic agent chloroquine (CQ) would impair TLR9 signaling, as well as prevent the development of hypertension and immune cell recruitment to the vasculature, in SHR.	Chloroquine	53-64	toll-like receptor 9	Rattus norvegicus	83-87
27623761-4	2017	Therefore, we hypothesized that lysosomotropic agent chloroquine (CQ) would impair TLR9 signaling, as well as prevent the development of hypertension and immune cell recruitment to the vasculature, in SHR.	Chloroquine	66-68	toll-like receptor 9	Rattus norvegicus	83-87
27623761-8	2017	RESULTS: In MRA from adult SHR, CQ increased the expression of MyD88-dependent proteins, whereas young SHR MRA exhibited a decrease.	Chloroquine	32-34	MYD88, innate immune signal transduction adaptor	Rattus norvegicus	63-68
28085543-5	2017	Furthermore, autophagy inhibition by chloroquine treatment or ATG7 small interfering RNA (siRNA) transfection, upregulated DNM1L expression and triggered DNM1L-mediated mitochondrial fragmentation.	Chloroquine	37-48	dynamin 1-like	Mus musculus	123-128
28085543-5	2017	Furthermore, autophagy inhibition by chloroquine treatment or ATG7 small interfering RNA (siRNA) transfection, upregulated DNM1L expression and triggered DNM1L-mediated mitochondrial fragmentation.	Chloroquine	37-48	dynamin 1-like	Mus musculus	154-159
28169350-0	2017	Chloroquine inhibits human CD4+ T-cell activation by AP-1 signaling modulation.	Chloroquine	0-11	CD4 molecule	Homo sapiens	27-30
28169350-3	2017	Thus, we evaluated the influence of CQ on activation parameters of human CD4+ T-cells.	Chloroquine	36-38	CD4 molecule	Homo sapiens	73-76
28169350-9	2017	Analyses of intracellular signaling showed that CQ specifically inhibited autophagic flux and additionally activation of AP-1 by reducing phosphorylation of c-JUN.	Chloroquine	48-50	Jun proto-oncogene, AP-1 transcription factor subunit	Homo sapiens	157-162
28169350-11	2017	In summary, we characterized selective and reversible immunomodulatory effects of CQ on human CD4+ T-cells.	Chloroquine	82-84	CD4 molecule	Homo sapiens	94-97
28169350-12	2017	These findings provide new insights into the biological actions of JNK/AP-1 signaling in T-cells and may help to expand the therapeutic spectrum of CQ.	Chloroquine	148-150	mitogen-activated protein kinase 8	Homo sapiens	67-70
28070729-7	2017	Co-treatment with CI radiation and CQ could block autophagy through the IRE1/JNK/Beclin-1 axis and enhance apoptotic cell death via the activation of C/EBP homologous protein (CHOP) by the IRE1 pathway rather than PERK in vitro and in vivo.	Chloroquine	35-37	mitogen-activated protein kinase 8	Mus musculus	77-80
28070729-7	2017	Co-treatment with CI radiation and CQ could block autophagy through the IRE1/JNK/Beclin-1 axis and enhance apoptotic cell death via the activation of C/EBP homologous protein (CHOP) by the IRE1 pathway rather than PERK in vitro and in vivo.	Chloroquine	35-37	beclin 1, autophagy related	Mus musculus	81-89
28070729-7	2017	Co-treatment with CI radiation and CQ could block autophagy through the IRE1/JNK/Beclin-1 axis and enhance apoptotic cell death via the activation of C/EBP homologous protein (CHOP) by the IRE1 pathway rather than PERK in vitro and in vivo.	Chloroquine	35-37	DNA-damage inducible transcript 3	Mus musculus	150-174
28070729-7	2017	Co-treatment with CI radiation and CQ could block autophagy through the IRE1/JNK/Beclin-1 axis and enhance apoptotic cell death via the activation of C/EBP homologous protein (CHOP) by the IRE1 pathway rather than PERK in vitro and in vivo.	Chloroquine	35-37	DNA-damage inducible transcript 3	Mus musculus	176-180
28070729-7	2017	Co-treatment with CI radiation and CQ could block autophagy through the IRE1/JNK/Beclin-1 axis and enhance apoptotic cell death via the activation of C/EBP homologous protein (CHOP) by the IRE1 pathway rather than PERK in vitro and in vivo.	Chloroquine	35-37	endoplasmic reticulum (ER) to nucleus signalling 2	Mus musculus	189-193
28070729-7	2017	Co-treatment with CI radiation and CQ could block autophagy through the IRE1/JNK/Beclin-1 axis and enhance apoptotic cell death via the activation of C/EBP homologous protein (CHOP) by the IRE1 pathway rather than PERK in vitro and in vivo.	Chloroquine	35-37	eukaryotic translation initiation factor 2 alpha kinase 3	Mus musculus	214-218
28163383-8	2017	Furthermore, indomethacin-induced Smad7 degradation through ubiquitin-proteasome pathway was relevant to increased cytotoxicity, while chloroquine as autophagy inhibitor significantly attenuated indomethacin-induced cytotoxicity through Smad7 preservation via repressed ubiquitination.	Chloroquine	135-146	SMAD family member 7	Rattus norvegicus	237-242
28146103-3	2017	In this study, we hypothesized that human quinone reductase 2 (hQR2), known to act as a flavin redox switch upon binding to the broadly used antimalarial chloroquine, could be involved in the activity of the redox-active indolone derivatives.	Chloroquine	154-165	N-ribosyldihydronicotinamide:quinone reductase 2	Homo sapiens	42-61
28146103-3	2017	In this study, we hypothesized that human quinone reductase 2 (hQR2), known to act as a flavin redox switch upon binding to the broadly used antimalarial chloroquine, could be involved in the activity of the redox-active indolone derivatives.	Chloroquine	154-165	N-ribosyldihydronicotinamide:quinone reductase 2	Homo sapiens	63-67
28981387-9	2017	HLTF overexpression blunted the antitumor efficacy of chloroquine derivatives in vitro and in vivo.	Chloroquine	54-65	helicase like transcription factor	Homo sapiens	0-4
29224002-9	2017	RESULTS: Inhibition of autophagy by the administration of chloroquine prevented the development of HPH in the rat model, as evidenced by significantly reduced mPAP and RVP, as well as decreased autophagy.	Chloroquine	58-69	phospholipid phosphatase 1	Mus musculus	159-163
28106079-3	2017	A screen of small molecule metabolism modulators identified combinatorial activity between a Chk1 inhibitor and chloroquine or the LDHA/LDHB inhibitor GSK 2837808A.	Chloroquine	112-123	checkpoint kinase 1	Homo sapiens	93-97
28076793-0	2017	Chloroquine-Inducible Par-4 Secretion Is Essential for Tumor Cell Apoptosis and Inhibition of Metastasis.	Chloroquine	0-11	Prader Willi/Angelman region RNA 4	Homo sapiens	22-27
28076793-2	2017	We report that the anti-malarial drug, chloroquine (CQ), is a robust inducer of Par-4 secretion from normal cells in mice and cancer patients in a clinical trial.	Chloroquine	39-50	PRKC, apoptosis, WT1, regulator	Mus musculus	80-85
28076793-2	2017	We report that the anti-malarial drug, chloroquine (CQ), is a robust inducer of Par-4 secretion from normal cells in mice and cancer patients in a clinical trial.	Chloroquine	52-54	PRKC, apoptosis, WT1, regulator	Mus musculus	80-85
28076793-3	2017	CQ-inducible Par-4 secretion triggers paracrine apoptosis of cancer cells and also inhibits metastatic tumor growth.	Chloroquine	0-2	Prader Willi/Angelman region RNA 4	Homo sapiens	13-18
28076793-4	2017	CQ induces Par-4 secretion via the classical secretory pathway that requires the activation of p53.	Chloroquine	0-2	Prader Willi/Angelman region RNA 4	Homo sapiens	11-16
28076793-4	2017	CQ induces Par-4 secretion via the classical secretory pathway that requires the activation of p53.	Chloroquine	0-2	tumor protein p53	Homo sapiens	95-98
28076793-6	2017	Our findings indicate that CQ induces p53- and Rab8b-dependent Par-4 secretion from normal cells for Par-4-dependent inhibition of metastatic tumor growth.	Chloroquine	27-29	tumor protein p53	Homo sapiens	38-41
28076793-6	2017	Our findings indicate that CQ induces p53- and Rab8b-dependent Par-4 secretion from normal cells for Par-4-dependent inhibition of metastatic tumor growth.	Chloroquine	27-29	RAB8B, member RAS oncogene family	Homo sapiens	47-52
28076793-6	2017	Our findings indicate that CQ induces p53- and Rab8b-dependent Par-4 secretion from normal cells for Par-4-dependent inhibition of metastatic tumor growth.	Chloroquine	27-29	Prader Willi/Angelman region RNA 4	Homo sapiens	63-68
28076793-6	2017	Our findings indicate that CQ induces p53- and Rab8b-dependent Par-4 secretion from normal cells for Par-4-dependent inhibition of metastatic tumor growth.	Chloroquine	27-29	Prader Willi/Angelman region RNA 4	Homo sapiens	101-106
28381809-8	2017	This coumestrol-induced reduction in tyrosinase protein levels was prevented by pretreatment with the proteasome inhibitor MG-132 or the lysosomal proteolysis inhibitor chloroquine.	Chloroquine	169-180	tyrosinase	Mus musculus	37-47
27733684-8	2016	Claudin-1 and -2 were mainly distributed in the cytosol and tight junctions (TJs) in the chloroquine- and monodansylcadaverine-treated cells, respectively.	Chloroquine	89-100	claudin 1	Canis lupus familiaris	0-16
27925633-9	2017	SW-induced angiogenesis, which was accompanied by increased VEGFR2 protein expression without transcriptional change, was suppressed by chloroquine and Rab11a silencing.	Chloroquine	136-147	kinase insert domain protein receptor	Mus musculus	60-66
27473763-1	2016	Chloroquine (CQ) is a widely used antimalarial drug with emerging potential in anticancer therapies due to its apparent inhibitory effects on CXCR4 chemokine receptor, autophagy, and cholesterol metabolism.	Chloroquine	0-11	chemokine (C-X-C motif) receptor 4	Mus musculus	142-147
27473763-1	2016	Chloroquine (CQ) is a widely used antimalarial drug with emerging potential in anticancer therapies due to its apparent inhibitory effects on CXCR4 chemokine receptor, autophagy, and cholesterol metabolism.	Chloroquine	13-15	chemokine (C-X-C motif) receptor 4	Mus musculus	142-147
27863375-5	2016	The Bax/Bcl-2 ratio increased after 12 h of exposure to LY294002 or CQ.	Chloroquine	68-70	apoptosis regulator BAX	Heterocephalus glaber	4-7
27863375-5	2016	The Bax/Bcl-2 ratio increased after 12 h of exposure to LY294002 or CQ.	Chloroquine	68-70	apoptosis regulator Bcl-2	Heterocephalus glaber	8-13
27863375-7	2016	Furthermore, LY294002 or CQ treatment decreased caspase-3, p53, and HIF1-alpha levels, suggesting that serum starvation or H2O2 treatment increase autophagy and apoptosis in NMR skin fibroblasts by inhibiting the PI3K/Akt pathway.	Chloroquine	25-27	caspase-3	Heterocephalus glaber	48-57
27863375-7	2016	Furthermore, LY294002 or CQ treatment decreased caspase-3, p53, and HIF1-alpha levels, suggesting that serum starvation or H2O2 treatment increase autophagy and apoptosis in NMR skin fibroblasts by inhibiting the PI3K/Akt pathway.	Chloroquine	25-27	hypoxia-inducible factor 1-alpha	Heterocephalus glaber	68-78
27811372-5	2016	Moreover, blocking autophagy using pharmacological inhibitors 3-methyladenine (3-MA) and chloroquine (CQ) enhanced Ru1-induced apoptosis, indicating the cytoprotective role of autophagy in Ru1-treated A549 and NCI-H460 cells.	Chloroquine	89-100	Scm like with four mbt domains 1	Homo sapiens	115-118
27811372-5	2016	Moreover, blocking autophagy using pharmacological inhibitors 3-methyladenine (3-MA) and chloroquine (CQ) enhanced Ru1-induced apoptosis, indicating the cytoprotective role of autophagy in Ru1-treated A549 and NCI-H460 cells.	Chloroquine	89-100	Scm like with four mbt domains 1	Homo sapiens	189-192
27811372-5	2016	Moreover, blocking autophagy using pharmacological inhibitors 3-methyladenine (3-MA) and chloroquine (CQ) enhanced Ru1-induced apoptosis, indicating the cytoprotective role of autophagy in Ru1-treated A549 and NCI-H460 cells.	Chloroquine	102-104	Scm like with four mbt domains 1	Homo sapiens	115-118
27811372-5	2016	Moreover, blocking autophagy using pharmacological inhibitors 3-methyladenine (3-MA) and chloroquine (CQ) enhanced Ru1-induced apoptosis, indicating the cytoprotective role of autophagy in Ru1-treated A549 and NCI-H460 cells.	Chloroquine	102-104	Scm like with four mbt domains 1	Homo sapiens	189-192
27733367-11	2016	Moreover, AQP2 protein abundance was decreased to a greater extent during the withdrawal period after dDAVP stimulation under Vps35 knockdown, which was significantly inhibited by chloroquine (a blocker of the lysosomal pathway) but not by MG132 (a proteasome inhibitor).	Chloroquine	180-191	aquaporin 2	Rattus norvegicus	10-14
27733367-11	2016	Moreover, AQP2 protein abundance was decreased to a greater extent during the withdrawal period after dDAVP stimulation under Vps35 knockdown, which was significantly inhibited by chloroquine (a blocker of the lysosomal pathway) but not by MG132 (a proteasome inhibitor).	Chloroquine	180-191	VPS35 retromer complex component	Rattus norvegicus	126-131
27770439-7	2016	CQ, an anti-malarial drug defined as a histamine-independent pruritogen, selectively enhanced the sustained phase of ASIC3 current in a concentration-dependent manner either in ASIC3-transfected Chinese hamster ovary cells or in primary cultured rat dorsal root ganglion neurons.	Chloroquine	0-2	acid-sensing ion channel 3	Cricetulus griseus	117-122
27770439-7	2016	CQ, an anti-malarial drug defined as a histamine-independent pruritogen, selectively enhanced the sustained phase of ASIC3 current in a concentration-dependent manner either in ASIC3-transfected Chinese hamster ovary cells or in primary cultured rat dorsal root ganglion neurons.	Chloroquine	0-2	acid-sensing ion channel 3	Cricetulus griseus	177-182
27770439-8	2016	Further studies revealed that the effect of CQ on ASIC3 channels depends on the newly identified non-proton ligand-sensing domain.	Chloroquine	44-46	acid sensing ion channel subunit 3	Rattus norvegicus	50-55
27770439-9	2016	Importantly, CQ-evoked scratching behavior was largely alleviated by APETx2, a selective ASIC3 channel blocker.	Chloroquine	13-15	acid sensing ion channel subunit 3	Rattus norvegicus	89-94
27770439-10	2016	Like CQ, other compounds such as amiloride, 2-guanidine-4-methylquinazoline and neuropeptide FF, which have been previously reported to be non-proton ligands that activate ASIC3, undoubtedly evoked the scratching response.	Chloroquine	5-7	acid sensing ion channel subunit 3	Rattus norvegicus	172-177
27692344-7	2016	Furthermore, experiments revealed that co-treatment of carboplatin and autophagy inhibitor chloroquine increased lung tissue infiltration by CD4+, FoxP3+ lymphocytes and antigen-specific immune activation.	Chloroquine	91-102	forkhead box P3	Homo sapiens	147-152
28024468-4	2016	RESULTS: Both IDO and TLR9 mRNA were expressed in HL-60 and K562 cells; IFN-gamma increased the expression and activity of IDO in a concentration-dependent manner; Talpha1 decreased the expression and activity of IDO in a concentration-dependent manner; the up-regulation of IFN-gamma on IDO induced expression and activity had been weakened by Talpha1(P&lt;0.01); Chloroquine had no effect on the expression of IDO.	Chloroquine	365-376	indoleamine 2,3-dioxygenase 1	Homo sapiens	14-17
28024468-4	2016	RESULTS: Both IDO and TLR9 mRNA were expressed in HL-60 and K562 cells; IFN-gamma increased the expression and activity of IDO in a concentration-dependent manner; Talpha1 decreased the expression and activity of IDO in a concentration-dependent manner; the up-regulation of IFN-gamma on IDO induced expression and activity had been weakened by Talpha1(P&lt;0.01); Chloroquine had no effect on the expression of IDO.	Chloroquine	365-376	toll like receptor 9	Homo sapiens	22-26
28024468-4	2016	RESULTS: Both IDO and TLR9 mRNA were expressed in HL-60 and K562 cells; IFN-gamma increased the expression and activity of IDO in a concentration-dependent manner; Talpha1 decreased the expression and activity of IDO in a concentration-dependent manner; the up-regulation of IFN-gamma on IDO induced expression and activity had been weakened by Talpha1(P&lt;0.01); Chloroquine had no effect on the expression of IDO.	Chloroquine	365-376	interferon gamma	Homo sapiens	72-81
28024468-4	2016	RESULTS: Both IDO and TLR9 mRNA were expressed in HL-60 and K562 cells; IFN-gamma increased the expression and activity of IDO in a concentration-dependent manner; Talpha1 decreased the expression and activity of IDO in a concentration-dependent manner; the up-regulation of IFN-gamma on IDO induced expression and activity had been weakened by Talpha1(P&lt;0.01); Chloroquine had no effect on the expression of IDO.	Chloroquine	365-376	indoleamine 2,3-dioxygenase 1	Homo sapiens	123-126
28024468-4	2016	RESULTS: Both IDO and TLR9 mRNA were expressed in HL-60 and K562 cells; IFN-gamma increased the expression and activity of IDO in a concentration-dependent manner; Talpha1 decreased the expression and activity of IDO in a concentration-dependent manner; the up-regulation of IFN-gamma on IDO induced expression and activity had been weakened by Talpha1(P&lt;0.01); Chloroquine had no effect on the expression of IDO.	Chloroquine	365-376	indoleamine 2,3-dioxygenase 1	Homo sapiens	123-126
28024468-4	2016	RESULTS: Both IDO and TLR9 mRNA were expressed in HL-60 and K562 cells; IFN-gamma increased the expression and activity of IDO in a concentration-dependent manner; Talpha1 decreased the expression and activity of IDO in a concentration-dependent manner; the up-regulation of IFN-gamma on IDO induced expression and activity had been weakened by Talpha1(P&lt;0.01); Chloroquine had no effect on the expression of IDO.	Chloroquine	365-376	indoleamine 2,3-dioxygenase 1	Homo sapiens	123-126
28024468-4	2016	RESULTS: Both IDO and TLR9 mRNA were expressed in HL-60 and K562 cells; IFN-gamma increased the expression and activity of IDO in a concentration-dependent manner; Talpha1 decreased the expression and activity of IDO in a concentration-dependent manner; the up-regulation of IFN-gamma on IDO induced expression and activity had been weakened by Talpha1(P&lt;0.01); Chloroquine had no effect on the expression of IDO.	Chloroquine	365-376	indoleamine 2,3-dioxygenase 1	Homo sapiens	123-126
28024468-5	2016	The expression of TLR9 in HL-60 cells and K562 cells cocultured with IFN-gamma,Talpha1,IFN-gamma+Talpha1 and chloroquine was not significantly changed.	Chloroquine	109-120	toll like receptor 9	Homo sapiens	18-22
28321151-0	2017	The Antimalarial Chloroquine Suppresses LPS-Induced NLRP3 Inflammasome Activation and Confers Protection against Murine Endotoxic Shock.	Chloroquine	17-28	NLR family, pyrin domain containing 3	Mus musculus	52-57
28321151-3	2017	In this study, we investigated whether CQ suppresses NLRP3 inflammasome activation and thereby confers protection against murine endotoxic shock.	Chloroquine	39-41	NLR family, pyrin domain containing 3	Mus musculus	53-58
28321151-4	2017	CQ attenuated NF-kappaB and MAPK activation and prohibited expression of IL-1beta, IL-18, and Nlrp3 in LPS treated murine bone marrow-derived macrophages (BMDMs), demonstrating its inhibitory effect on the priming signal of NLRP3 activation.	Chloroquine	0-2	interleukin 1 beta	Mus musculus	73-81
28321151-4	2017	CQ attenuated NF-kappaB and MAPK activation and prohibited expression of IL-1beta, IL-18, and Nlrp3 in LPS treated murine bone marrow-derived macrophages (BMDMs), demonstrating its inhibitory effect on the priming signal of NLRP3 activation.	Chloroquine	0-2	interleukin 18	Mus musculus	83-88
28321151-4	2017	CQ attenuated NF-kappaB and MAPK activation and prohibited expression of IL-1beta, IL-18, and Nlrp3 in LPS treated murine bone marrow-derived macrophages (BMDMs), demonstrating its inhibitory effect on the priming signal of NLRP3 activation.	Chloroquine	0-2	NLR family, pyrin domain containing 3	Mus musculus	94-99
28321151-4	2017	CQ attenuated NF-kappaB and MAPK activation and prohibited expression of IL-1beta, IL-18, and Nlrp3 in LPS treated murine bone marrow-derived macrophages (BMDMs), demonstrating its inhibitory effect on the priming signal of NLRP3 activation.	Chloroquine	0-2	NLR family, pyrin domain containing 3	Mus musculus	224-229
28321151-5	2017	Then, CQ was shown to inhibit caspase-1 activation and ASC specks formation in BMDMs, which indicates that CQ also suppresses inflammasome assembly, the second signal for NLRP3 inflammasome activation.	Chloroquine	6-8	NLR family, pyrin domain containing 3	Mus musculus	171-176
28321151-6	2017	In a murine endotoxic shock model, CQ effectively improved survival and markedly reduced IL-1beta and IL-18 production in serum, peritoneal fluid, and lung tissues.	Chloroquine	35-37	interleukin 1 beta	Mus musculus	89-97
28321151-6	2017	In a murine endotoxic shock model, CQ effectively improved survival and markedly reduced IL-1beta and IL-18 production in serum, peritoneal fluid, and lung tissues.	Chloroquine	35-37	interleukin 18	Mus musculus	102-107
28321151-8	2017	Overall, our results demonstrate a new role of CQ that facilitates negative regulation on NLRP3 inflammasome, which thereby confers protection against lethal endotoxic shock.	Chloroquine	47-49	NLR family, pyrin domain containing 3	Mus musculus	90-95
27779641-6	2016	Furthermore, pretreatment with the autophagy inhibitor chloroquine or 3-methyladenine showed the potential in attenuating the apoptosis rate induced by Sal B. Mechanistically, Sal B treatment inhibited the AKT/mTOR signaling cascade in vitro.	Chloroquine	55-66	AKT serine/threonine kinase 1	Homo sapiens	206-209
27779641-6	2016	Furthermore, pretreatment with the autophagy inhibitor chloroquine or 3-methyladenine showed the potential in attenuating the apoptosis rate induced by Sal B. Mechanistically, Sal B treatment inhibited the AKT/mTOR signaling cascade in vitro.	Chloroquine	55-66	mechanistic target of rapamycin kinase	Homo sapiens	210-214
27667695-6	2016	The accumulation of LC3-II and p62 increased further when complementing MeHg with autophagy inhibitor, chloroquine.	Chloroquine	103-114	nucleoporin 62	Mus musculus	31-34
27833900-6	2016	In addition, the treatment of these mice with chloroquine, an inhibitor of autophagic flux, reverses the effects of VMP1 in pancreatic cancer induced by the KRAS oncogene.	Chloroquine	46-57	vacuole membrane protein 1	Mus musculus	116-120
27867537-9	2016	Chloroquine (CQ), an autophagy inhibitor, enhanced the cytotoxicity of cDDP in GC cells, and CQ reversed the chemoresistance to cDDP caused by AQP3 overexpression in GC cells.	Chloroquine	0-11	aquaporin 3 (Gill blood group)	Homo sapiens	143-147
27867537-9	2016	Chloroquine (CQ), an autophagy inhibitor, enhanced the cytotoxicity of cDDP in GC cells, and CQ reversed the chemoresistance to cDDP caused by AQP3 overexpression in GC cells.	Chloroquine	13-15	aquaporin 3 (Gill blood group)	Homo sapiens	143-147
27867537-9	2016	Chloroquine (CQ), an autophagy inhibitor, enhanced the cytotoxicity of cDDP in GC cells, and CQ reversed the chemoresistance to cDDP caused by AQP3 overexpression in GC cells.	Chloroquine	93-95	aquaporin 3 (Gill blood group)	Homo sapiens	143-147
27809838-5	2016	METHODS: ATP-dependent DNA helicase gene (PfRuvB3) of Plasmodium falciparum strain K1, a chloroquine and pyrimethamine-resistant strain, was inserted into pQE-TriSystem His-Strep 2 vector, heterologously expressed and affinity purified.	Chloroquine	89-100	helicase for meiosis 1	Homo sapiens	27-35
27565383-8	2016	Chloroquine also enhanced carfilzomib-induced calreticulin exposure in MM cells undergoing apoptosis, increasing the immunogenic ability of carfilzomib.	Chloroquine	0-11	calreticulin	Mus musculus	46-58
27655758-12	2016	Hepcidin significantly reduced biotinylated cell surface ZnT1 compared with control cells (P &lt; 0.05); chloroquine inhibited hepcidin-mediated degradation of ZnT1 (P &gt;= 0.05), whereas MG132 had no effect (P &lt; 0.05).	Chloroquine	105-116	hepcidin antimicrobial peptide	Homo sapiens	127-135
27655758-12	2016	Hepcidin significantly reduced biotinylated cell surface ZnT1 compared with control cells (P &lt; 0.05); chloroquine inhibited hepcidin-mediated degradation of ZnT1 (P &gt;= 0.05), whereas MG132 had no effect (P &lt; 0.05).	Chloroquine	105-116	solute carrier family 30 member 1	Homo sapiens	160-164
27793909-3	2016	MATERIALS AND METHODS: The anti-malarial drugs chloroquine (CHL), mefloquine (MEF) and primaquine (PRI) have been shown to increase sensitization in drug-resistant KBV20C cells via P-gp inhibition.	Chloroquine	47-58	ATP binding cassette subfamily B member 1	Homo sapiens	181-185
27793909-3	2016	MATERIALS AND METHODS: The anti-malarial drugs chloroquine (CHL), mefloquine (MEF) and primaquine (PRI) have been shown to increase sensitization in drug-resistant KBV20C cells via P-gp inhibition.	Chloroquine	60-63	ATP binding cassette subfamily B member 1	Homo sapiens	181-185
27833900-6	2016	In addition, the treatment of these mice with chloroquine, an inhibitor of autophagic flux, reverses the effects of VMP1 in pancreatic cancer induced by the KRAS oncogene.	Chloroquine	46-57	Kirsten rat sarcoma viral oncogene homolog	Mus musculus	157-161
27771855-16	2016	Western blot showed that CQ might suppress angiogenesis by downregulating p-Akt, Jagged1, and Ang2 in HUVECs.	Chloroquine	25-27	jagged 1	Mus musculus	81-88
27771855-16	2016	Western blot showed that CQ might suppress angiogenesis by downregulating p-Akt, Jagged1, and Ang2 in HUVECs.	Chloroquine	25-27	angiogenin, ribonuclease A family, member 2	Mus musculus	94-98
27618912-5	2016	RESULTS: Both CQ and QN significantly inhibited the activity of CYP2D6.	Chloroquine	14-16	cytochrome P450 family 2 subfamily D member 6	Homo sapiens	64-70
27799074-5	2016	In human AVM muscle, sequestration of Keap1 into the SQSTM1-positive protein aggregates was accompanied by an increase in mRNA and protein levels of Nrf2 target genes; similarly, treatment of differentiated C2C12 myotubes with autophagy inhibitor chloroquine led to an increase in the nuclear Nrf2 protein level and an increase in expression of the Nrf2-regulated genes.	Chloroquine	247-258	kelch like ECH associated protein 1	Homo sapiens	38-43
27422716-6	2016	Scratching behaviors evoked by chloroquine were inhibited by the NMDA receptor antagonists D-AP5 and CP101,606 and by the Src kinase inhibitor PP2.	Chloroquine	31-42	neuropeptide Y receptor Y6	Mus musculus	143-146
27620077-6	2016	Indeed, autophagy inhibition by chloroquine partially restored c-Myc expression in EBV-positive (Akata) and EBV-negative (2A8) cells that harbor c-Myc mutation.	Chloroquine	32-43	MYC proto-oncogene, bHLH transcription factor	Homo sapiens	63-68
27620077-6	2016	Indeed, autophagy inhibition by chloroquine partially restored c-Myc expression in EBV-positive (Akata) and EBV-negative (2A8) cells that harbor c-Myc mutation.	Chloroquine	32-43	MYC proto-oncogene, bHLH transcription factor	Homo sapiens	145-150
27679638-8	2016	Blocking hepatic autophagy activity with chloroquine diminished the differences in T cell activation and liver injury between Con A-injected WT and fat-1 transgenic mice.	Chloroquine	41-52	FAT atypical cadherin 1	Mus musculus	148-153
27618912-2	2016	However, both CQ and QN are considered effective, although perhaps moderate inhibitors of CYP2D6, an enzyme now regarded as necessary for primaquine (PQ) pharmacologic activity.	Chloroquine	14-16	cytochrome P450 family 2 subfamily D member 6	Homo sapiens	90-96
27618912-7	2016	CYP2D6-mediated hydroxylation was largely suppressed by both CQ and QN.	Chloroquine	61-63	cytochrome P450 family 2 subfamily D member 6	Homo sapiens	0-6
27506940-4	2016	DR5, which is essential for 5-FU-induced apoptosis, accumulated in lysosomes and autophagosomes upon chloroquine treatment.	Chloroquine	101-112	TNF receptor superfamily member 10b	Homo sapiens	0-3
27506940-8	2016	We conclude that targeting of lysosomes by chloroquine deregulates DR5 trafficking and abrogates 5-FU- but not TRAIL-stimulated cell elimination, hence suggesting a novel mechanism for receptor activation.	Chloroquine	43-54	TNF receptor superfamily member 10b	Homo sapiens	67-70
27621594-7	2016	In addition, CQ decreased the autophagolysosomes, cardiomyocyte apoptosis, and cardiac fibrosis but increased LC3-II and p62 expressions.	Chloroquine	13-15	nucleoporin 62	Mus musculus	121-124
27599722-8	2016	METHODS: p53 levels were analysed by western blot upon capsaicin treatment in the presence of the autophagy inhibitor chloroquine.	Chloroquine	118-129	tumor protein p53	Homo sapiens	9-12
27575054-0	2016	Correction: Influence of LAR and VAR on Para-Aminopyridine Antimalarials Targetting Haematin in Chloroquine-Resistance.	Chloroquine	96-107	protein tyrosine phosphatase receptor type F	Homo sapiens	25-28
29263493-12	2016	At the same time, the result of sunitinib combined with chloroquine, a drug which blocked the fusion of autophagosomes and lysosomes, demonstrated that the increasing amount of LC3-II was due to the enhanced autophagy flux by sunitinib treatment in ACHN cells.	Chloroquine	56-67	microtubule associated protein 1 light chain 3 alpha	Homo sapiens	177-180
27316542-3	2016	The most active compounds towards chloroquine sensitive Plasmodium strain 3D7 and chloroquine resistant strain Dd2 show IC50 values in the nanomolar range of concentration, low cytotoxicity and target the cysteine protease falcipain-2, which is essential for parasite growth.	Chloroquine	34-45	aldo-keto reductase family 1 member C2	Homo sapiens	111-114
27316542-3	2016	The most active compounds towards chloroquine sensitive Plasmodium strain 3D7 and chloroquine resistant strain Dd2 show IC50 values in the nanomolar range of concentration, low cytotoxicity and target the cysteine protease falcipain-2, which is essential for parasite growth.	Chloroquine	82-93	aldo-keto reductase family 1 member C2	Homo sapiens	111-114
27513923-4	2016	Studies with Atg5 small interfering RNA (siRNA) and the autophagy inhibitors bafilomycin A1 (Baf) and chloroquine demonstrate that autophagy is required for AGGF1-mediated EC proliferation, migration, capillary tube formation, and aortic ring-based angiogenesis.	Chloroquine	102-113	angiogenic factor with G patch and FHA domains 1	Mus musculus	157-162
27517960-9	2016	The blocking efficiency of pores formed by Iota b and C2IIa by the chloroquine analogs showed interesting differences indicating structural variations between the types of protein-conducting nanochannels formed by Iota b and C2IIa.	Chloroquine	67-78	endogenous retrovirus group K member 24	Homo sapiens	54-59
27517960-9	2016	The blocking efficiency of pores formed by Iota b and C2IIa by the chloroquine analogs showed interesting differences indicating structural variations between the types of protein-conducting nanochannels formed by Iota b and C2IIa.	Chloroquine	67-78	endogenous retrovirus group K member 24	Homo sapiens	225-230
27504984-6	2016	Chloroquine and Bay11-7082, inhibitors of TLR3 and NF-kappaB signaling, respectively, protected against the loss of claudin-5.	Chloroquine	0-11	toll like receptor 3	Homo sapiens	42-46
27504984-6	2016	Chloroquine and Bay11-7082, inhibitors of TLR3 and NF-kappaB signaling, respectively, protected against the loss of claudin-5.	Chloroquine	0-11	claudin 5	Homo sapiens	116-125
27431089-6	2016	By using CPH, the intralysosomal pH fluctuation stimulated by antimalaria drug chloroquine was successfully tracked in live cells through the ratiometric fluorescence images.	Chloroquine	79-90	carboxypeptidase E	Homo sapiens	9-12
27235577-4	2016	Electrophysiologically, 9.5% of chloroquine-responsive neurons responded to BNP, 33.3% to GRP, and 4.8% to both, indicating that almost half of chloroquine-responsive neurons were unresponsive to both BNP and GRP.	Chloroquine	32-43	natriuretic peptide B	Homo sapiens	76-79
27235577-4	2016	Electrophysiologically, 9.5% of chloroquine-responsive neurons responded to BNP, 33.3% to GRP, and 4.8% to both, indicating that almost half of chloroquine-responsive neurons were unresponsive to both BNP and GRP.	Chloroquine	32-43	gastrin releasing peptide	Homo sapiens	90-93
27235577-4	2016	Electrophysiologically, 9.5% of chloroquine-responsive neurons responded to BNP, 33.3% to GRP, and 4.8% to both, indicating that almost half of chloroquine-responsive neurons were unresponsive to both BNP and GRP.	Chloroquine	32-43	natriuretic peptide B	Homo sapiens	201-204
27235577-4	2016	Electrophysiologically, 9.5% of chloroquine-responsive neurons responded to BNP, 33.3% to GRP, and 4.8% to both, indicating that almost half of chloroquine-responsive neurons were unresponsive to both BNP and GRP.	Chloroquine	32-43	gastrin releasing peptide	Homo sapiens	209-212
27436359-3	2016	We showed that, in sensory neurons, TRPV4 is important for both chloroquine- and histamine-induced itch and that TRPV1 has a role in chloroquine-induced itch.	Chloroquine	133-144	transient receptor potential cation channel subfamily V member 1	Homo sapiens	113-118
27486024-8	2016	Administration of chloroquine alone, an IK1 channel antagonist, had no effect on all the parameters measured, but significantly blocked the beneficial effects of ZAC on cardiac repair.	Chloroquine	18-29	potassium calcium-activated channel subfamily N member 4	Homo sapiens	40-43
27467145-4	2016	Furthermore, because PQ is co-administered with chloroquine (CQ), we investigated whether CQ-impaired metabolism by cytochrome P-450 2C8 (CYP2C8) could also contribute to vivax recurrences.	Chloroquine	90-92	cytochrome P450 family 2 subfamily C member 8	Homo sapiens	116-136
27467145-4	2016	Furthermore, because PQ is co-administered with chloroquine (CQ), we investigated whether CQ-impaired metabolism by cytochrome P-450 2C8 (CYP2C8) could also contribute to vivax recurrences.	Chloroquine	90-92	cytochrome P450 family 2 subfamily C member 8	Homo sapiens	138-144
27467145-5	2016	Our results show that CYP2C8-mutated patients frequently relapsed early (&lt;42 days) and had a higher proportion of genetically similar parasites, suggesting the possibility of recrudescence due to CQ therapeutic failure.	Chloroquine	199-201	cytochrome P450 family 2 subfamily C member 8	Homo sapiens	22-28
27436359-2	2016	TRPV1 responds to the itch-inducing endogenous signal histamine, and TRPA1 responds to the itch-inducing chemical chloroquine.	Chloroquine	114-125	transient receptor potential cation channel subfamily A member 1	Homo sapiens	69-74
27436359-2	2016	TRPV1 responds to the itch-inducing endogenous signal histamine, and TRPA1 responds to the itch-inducing chemical chloroquine.	Chloroquine	114-125	itchy E3 ubiquitin protein ligase	Homo sapiens	91-95
27436359-3	2016	We showed that, in sensory neurons, TRPV4 is important for both chloroquine- and histamine-induced itch and that TRPV1 has a role in chloroquine-induced itch.	Chloroquine	133-144	itchy E3 ubiquitin protein ligase	Homo sapiens	153-157
27436359-3	2016	We showed that, in sensory neurons, TRPV4 is important for both chloroquine- and histamine-induced itch and that TRPV1 has a role in chloroquine-induced itch.	Chloroquine	64-75	transient receptor potential cation channel subfamily V member 4	Homo sapiens	36-41
27436359-3	2016	We showed that, in sensory neurons, TRPV4 is important for both chloroquine- and histamine-induced itch and that TRPV1 has a role in chloroquine-induced itch.	Chloroquine	64-75	itchy E3 ubiquitin protein ligase	Homo sapiens	99-103
27436359-4	2016	Chloroquine-induced scratching was reduced in mice in which TRPV1 was knocked down or pharmacologically inhibited.	Chloroquine	0-11	transient receptor potential cation channel, subfamily V, member 1	Mus musculus	60-65
27436359-6	2016	Pharmacological blockade of either TRPV4 or TRPV1 significantly attenuated the Ca(2+) response of sensory neurons exposed to histamine or chloroquine.	Chloroquine	138-149	transient receptor potential cation channel subfamily V member 4	Homo sapiens	35-40
27436359-6	2016	Pharmacological blockade of either TRPV4 or TRPV1 significantly attenuated the Ca(2+) response of sensory neurons exposed to histamine or chloroquine.	Chloroquine	138-149	transient receptor potential cation channel subfamily V member 1	Homo sapiens	44-49
27436359-10	2016	Thus, our studies identified TRPV4 as a channel that contributes to both histamine- and chloroquine-induced itch and indicated that the function of TRPV4 in itch signaling involves TRPV1-mediated facilitation.	Chloroquine	88-99	transient receptor potential cation channel subfamily V member 4	Homo sapiens	29-34
27436359-10	2016	Thus, our studies identified TRPV4 as a channel that contributes to both histamine- and chloroquine-induced itch and indicated that the function of TRPV4 in itch signaling involves TRPV1-mediated facilitation.	Chloroquine	88-99	itchy E3 ubiquitin protein ligase	Homo sapiens	108-112
27436359-10	2016	Thus, our studies identified TRPV4 as a channel that contributes to both histamine- and chloroquine-induced itch and indicated that the function of TRPV4 in itch signaling involves TRPV1-mediated facilitation.	Chloroquine	88-99	itchy E3 ubiquitin protein ligase	Homo sapiens	157-161
27436359-10	2016	Thus, our studies identified TRPV4 as a channel that contributes to both histamine- and chloroquine-induced itch and indicated that the function of TRPV4 in itch signaling involves TRPV1-mediated facilitation.	Chloroquine	88-99	transient receptor potential cation channel subfamily V member 1	Homo sapiens	181-186
27487279-8	2016	All these changes were further improved by TLR7 inhibition Chloroquine except Paller scores (p&lt;0.05).	Chloroquine	59-70	toll-like receptor 7	Rattus norvegicus	43-47
27385120-4	2016	Conversely, HCV particles are detected by macrophages, but not by monocytes and DCs, through a TLR7/8 dependent mechanism; this leads to chloroquine sensitive production of pro-inflammatory cytokines including IL-1beta, while the antiviral type I Interferon response is not triggered in these cells.	Chloroquine	137-148	toll like receptor 7	Homo sapiens	95-99
27385120-4	2016	Conversely, HCV particles are detected by macrophages, but not by monocytes and DCs, through a TLR7/8 dependent mechanism; this leads to chloroquine sensitive production of pro-inflammatory cytokines including IL-1beta, while the antiviral type I Interferon response is not triggered in these cells.	Chloroquine	137-148	interleukin 1 beta	Homo sapiens	210-218
27275542-6	2016	Combined treatment with chloroquine (CQ) and KB-R7943 decreased P62 and increased LC3-II protein levels in PC3 cells, indicating that KB-R7943 blocked autophagic flux.	Chloroquine	24-35	proprotein convertase subtilisin/kexin type 1	Homo sapiens	107-110
27275542-6	2016	Combined treatment with chloroquine (CQ) and KB-R7943 decreased P62 and increased LC3-II protein levels in PC3 cells, indicating that KB-R7943 blocked autophagic flux.	Chloroquine	37-39	proprotein convertase subtilisin/kexin type 1	Homo sapiens	107-110
26935044-5	2016	Combining the periods of chloroquine use in both arms of the on-ART cohort yielded a modest reduction in the proportions of CD8 T cells co-expressing CD38 and DR (median decrease = 3.0%, p = .003).	Chloroquine	25-36	CD38 molecule	Homo sapiens	150-154
27226588-6	2016	Although the proteasome-specific inhibitors lactacystin and epoxomicin only moderately increase FoxO1 protein levels, the inhibitors of lysosomal proteolysis bafilomycin A1 and chloroquine restore the decreased FoxO1 levels in Zfat-deficient T cells to levels comparable with those in control cells.	Chloroquine	177-188	forkhead box O1	Mus musculus	211-216
27226588-6	2016	Although the proteasome-specific inhibitors lactacystin and epoxomicin only moderately increase FoxO1 protein levels, the inhibitors of lysosomal proteolysis bafilomycin A1 and chloroquine restore the decreased FoxO1 levels in Zfat-deficient T cells to levels comparable with those in control cells.	Chloroquine	177-188	zinc finger and AT hook domain containing	Mus musculus	227-231
27415425-6	2016	Using chloroquine, an inhibitor of autophagy, we show that this drug antagonizes the effect of VMP1 on PanIN formation.	Chloroquine	6-17	vacuole membrane protein 1	Homo sapiens	95-99
27428937-8	2016	Pretreatment with chloroquine, an autophagy inhibitor, strongly augmented apoptosis in SNU-16 cells, as evidenced by decreased cell viability, an increased number of sub-G1 phase cells and increased levels of cleaved PARP.	Chloroquine	18-29	collagen type XI alpha 2 chain	Homo sapiens	217-221
26935044-7	2016	Transcriptional analyses in the off-ART cohort showed decreased expression of interferon-stimulated genes in 5 of 10 chloroquine-treated participants and modest decreases in CD38 and CCR5 RNAs in all chloroquine-treated participants.	Chloroquine	200-211	CD38 molecule	Homo sapiens	174-178
26434592-2	2016	By comparing the treatment effects of the antimalarials chloroquine (CQ) and quinacrine (Q) on KRAS mutant lung cancer cells, we demonstrate that inhibition of the oxidative arm of the pentose phosphate pathway (oxPPP) is required for antimalarial induced apoptosis.	Chloroquine	56-67	KRAS proto-oncogene, GTPase	Homo sapiens	95-99
26935044-7	2016	Transcriptional analyses in the off-ART cohort showed decreased expression of interferon-stimulated genes in 5 of 10 chloroquine-treated participants and modest decreases in CD38 and CCR5 RNAs in all chloroquine-treated participants.	Chloroquine	200-211	C-C motif chemokine receptor 5	Homo sapiens	183-187
27079946-7	2016	Chloroquine, a TLR7 inhibitor, and BAY 11-7082, an NF-kappaB inhibitor, reversed both the SZU101-induced antiviral effect and induction of cytokine genes and ISGs expression.	Chloroquine	0-11	toll like receptor 7	Homo sapiens	15-19
27250034-5	2016	In EAC cell lines, an increase in LC3B and p62 was observed with increasing concentrations of the autophagy inhibitor chloroquine, which indicates functional basal autophagy.	Chloroquine	118-129	microtubule associated protein 1 light chain 3 beta	Homo sapiens	34-38
27250034-5	2016	In EAC cell lines, an increase in LC3B and p62 was observed with increasing concentrations of the autophagy inhibitor chloroquine, which indicates functional basal autophagy.	Chloroquine	118-129	nucleoporin 62	Homo sapiens	43-46
27282478-12	2016	This protective effect of CQ was associated with a reduced expression of the inflammatory mediators interleukin-1beta, interleukin-6, and cyclooxygenase-2, while the levels of matrix metalloproteinases-2 and -9 were not modified.	Chloroquine	26-28	interleukin 1 beta	Mus musculus	100-117
27282478-12	2016	This protective effect of CQ was associated with a reduced expression of the inflammatory mediators interleukin-1beta, interleukin-6, and cyclooxygenase-2, while the levels of matrix metalloproteinases-2 and -9 were not modified.	Chloroquine	26-28	interleukin 6	Mus musculus	119-132
27282478-12	2016	This protective effect of CQ was associated with a reduced expression of the inflammatory mediators interleukin-1beta, interleukin-6, and cyclooxygenase-2, while the levels of matrix metalloproteinases-2 and -9 were not modified.	Chloroquine	26-28	prostaglandin-endoperoxide synthase 2	Mus musculus	138-154
27270268-0	2016	Spinal neurons that contain gastrin-releasing peptide seldom express Fos or phosphorylate extracellular signal-regulated kinases in response to intradermal chloroquine.	Chloroquine	156-167	gastrin releasing peptide	Mus musculus	28-53
27270268-0	2016	Spinal neurons that contain gastrin-releasing peptide seldom express Fos or phosphorylate extracellular signal-regulated kinases in response to intradermal chloroquine.	Chloroquine	156-167	mitogen-activated protein kinase 1	Mus musculus	90-128
27270268-1	2016	BACKGROUND: Gastrin-releasing peptide (GRP) is thought to play a role in the itch evoked by intradermal injection of chloroquine.	Chloroquine	117-128	gastrin releasing peptide	Mus musculus	12-37
27270268-1	2016	BACKGROUND: Gastrin-releasing peptide (GRP) is thought to play a role in the itch evoked by intradermal injection of chloroquine.	Chloroquine	117-128	gastrin releasing peptide	Mus musculus	39-42
27270268-3	2016	To test this hypothesis, we used the transcription factor Fos and phosphorylation of extracellular signal-regulated kinases (ERK) to look for evidence that interneurons expressing GRP were activated following intradermal injection of chloroquine into the calf, in mice that express enhanced green fluorescent protein (EGFP) in these cells.	Chloroquine	234-245	mitogen-activated protein kinase 1	Mus musculus	85-123
27270268-3	2016	To test this hypothesis, we used the transcription factor Fos and phosphorylation of extracellular signal-regulated kinases (ERK) to look for evidence that interneurons expressing GRP were activated following intradermal injection of chloroquine into the calf, in mice that express enhanced green fluorescent protein (EGFP) in these cells.	Chloroquine	234-245	mitogen-activated protein kinase 1	Mus musculus	125-128
27270268-3	2016	To test this hypothesis, we used the transcription factor Fos and phosphorylation of extracellular signal-regulated kinases (ERK) to look for evidence that interneurons expressing GRP were activated following intradermal injection of chloroquine into the calf, in mice that express enhanced green fluorescent protein (EGFP) in these cells.	Chloroquine	234-245	gastrin releasing peptide	Bos taurus	180-183
27270268-4	2016	RESULTS: Injection of chloroquine resulted in numerous Fos- or phospho-ERK (pERK) positive cells in the somatotopically appropriate part of the superficial dorsal horn.	Chloroquine	22-33	FBJ osteosarcoma oncogene	Mus musculus	55-58
27270268-4	2016	RESULTS: Injection of chloroquine resulted in numerous Fos- or phospho-ERK (pERK) positive cells in the somatotopically appropriate part of the superficial dorsal horn.	Chloroquine	22-33	mitogen-activated protein kinase 1	Mus musculus	71-74
27270268-8	2016	CONCLUSIONS: Both expression of Fos and phosphorylation of ERK can be used to identify dorsal horn neurons activated by chloroquine injection.	Chloroquine	120-131	FBJ osteosarcoma oncogene	Mus musculus	32-35
27270268-8	2016	CONCLUSIONS: Both expression of Fos and phosphorylation of ERK can be used to identify dorsal horn neurons activated by chloroquine injection.	Chloroquine	120-131	mitogen-activated protein kinase 1	Mus musculus	59-62
26434592-2	2016	By comparing the treatment effects of the antimalarials chloroquine (CQ) and quinacrine (Q) on KRAS mutant lung cancer cells, we demonstrate that inhibition of the oxidative arm of the pentose phosphate pathway (oxPPP) is required for antimalarial induced apoptosis.	Chloroquine	69-71	KRAS proto-oncogene, GTPase	Homo sapiens	95-99
27109480-0	2016	Anti-inflammatory activity of chloroquine and amodiaquine through p21-mediated suppression of T cell proliferation and Th1 cell differentiation.	Chloroquine	30-41	cyclin dependent kinase inhibitor 1A	Homo sapiens	66-69
27109915-5	2016	When treated with radiation alone, human esophageal carcinoma xenografts showed increased LC3B and p-LKB1 expression, which was decreased by the autophagy inhibitor chloroquine.	Chloroquine	165-176	microtubule associated protein 1 light chain 3 beta	Homo sapiens	90-94
27109915-5	2016	When treated with radiation alone, human esophageal carcinoma xenografts showed increased LC3B and p-LKB1 expression, which was decreased by the autophagy inhibitor chloroquine.	Chloroquine	165-176	serine/threonine kinase 11	Homo sapiens	101-105
27100736-12	2016	CONCLUSIONS: Tanshinone I induced apoptosis and pro-survival autophagy via inhibiting Bcl-2 expression on gastric cancer, and the combination of chloroquine and Tanshinone I could inhibit tumor growth more efficiently than monotherapy, which might be considered as an effective strategy for the treatment for gastric cancer.	Chloroquine	145-156	BCL2 apoptosis regulator	Homo sapiens	86-91
26518989-13	2016	Moreover, it was also found that downregulation of MITF was clearly inhibited by lysosomal inhibitor (chloroquine).	Chloroquine	102-113	melanocyte inducing transcription factor	Homo sapiens	51-55
27037187-7	2016	However 25 and 50mg/kg CQ treatment significantly decreased the CS-induced autophagosomes (p=0.0505; p=0.0065) and attenuated the effects of CS on LC3B and BECN1 expression.	Chloroquine	23-25	microtubule-associated protein 1 light chain 3 beta	Mus musculus	147-151
27037187-7	2016	However 25 and 50mg/kg CQ treatment significantly decreased the CS-induced autophagosomes (p=0.0505; p=0.0065) and attenuated the effects of CS on LC3B and BECN1 expression.	Chloroquine	23-25	beclin 1, autophagy related	Mus musculus	156-161
27109480-8	2016	Sustained treatment of developing T cells with either CQ or AQ suppressed IFN-gamma production in a dose dependent manner and potently inhibited the differentiation of IFN-gamma-producing Th1 cells.	Chloroquine	54-56	interferon gamma	Homo sapiens	74-83
27109480-8	2016	Sustained treatment of developing T cells with either CQ or AQ suppressed IFN-gamma production in a dose dependent manner and potently inhibited the differentiation of IFN-gamma-producing Th1 cells.	Chloroquine	54-56	interferon gamma	Homo sapiens	168-177
27109480-9	2016	These results demonstrate that CQ and AQ increase the expression level of p21 and inhibit T cell proliferation and the development of IFN-gamma-producing Th1 cells, thereby revealing beneficial roles in treating a wide range of chronic inflammatory diseases mediated by inflammatory T cells.	Chloroquine	31-33	cyclin dependent kinase inhibitor 1A	Homo sapiens	74-77
27109480-6	2016	Interestingly, the cyclin-dependent kinase inhibitor p21 was significantly and dose-dependently increased by CQ, and more potently by AQ, while other cell cycle regulators were unchanged.	Chloroquine	109-111	cyclin dependent kinase inhibitor 1A	Homo sapiens	53-56
27109480-9	2016	These results demonstrate that CQ and AQ increase the expression level of p21 and inhibit T cell proliferation and the development of IFN-gamma-producing Th1 cells, thereby revealing beneficial roles in treating a wide range of chronic inflammatory diseases mediated by inflammatory T cells.	Chloroquine	31-33	interferon gamma	Homo sapiens	134-143
27109480-7	2016	Both CQ and AQ elevated the transcription level of p21 though the activation of p53, but also blocked p21 protein degradation in the presence of cycloheximide, causing p21 protein accumulation mainly in the nucleus.	Chloroquine	5-7	cyclin dependent kinase inhibitor 1A	Homo sapiens	51-54
27109480-7	2016	Both CQ and AQ elevated the transcription level of p21 though the activation of p53, but also blocked p21 protein degradation in the presence of cycloheximide, causing p21 protein accumulation mainly in the nucleus.	Chloroquine	5-7	tumor protein p53	Homo sapiens	80-83
27109480-7	2016	Both CQ and AQ elevated the transcription level of p21 though the activation of p53, but also blocked p21 protein degradation in the presence of cycloheximide, causing p21 protein accumulation mainly in the nucleus.	Chloroquine	5-7	cyclin dependent kinase inhibitor 1A	Homo sapiens	102-105
27109480-7	2016	Both CQ and AQ elevated the transcription level of p21 though the activation of p53, but also blocked p21 protein degradation in the presence of cycloheximide, causing p21 protein accumulation mainly in the nucleus.	Chloroquine	5-7	cyclin dependent kinase inhibitor 1A	Homo sapiens	102-105
27184816-5	2016	LCA-induced LC3-II expression was increased when combined with chloroquine (CQ), while knock-down of autophagy related protein (ATG) 7 or ATG5 reversed LCA-induced LC3-II expression and GFP-LC3 punta formation, suggesting that LCA induced autophagy in NSCLC cells.	Chloroquine	63-74	clathrin light chain A	Homo sapiens	0-3
27189859-9	2016	TUNEL staining and caspase-3 cleavage revealed less apoptosis in the tumors from mice treated with penfluridol and chloroquine as compared to penfluridol alone.	Chloroquine	115-126	caspase 3	Mus musculus	19-28
27184816-5	2016	LCA-induced LC3-II expression was increased when combined with chloroquine (CQ), while knock-down of autophagy related protein (ATG) 7 or ATG5 reversed LCA-induced LC3-II expression and GFP-LC3 punta formation, suggesting that LCA induced autophagy in NSCLC cells.	Chloroquine	76-78	clathrin light chain A	Homo sapiens	0-3
26818531-5	2016	Subcellular localizations and western blots indicate that SNX11 interacts with TRPV3 and targets it to lysosomes for degradation, which is blocked by the lysosomal inhibitors chloroquine and leupeptin.	Chloroquine	175-186	sorting nexin 11	Homo sapiens	58-63
27028858-11	2016	Inhibition of autophagy using the lysosomal inhibitor chloroquine, reduced Spred2-mediated HeLa cell death.	Chloroquine	54-65	sprouty related EVH1 domain containing 2	Homo sapiens	75-81
27322458-3	2016	In contrast, mechanism-driven co-targeting hexokinase 2 (HK2)-mediated Warburg effect with 2-deoxyglucose (2-DG) and ULK1-dependent autophagy with chloroquine (CQ) selectively kills cancer cells through intrinsic apoptosis to cause tumor regression in xenograft, leads to a near-complete tumor suppression and remarkably extends survival in Pten-/p53-deficiency-driven CRPC mouse model.	Chloroquine	147-158	hexokinase 2	Mus musculus	43-55
27322458-3	2016	In contrast, mechanism-driven co-targeting hexokinase 2 (HK2)-mediated Warburg effect with 2-deoxyglucose (2-DG) and ULK1-dependent autophagy with chloroquine (CQ) selectively kills cancer cells through intrinsic apoptosis to cause tumor regression in xenograft, leads to a near-complete tumor suppression and remarkably extends survival in Pten-/p53-deficiency-driven CRPC mouse model.	Chloroquine	147-158	hexokinase 2	Mus musculus	57-60
27322458-3	2016	In contrast, mechanism-driven co-targeting hexokinase 2 (HK2)-mediated Warburg effect with 2-deoxyglucose (2-DG) and ULK1-dependent autophagy with chloroquine (CQ) selectively kills cancer cells through intrinsic apoptosis to cause tumor regression in xenograft, leads to a near-complete tumor suppression and remarkably extends survival in Pten-/p53-deficiency-driven CRPC mouse model.	Chloroquine	147-158	unc-51 like kinase 1	Mus musculus	117-121
27322458-3	2016	In contrast, mechanism-driven co-targeting hexokinase 2 (HK2)-mediated Warburg effect with 2-deoxyglucose (2-DG) and ULK1-dependent autophagy with chloroquine (CQ) selectively kills cancer cells through intrinsic apoptosis to cause tumor regression in xenograft, leads to a near-complete tumor suppression and remarkably extends survival in Pten-/p53-deficiency-driven CRPC mouse model.	Chloroquine	147-158	phosphatase and tensin homolog	Mus musculus	341-345
27322458-3	2016	In contrast, mechanism-driven co-targeting hexokinase 2 (HK2)-mediated Warburg effect with 2-deoxyglucose (2-DG) and ULK1-dependent autophagy with chloroquine (CQ) selectively kills cancer cells through intrinsic apoptosis to cause tumor regression in xenograft, leads to a near-complete tumor suppression and remarkably extends survival in Pten-/p53-deficiency-driven CRPC mouse model.	Chloroquine	147-158	transformation related protein 53	Mus musculus	347-350
27322458-3	2016	In contrast, mechanism-driven co-targeting hexokinase 2 (HK2)-mediated Warburg effect with 2-deoxyglucose (2-DG) and ULK1-dependent autophagy with chloroquine (CQ) selectively kills cancer cells through intrinsic apoptosis to cause tumor regression in xenograft, leads to a near-complete tumor suppression and remarkably extends survival in Pten-/p53-deficiency-driven CRPC mouse model.	Chloroquine	160-162	hexokinase 2	Mus musculus	43-55
27322458-3	2016	In contrast, mechanism-driven co-targeting hexokinase 2 (HK2)-mediated Warburg effect with 2-deoxyglucose (2-DG) and ULK1-dependent autophagy with chloroquine (CQ) selectively kills cancer cells through intrinsic apoptosis to cause tumor regression in xenograft, leads to a near-complete tumor suppression and remarkably extends survival in Pten-/p53-deficiency-driven CRPC mouse model.	Chloroquine	160-162	hexokinase 2	Mus musculus	57-60
27322458-3	2016	In contrast, mechanism-driven co-targeting hexokinase 2 (HK2)-mediated Warburg effect with 2-deoxyglucose (2-DG) and ULK1-dependent autophagy with chloroquine (CQ) selectively kills cancer cells through intrinsic apoptosis to cause tumor regression in xenograft, leads to a near-complete tumor suppression and remarkably extends survival in Pten-/p53-deficiency-driven CRPC mouse model.	Chloroquine	160-162	unc-51 like kinase 1	Mus musculus	117-121
27322458-6	2016	Given that 2-DG is recommended for phase II clinical trials for prostate cancer and CQ has been clinically used as an anti-malaria drug for many decades, the preclinical results from our proof-of-principle studies in vivo are imminently translatable to clinical trials to evaluate the therapeutic efficacy by the combination modality for a subset of currently incurable CRPC harboring PTEN and TP53 mutations.	Chloroquine	84-86	phosphatase and tensin homolog	Mus musculus	385-389
27322458-6	2016	Given that 2-DG is recommended for phase II clinical trials for prostate cancer and CQ has been clinically used as an anti-malaria drug for many decades, the preclinical results from our proof-of-principle studies in vivo are imminently translatable to clinical trials to evaluate the therapeutic efficacy by the combination modality for a subset of currently incurable CRPC harboring PTEN and TP53 mutations.	Chloroquine	84-86	transformation related protein 53	Mus musculus	394-398
26986900-7	2016	Interestingly, CQ reversed the increase in cell proliferation and autophagy in the E2-2 knockdown group.	Chloroquine	15-17	transcription factor 4	Mus musculus	83-87
27107419-6	2016	Treatment of melanoma-bearing mice with the autophagy inhibitor chloroquine restored sensitivity to cisplatin of tumours expressing low levels of A-SMase while no additive effects were observed in tumours characterised by sustained A-SMase levels.	Chloroquine	64-75	sphingomyelin phosphodiesterase 1, acid lysosomal	Mus musculus	146-153
27107419-6	2016	Treatment of melanoma-bearing mice with the autophagy inhibitor chloroquine restored sensitivity to cisplatin of tumours expressing low levels of A-SMase while no additive effects were observed in tumours characterised by sustained A-SMase levels.	Chloroquine	64-75	sphingomyelin phosphodiesterase 1, acid lysosomal	Mus musculus	232-239
26818531-5	2016	Subcellular localizations and western blots indicate that SNX11 interacts with TRPV3 and targets it to lysosomes for degradation, which is blocked by the lysosomal inhibitors chloroquine and leupeptin.	Chloroquine	175-186	transient receptor potential cation channel subfamily V member 3	Homo sapiens	79-84
26924047-6	2016	Inhibition of lysosomal degradation of TRPP2(D511V) by the US Food and Drug Administration (FDA)-approved drug chloroquine strongly increased TRPP2 protein levels in vitro.	Chloroquine	111-122	polycystin 2, transient receptor potential cation channel	Homo sapiens	39-44
26953199-4	2016	Synthetically linking a CRA scaffold to chloroquine produces hybrid compounds with restored potency toward a range of resistant malaria parasites.	Chloroquine	40-51	myotubularin related protein 11	Homo sapiens	24-27
26820502-10	2016	Treatment with the autophagy inhibitor chloroquine conversely increased HIF-1alpha expression, mtROS generation, cell survival and invasion in hypoxic MKN45 cells.	Chloroquine	39-50	hypoxia inducible factor 1 subunit alpha	Homo sapiens	72-82
26924047-6	2016	Inhibition of lysosomal degradation of TRPP2(D511V) by the US Food and Drug Administration (FDA)-approved drug chloroquine strongly increased TRPP2 protein levels in vitro.	Chloroquine	111-122	polycystin 2, transient receptor potential cation channel	Homo sapiens	142-147
26924047-10	2016	Notably, chloroquine was sufficient to improve the phenotype of flies expressing mutant TRPP2.	Chloroquine	9-20	polycystin 2, transient receptor potential cation channel	Homo sapiens	88-93
32263184-3	2016	In brief, nanogel particles synthesized from a chloroquine (CQ)-loaded bovine serum albumin (BSA) solution were prepared and then combined with genipin, a crosslinking agent.	Chloroquine	47-58	albumin	Homo sapiens	78-91
26801583-7	2016	Disrupting the autophagy-lysosomal pathway through chloroquine or ATG5-siRNA exacerbated AgNPs-induced caspase-1 activation and lactate dehydrogenase release, suggesting that NLRP3-inflammasome plays an important role in AgNPs-induced cytotoxicity.	Chloroquine	51-62	caspase 1	Homo sapiens	103-112
26645545-3	2016	Tlr4 mice exhibited normal acute itch induced by compound 48/80 and chloroquine, but these mice showed substantial reductions in scratching in chronic itch models of dry skin, induced by acetone and diethylether followed by water (AEW), contact dermatitis, and allergic contact dermatitis on the neck.	Chloroquine	68-79	toll-like receptor 4	Mus musculus	0-4
32263184-3	2016	In brief, nanogel particles synthesized from a chloroquine (CQ)-loaded bovine serum albumin (BSA) solution were prepared and then combined with genipin, a crosslinking agent.	Chloroquine	60-62	albumin	Homo sapiens	78-91
27795873-0	2016	Chloroquine-Containing HPMA Copolymers as Polymeric Inhibitors of Cancer Cell Migration Mediated by the CXCR4/SDF-1 Chemokine Axis.	Chloroquine	0-11	C-X-C motif chemokine receptor 4	Homo sapiens	104-109
27186430-8	2016	Pharmacological inhibition of autophagy flux by chloroquine stabilized p62/SQSTM1, and increased basal and acetaldehyde-mediate oxidative stress in Aldh2 deficient cells as documented in monolayer culture as well as single-cell derived three-dimensional esophageal organoids, recapitulating a physiological esophageal epithelial proliferation-differentiation gradient.	Chloroquine	48-59	sequestosome 1	Mus musculus	71-74
27186430-8	2016	Pharmacological inhibition of autophagy flux by chloroquine stabilized p62/SQSTM1, and increased basal and acetaldehyde-mediate oxidative stress in Aldh2 deficient cells as documented in monolayer culture as well as single-cell derived three-dimensional esophageal organoids, recapitulating a physiological esophageal epithelial proliferation-differentiation gradient.	Chloroquine	48-59	sequestosome 1	Mus musculus	75-81
26660048-9	2016	KEY RESULTS: Genipin improved survival rate and decreased serum levels of aminotransferases and pro-inflammatory cytokines after CLP; effects abolished by chloroquine.	Chloroquine	155-166	hyaluronan and proteoglycan link protein 1	Mus musculus	129-132
26964637-0	2016	Chloroquine enhances TRAIL-mediated apoptosis through up-regulation of DR5 by stabilization of mRNA and protein in cancer cells.	Chloroquine	0-11	TNF superfamily member 10	Homo sapiens	21-26
26964637-0	2016	Chloroquine enhances TRAIL-mediated apoptosis through up-regulation of DR5 by stabilization of mRNA and protein in cancer cells.	Chloroquine	0-11	TNF receptor superfamily member 10b	Homo sapiens	71-74
26964637-2	2016	In this study, we investigated CQ sensitizes TRAIL-mediated apoptosis in human renal cancer Caki cells.	Chloroquine	31-33	TNF superfamily member 10	Homo sapiens	45-50
26964637-4	2016	CQ up-regulates DR5 mRNA and protein expression in a dose- and time- dependent manner.	Chloroquine	0-2	TNF receptor superfamily member 10b	Homo sapiens	16-19
26964637-6	2016	Moreover, we found that CQ decreased the expression of Cbl, an E3 ligase of DR5, and knock-down of Cbl markedly enhanced DR5 up-regulation.	Chloroquine	24-26	Cbl proto-oncogene	Homo sapiens	55-58
26964637-6	2016	Moreover, we found that CQ decreased the expression of Cbl, an E3 ligase of DR5, and knock-down of Cbl markedly enhanced DR5 up-regulation.	Chloroquine	24-26	TNF receptor superfamily member 10b	Homo sapiens	76-79
26964637-8	2016	Therefore, this study demonstrates that lysosomal inhibition by CQ may sensitize TRAIL-mediated apoptosis in human renal cancer Caki cells via DR5 up-regulation.	Chloroquine	64-66	TNF superfamily member 10	Homo sapiens	81-86
26964637-8	2016	Therefore, this study demonstrates that lysosomal inhibition by CQ may sensitize TRAIL-mediated apoptosis in human renal cancer Caki cells via DR5 up-regulation.	Chloroquine	64-66	TNF receptor superfamily member 10b	Homo sapiens	143-146
26776969-0	2016	Fabrication and efficacy evaluation of chloroquine nanoparticles in CFA-induced arthritic rats using TNF-alpha ELISA.	Chloroquine	39-50	tumor necrosis factor	Rattus norvegicus	101-110
26776969-2	2016	Chloroquine, an anti-malarial drug inhibits the production of TNF-alpha, thus, halting the disease progression.	Chloroquine	0-11	tumor necrosis factor	Rattus norvegicus	62-71
26776969-3	2016	The aim of the present study was fabrication, characterization and demonstration of kinetic and dynamic efficacy of chloroquine loaded solid lipid nanoparticles (CQ-SLNs) in arthritic rats and in lowering TNF-alpha levels.	Chloroquine	116-127	tumor necrosis factor	Rattus norvegicus	205-214
26750564-0	2016	Downregulation of Organic Anion Transporting Polypeptide (OATP) 1B1 Transport Function by Lysosomotropic Drug Chloroquine: Implication in OATP-Mediated Drug-Drug Interactions.	Chloroquine	110-121	solute carrier organic anion transporter family member 1B1	Homo sapiens	18-67
26750564-0	2016	Downregulation of Organic Anion Transporting Polypeptide (OATP) 1B1 Transport Function by Lysosomotropic Drug Chloroquine: Implication in OATP-Mediated Drug-Drug Interactions.	Chloroquine	110-121	solute carrier organic anion transporter family member 1A2	Homo sapiens	58-62
26750564-6	2016	Treatment with lysosome inhibitor CQ increased OATP1B1 total protein levels in HEK293-OATP1B1 cells and in human SCH as determined by OATP1B1 immunoblot.	Chloroquine	34-36	solute carrier organic anion transporter family member 1B1	Homo sapiens	47-54
26750564-6	2016	Treatment with lysosome inhibitor CQ increased OATP1B1 total protein levels in HEK293-OATP1B1 cells and in human SCH as determined by OATP1B1 immunoblot.	Chloroquine	34-36	solute carrier organic anion transporter family member 1B1	Homo sapiens	86-93
26750564-6	2016	Treatment with lysosome inhibitor CQ increased OATP1B1 total protein levels in HEK293-OATP1B1 cells and in human SCH as determined by OATP1B1 immunoblot.	Chloroquine	34-36	solute carrier organic anion transporter family member 1B1	Homo sapiens	86-93
26750564-8	2016	Enlarged LAMP-2-positive vacuoles with FLAG-OATP1B1 protein retained inside were readily detected in CQ-treated cells, consistent with blocking lysosomal degradation of OATP1B1 by CQ.	Chloroquine	101-103	lysosomal associated membrane protein 2	Homo sapiens	9-15
26750564-8	2016	Enlarged LAMP-2-positive vacuoles with FLAG-OATP1B1 protein retained inside were readily detected in CQ-treated cells, consistent with blocking lysosomal degradation of OATP1B1 by CQ.	Chloroquine	101-103	solute carrier organic anion transporter family member 1B1	Homo sapiens	44-51
26750564-8	2016	Enlarged LAMP-2-positive vacuoles with FLAG-OATP1B1 protein retained inside were readily detected in CQ-treated cells, consistent with blocking lysosomal degradation of OATP1B1 by CQ.	Chloroquine	101-103	solute carrier organic anion transporter family member 1B1	Homo sapiens	169-176
26750564-8	2016	Enlarged LAMP-2-positive vacuoles with FLAG-OATP1B1 protein retained inside were readily detected in CQ-treated cells, consistent with blocking lysosomal degradation of OATP1B1 by CQ.	Chloroquine	180-182	lysosomal associated membrane protein 2	Homo sapiens	9-15
26750564-8	2016	Enlarged LAMP-2-positive vacuoles with FLAG-OATP1B1 protein retained inside were readily detected in CQ-treated cells, consistent with blocking lysosomal degradation of OATP1B1 by CQ.	Chloroquine	180-182	solute carrier organic anion transporter family member 1B1	Homo sapiens	169-176
26750564-10	2016	However, pre-incubation with CQ at clinically relevant concentration(s) significantly decreased [(3)H]E217G and [(3)H]pitavastatin accumulation in HEK293-OATP1B1 cells and [(3)H]pitavastatin accumulation in human SCH.	Chloroquine	29-31	solute carrier organic anion transporter family member 1B1	Homo sapiens	154-161
26750564-11	2016	CQ pretreatment (25 muM, 2 h) resulted in ~1.9-fold decrease in Vmax without affecting Km of OATP1B1-mediated [(3)H]E217G transport in HEK293-OATP1B1 cells.	Chloroquine	0-2	solute carrier organic anion transporter family member 1B1	Homo sapiens	93-100
26750564-11	2016	CQ pretreatment (25 muM, 2 h) resulted in ~1.9-fold decrease in Vmax without affecting Km of OATP1B1-mediated [(3)H]E217G transport in HEK293-OATP1B1 cells.	Chloroquine	0-2	solute carrier organic anion transporter family member 1B1	Homo sapiens	142-149
26750564-14	2016	In summary, the present studies report novel findings that lysosome is involved in degradation of OATP1B1 protein and that pre-incubation with lysosomotropic drug CQ downregulates OATP1B1 transport activity.	Chloroquine	163-165	solute carrier organic anion transporter family member 1B1	Homo sapiens	98-105
26750564-14	2016	In summary, the present studies report novel findings that lysosome is involved in degradation of OATP1B1 protein and that pre-incubation with lysosomotropic drug CQ downregulates OATP1B1 transport activity.	Chloroquine	163-165	solute carrier organic anion transporter family member 1B1	Homo sapiens	180-187
26750564-15	2016	Our in vitro data in combination with pharmacoepidemiologic studies support that CQ has potential to cause OATP-mediated drug-drug interactions.	Chloroquine	81-83	solute carrier organic anion transporter family member 1A2	Homo sapiens	107-111
26660048-12	2016	CLP impaired autophagic flux, as indicated by increased liver expression of microtubule-associated protein-1 light chain 3-II and sequestosome-1/p62 protein; this impaired autophagic flux was restored by genipin, and chloroquine abolished this effect.	Chloroquine	217-228	hyaluronan and proteoglycan link protein 1	Mus musculus	0-3
27538132-12	2016	At the same time, the result of sunitinib combined with chloroquine, a drug which blocked the fusion of autophagosomes and lysosomes, demonstrated that the increasing amount of LC3-II was due to the enhanced autophagy flux by sunitinib treatment in ACHN cells.	Chloroquine	56-67	microtubule associated protein 1 light chain 3 alpha	Homo sapiens	177-180
27047993-12	2016	SIGNIFICANCE: These ATM-independent effects of chloroquine on AMPK and Akt and the additional effect to decrease intracellular calcium are likely to partially underlie the positive metabolic effects of chloroquine that have been reported in the literature.	Chloroquine	202-213	ATM serine/threonine kinase	Homo sapiens	20-23
27047993-12	2016	SIGNIFICANCE: These ATM-independent effects of chloroquine on AMPK and Akt and the additional effect to decrease intracellular calcium are likely to partially underlie the positive metabolic effects of chloroquine that have been reported in the literature.	Chloroquine	202-213	protein kinase AMP-activated catalytic subunit alpha 2	Homo sapiens	62-66
27047993-12	2016	SIGNIFICANCE: These ATM-independent effects of chloroquine on AMPK and Akt and the additional effect to decrease intracellular calcium are likely to partially underlie the positive metabolic effects of chloroquine that have been reported in the literature.	Chloroquine	202-213	AKT serine/threonine kinase 1	Homo sapiens	71-74
27047993-0	2016	Chloroquine increases phosphorylation of AMPK and Akt in myotubes.	Chloroquine	0-11	protein kinase AMP-activated catalytic subunit alpha 2	Homo sapiens	41-45
27047993-0	2016	Chloroquine increases phosphorylation of AMPK and Akt in myotubes.	Chloroquine	0-11	AKT serine/threonine kinase 1	Homo sapiens	50-53
27047993-2	2016	We hypothesized that chloroquine and resveratrol, both known ATM activators, would also activate AMPK and Akt.	Chloroquine	21-32	ATM serine/threonine kinase	Homo sapiens	61-64
27047993-2	2016	We hypothesized that chloroquine and resveratrol, both known ATM activators, would also activate AMPK and Akt.	Chloroquine	21-32	protein kinase AMP-activated catalytic subunit alpha 2	Homo sapiens	97-101
27047993-2	2016	We hypothesized that chloroquine and resveratrol, both known ATM activators, would also activate AMPK and Akt.	Chloroquine	21-32	AKT serine/threonine kinase 1	Homo sapiens	106-109
27047993-3	2016	MAIN METHODS: Phosphorylation of AMPK and Akt was assessed after C2C12 myotubes were exposed to chloroquine or resveratrol.	Chloroquine	96-107	protein kinase AMP-activated catalytic subunit alpha 2	Homo sapiens	33-37
27047993-3	2016	MAIN METHODS: Phosphorylation of AMPK and Akt was assessed after C2C12 myotubes were exposed to chloroquine or resveratrol.	Chloroquine	96-107	AKT serine/threonine kinase 1	Homo sapiens	42-45
27047993-6	2016	KEY FINDINGS: 0.5 mM chloroquine increased AMPK phosphorylation by nearly 4-fold (P&lt;0.05), and 0.25 mM chloroquine roughly doubled Akt phosphorylation (P&lt;0.05).	Chloroquine	21-32	protein kinase AMP-activated catalytic subunit alpha 2	Homo sapiens	43-47
27047993-6	2016	KEY FINDINGS: 0.5 mM chloroquine increased AMPK phosphorylation by nearly 4-fold (P&lt;0.05), and 0.25 mM chloroquine roughly doubled Akt phosphorylation (P&lt;0.05).	Chloroquine	106-117	AKT serine/threonine kinase 1	Homo sapiens	134-137
27047993-7	2016	Chloroquine also increased autophosphorylation of ATM by ~50% (P&lt;0.05).	Chloroquine	0-11	ATM serine/threonine kinase	Homo sapiens	50-53
27047993-9	2016	Chloroquine increased AMPK and Akt phosphorylation in myotubes expressing shRNA against ATM that reduced ATM protein levels by about 90%.	Chloroquine	0-11	protein kinase AMP-activated catalytic subunit alpha 2	Homo sapiens	22-26
27047993-9	2016	Chloroquine increased AMPK and Akt phosphorylation in myotubes expressing shRNA against ATM that reduced ATM protein levels by about 90%.	Chloroquine	0-11	AKT serine/threonine kinase 1	Homo sapiens	31-34
27047993-9	2016	Chloroquine increased AMPK and Akt phosphorylation in myotubes expressing shRNA against ATM that reduced ATM protein levels by about 90%.	Chloroquine	0-11	ATM serine/threonine kinase	Homo sapiens	88-91
27047993-9	2016	Chloroquine increased AMPK and Akt phosphorylation in myotubes expressing shRNA against ATM that reduced ATM protein levels by about 90%.	Chloroquine	0-11	ATM serine/threonine kinase	Homo sapiens	105-108
27047993-10	2016	Likewise, chloroquine-stimulated phosphorylation of AMPK and Akt and resveratrol-stimulated phosphorylation of AMPK were not altered by inhibition of ATM.	Chloroquine	10-21	protein kinase AMP-activated catalytic subunit alpha 2	Homo sapiens	52-56
27047993-10	2016	Likewise, chloroquine-stimulated phosphorylation of AMPK and Akt and resveratrol-stimulated phosphorylation of AMPK were not altered by inhibition of ATM.	Chloroquine	10-21	AKT serine/threonine kinase 1	Homo sapiens	61-64
27047993-12	2016	SIGNIFICANCE: These ATM-independent effects of chloroquine on AMPK and Akt and the additional effect to decrease intracellular calcium are likely to partially underlie the positive metabolic effects of chloroquine that have been reported in the literature.	Chloroquine	47-58	ATM serine/threonine kinase	Homo sapiens	20-23
27047993-12	2016	SIGNIFICANCE: These ATM-independent effects of chloroquine on AMPK and Akt and the additional effect to decrease intracellular calcium are likely to partially underlie the positive metabolic effects of chloroquine that have been reported in the literature.	Chloroquine	47-58	protein kinase AMP-activated catalytic subunit alpha 2	Homo sapiens	62-66
27047993-12	2016	SIGNIFICANCE: These ATM-independent effects of chloroquine on AMPK and Akt and the additional effect to decrease intracellular calcium are likely to partially underlie the positive metabolic effects of chloroquine that have been reported in the literature.	Chloroquine	47-58	AKT serine/threonine kinase 1	Homo sapiens	71-74
26577496-5	2016	Pretreatment with either the lysosomal inhibitor chloroquine, or the proteasomal inhibitor MG132 blocks HT-induced EGFR downregulation.	Chloroquine	49-60	epidermal growth factor receptor	Homo sapiens	115-119
26760678-5	2016	Blockade of autophagic flux by chloroquine (CQ) or ATG7 knockdown reverses the ameliorated liver steatosis in MAPK1/3-activated db/db mice.	Chloroquine	44-46	mitogen-activated protein kinase 1	Mus musculus	110-115
26676567-8	2016	When autophagy was inhibited by 3-MA or chloroquine, the percentage of apoptotic cells and NSE-positive cells as well as the expression of MAP2 were markedly reduced compared to those in the control group (P&lt;0.05).	Chloroquine	40-51	enolase 2	Rattus norvegicus	91-94
26808193-5	2016	Inhibition of autophagy by treating cells with autophagy inhibitor (chloroquine) abolished the cell death caused by PP7, indicating that PP7 induced an autophagic cell death in HepG2 cells.	Chloroquine	68-79	protein phosphatase with EF-hand domain 1	Homo sapiens	116-119
26808193-5	2016	Inhibition of autophagy by treating cells with autophagy inhibitor (chloroquine) abolished the cell death caused by PP7, indicating that PP7 induced an autophagic cell death in HepG2 cells.	Chloroquine	68-79	protein phosphatase with EF-hand domain 1	Homo sapiens	137-140
26562437-7	2016	Conversely, inhibition of autophagy by chloroquine (CQ), an autophagy inhibitor, or knockdown of ATG5, a key component of the autophagy pathway by specific siRNA, aggravated Ang II-mediated the accumulation of Col-I and FN.	Chloroquine	39-50	angiotensinogen	Rattus norvegicus	174-180
26562437-7	2016	Conversely, inhibition of autophagy by chloroquine (CQ), an autophagy inhibitor, or knockdown of ATG5, a key component of the autophagy pathway by specific siRNA, aggravated Ang II-mediated the accumulation of Col-I and FN.	Chloroquine	52-54	angiotensinogen	Rattus norvegicus	174-180
26212375-6	2016	Treatment with lysosomal inhibitors chloroquine and ammonium chloride, compounds known to raise lysosomal pH, significantly increased mTOR protein levels in +/+ cells, confirming the importance of lysosomal pH in mTOR signaling.	Chloroquine	36-47	mechanistic target of rapamycin kinase	Homo sapiens	134-138
26212375-6	2016	Treatment with lysosomal inhibitors chloroquine and ammonium chloride, compounds known to raise lysosomal pH, significantly increased mTOR protein levels in +/+ cells, confirming the importance of lysosomal pH in mTOR signaling.	Chloroquine	36-47	mechanistic target of rapamycin kinase	Homo sapiens	213-217
26212375-9	2016	Both chloroquine and MG132 increased mTOR and p-mTOR protein levels in +/+ osteoclasts, suggesting that mTOR undergoes both lysosomal and proteasomal degradation.	Chloroquine	5-16	mechanistic target of rapamycin kinase	Homo sapiens	37-41
26212375-9	2016	Both chloroquine and MG132 increased mTOR and p-mTOR protein levels in +/+ osteoclasts, suggesting that mTOR undergoes both lysosomal and proteasomal degradation.	Chloroquine	5-16	mechanistic target of rapamycin kinase	Homo sapiens	48-52
26212375-9	2016	Both chloroquine and MG132 increased mTOR and p-mTOR protein levels in +/+ osteoclasts, suggesting that mTOR undergoes both lysosomal and proteasomal degradation.	Chloroquine	5-16	mechanistic target of rapamycin kinase	Homo sapiens	48-52
26429523-0	2016	Chloroquine and Hydroxychloroquine Are Novel Inhibitors of Human Organic Anion Transporting Polypeptide 1A2.	Chloroquine	0-11	solute carrier organic anion transporter family member 1A2	Homo sapiens	65-107
26429523-5	2016	Our data revealed that both CQ and HCQ potently inhibit the uptake activity of organic anion transporting polypeptide 1A2 (OATP1A2).	Chloroquine	28-30	solute carrier organic anion transporter family member 1A2	Homo sapiens	79-121
26429523-5	2016	Our data revealed that both CQ and HCQ potently inhibit the uptake activity of organic anion transporting polypeptide 1A2 (OATP1A2).	Chloroquine	28-30	solute carrier organic anion transporter family member 1A2	Homo sapiens	123-130
26429523-7	2016	In this study, we demonstrate that CQ and HCQ could markedly impair atROL uptake in OATP1A2-expressing HEK293 cells and more importantly, in primary human RPE cells.	Chloroquine	35-37	solute carrier organic anion transporter family member 1A2	Homo sapiens	84-91
26429523-8	2016	Our study shows that CQ and HCQ are novel inhibitors of OATP1A2 and significantly impair OATP1A2-mediated substrate uptake, particularly transport of atROL into the RPE.	Chloroquine	21-23	solute carrier organic anion transporter family member 1A2	Homo sapiens	56-63
26429523-8	2016	Our study shows that CQ and HCQ are novel inhibitors of OATP1A2 and significantly impair OATP1A2-mediated substrate uptake, particularly transport of atROL into the RPE.	Chloroquine	21-23	solute carrier organic anion transporter family member 1A2	Homo sapiens	89-96
26680738-5	2016	Munc13-4-deficient cells show increased numbers of significantly enlarged late endosomes, a phenotype that was mimicked by the fusion inhibitor chloroquine in wild-type cells and rescued by expression of Munc13-4 but not by a syntaxin 7-binding-deficient mutant.	Chloroquine	144-155	unc-13 homolog D	Homo sapiens	0-8
27160165-12	2016	CONCLUSION: Our data indicate that chloroquine via Gbetax03B3;-PLC-IP3-IP3R induces Ca2+ elevation, which in turn promotes GLUT4 fusion with the PM.	Chloroquine	35-46	solute carrier family 2 member 4	Homo sapiens	123-128
27160165-13	2016	Moreover, chloroquine can enhance GLUT4 trafficking to the PM.	Chloroquine	10-21	solute carrier family 2 member 4	Homo sapiens	34-39
27160165-0	2016	Chloroquine Increases Glucose Uptake via Enhancing GLUT4 Translocation and Fusion with the Plasma Membrane in L6 Cells.	Chloroquine	0-11	solute carrier family 2 member 4	Homo sapiens	51-56
27160165-6	2016	RESULTS: We found that chloroquine induced significant increases in glucose uptake, glucose transporter GLUT4 translocation to the plasma membrane (GTPM), GLUT4 fusion with the PM, and intracellular Ca2+ in L6 muscle cells.	Chloroquine	23-34	solute carrier family 2 member 4	Homo sapiens	104-109
27132793-10	2016	Inhibition of lysosomal activity with CQ also increased the levels of high mass ubiquitin conjugates, LC3-II and p62.	Chloroquine	38-40	nucleoporin 62	Homo sapiens	113-116
27160165-6	2016	RESULTS: We found that chloroquine induced significant increases in glucose uptake, glucose transporter GLUT4 translocation to the plasma membrane (GTPM), GLUT4 fusion with the PM, and intracellular Ca2+ in L6 muscle cells.	Chloroquine	23-34	solute carrier family 2 member 4	Homo sapiens	155-160
27160165-9	2016	These results indicate that chloroquine, via the Gbetax03B3;-PLC-IP3-IP3R pathway, induces elevation of Ca2+, and this Ca2+ increase does not play a role in chloroqui-ne-evoked GTPM increase.	Chloroquine	28-39	inositol 1,4,5-trisphosphate receptor type 3	Homo sapiens	69-73
27160165-12	2016	CONCLUSION: Our data indicate that chloroquine via Gbetax03B3;-PLC-IP3-IP3R induces Ca2+ elevation, which in turn promotes GLUT4 fusion with the PM.	Chloroquine	35-46	inositol 1,4,5-trisphosphate receptor type 3	Homo sapiens	71-75
26572581-11	2016	Moreover, orexin A upregulated ERK phosphorylation; however, U0126 or chloroquine abrogated ERK phosphorylation and decreased autophagy, compared to treatment with orexin A alone.	Chloroquine	70-81	mitogen-activated protein kinase 1	Homo sapiens	92-95
26708201-8	2016	Additionally, inhibited autophagy via chloroquine (CQ) markedly enhanced the apoptosis induced by TG, which was linked to the Bcl-2 family.	Chloroquine	38-49	BCL2 apoptosis regulator	Homo sapiens	126-131
26708201-8	2016	Additionally, inhibited autophagy via chloroquine (CQ) markedly enhanced the apoptosis induced by TG, which was linked to the Bcl-2 family.	Chloroquine	51-53	BCL2 apoptosis regulator	Homo sapiens	126-131
26577174-4	2016	NAC-containing media protected cells against CQ-induced loss of mitochondrial membrane potential (MMP), autophagic vacuoles (LC3II) accumulation and loss of cell viability induced by CQ.	Chloroquine	45-47	synuclein alpha	Homo sapiens	0-3
26577174-4	2016	NAC-containing media protected cells against CQ-induced loss of mitochondrial membrane potential (MMP), autophagic vacuoles (LC3II) accumulation and loss of cell viability induced by CQ.	Chloroquine	183-185	synuclein alpha	Homo sapiens	0-3
26648440-7	2016	In addition, autophagic flux-inactivating reagents, including 3-methyladenine and chloroquine, increased the TRAIL sensitivity of HaCaT cells exposed to hypoxia.	Chloroquine	82-93	TNF superfamily member 10	Homo sapiens	109-114
26923027-9	2016	Additional experiments showed that the autophagy inducer, rapamycin, enhances Abeta plaque degradation by ApoE4 astrocytes whereas the autophagy inhibitor, chloroquine, blocks Abeta plaque degradation by ApoE3 astrocytes.	Chloroquine	156-167	amyloid beta (A4) precursor protein	Mus musculus	176-181
26690546-0	2015	Chloroquine alleviates etoposide-induced centrosome amplification by inhibiting CDK2 in adrenocortical tumor cells.	Chloroquine	0-11	cyclin dependent kinase 2	Homo sapiens	80-84
26062786-6	2016	Reduction of BACE1 protein levels by overexpression of DISC1 was accompanied by an accelerating decline rate of BACE1, and was blocked by the lysosomal inhibitor chloroquine, rather than proteasome inhibitor MG-132.	Chloroquine	162-173	beta-site APP cleaving enzyme 1	Mus musculus	13-18
26062786-6	2016	Reduction of BACE1 protein levels by overexpression of DISC1 was accompanied by an accelerating decline rate of BACE1, and was blocked by the lysosomal inhibitor chloroquine, rather than proteasome inhibitor MG-132.	Chloroquine	162-173	disrupted in schizophrenia 1	Mus musculus	55-60
26062786-6	2016	Reduction of BACE1 protein levels by overexpression of DISC1 was accompanied by an accelerating decline rate of BACE1, and was blocked by the lysosomal inhibitor chloroquine, rather than proteasome inhibitor MG-132.	Chloroquine	162-173	beta-site APP cleaving enzyme 1	Mus musculus	112-117
30188621-0	2016	CHLOROQUINE DOES NOT CANCEL E1A+cHa-Ras TRANSFORMANTS" DEATH INDUCED BY mTOR KINASE INHIBITOR pp242.	Chloroquine	0-11	mechanistic target of rapamycin kinase	Rattus norvegicus	72-76
26651537-5	2015	The new natural product 1 exhibited antiplasmodial activity with IC50 values of 3.7 and 5.3 muM against the chloroquine-sensitive 3D7 and the chloroquine-resistant Dd2 Plasmodium falciparum strains, respectively, and was also cytotoxic to the HEK293 cell line.	Chloroquine	108-119	latexin	Homo sapiens	92-95
26651537-5	2015	The new natural product 1 exhibited antiplasmodial activity with IC50 values of 3.7 and 5.3 muM against the chloroquine-sensitive 3D7 and the chloroquine-resistant Dd2 Plasmodium falciparum strains, respectively, and was also cytotoxic to the HEK293 cell line.	Chloroquine	142-153	latexin	Homo sapiens	92-95
26619207-17	2016	CQ may potentiate the antitumor effect of mTOR inhibitors.	Chloroquine	0-2	mechanistic target of rapamycin kinase	Homo sapiens	42-46
26690546-10	2015	Chloroquine alleviated CDK2 and ERK, but not Chk2, activation and thus inhibited centrosome amplification in either ETO- or hydroxyurea-treated ACT cells.	Chloroquine	0-11	cyclin dependent kinase 2	Homo sapiens	23-27
26690546-10	2015	Chloroquine alleviated CDK2 and ERK, but not Chk2, activation and thus inhibited centrosome amplification in either ETO- or hydroxyurea-treated ACT cells.	Chloroquine	0-11	mitogen-activated protein kinase 1	Homo sapiens	32-35
26690546-12	2015	In summary, we have demonstrated that chloroquine inhibited ACT cell growth and alleviated DNA damage-induced centrosome amplification by inhibiting CDK2 and ERK activity, thus preventing genomic instability and recurrence of ACT.	Chloroquine	38-49	cyclin dependent kinase 2	Homo sapiens	149-153
26690546-12	2015	In summary, we have demonstrated that chloroquine inhibited ACT cell growth and alleviated DNA damage-induced centrosome amplification by inhibiting CDK2 and ERK activity, thus preventing genomic instability and recurrence of ACT.	Chloroquine	38-49	mitogen-activated protein kinase 1	Homo sapiens	158-161
26453000-5	2015	Interestingly, CQ increased lysosomal pH in amyloid precursor protein (APP)/mPS1-expressing Chinese hamster ovary 7WDeltaE9 (CHO-7WDeltaE9) cell line, and ClioQ partially re-acidified lysosomes.	Chloroquine	15-17	presenilin 1	Mus musculus	76-80
26657973-6	2015	LC extraction by 25-hydroxycholesterol increased APAP-mediated mitophagy and protected ASMase(-/-) mice and hepatocytes against APAP hepatotoxicity, effects that were reversed by chloroquine to disrupt autophagy.	Chloroquine	179-190	sphingomyelin phosphodiesterase 1, acid lysosomal	Mus musculus	87-93
27308577-3	2016	In a recent study we found that chloroquine reduced intratumoral hypoxia and metastasis, while improving chemotherapy response, largely through an autophagy-independent, NOTCH1-reliant mechanism of tumor vessel normalization.	Chloroquine	32-43	notch receptor 1	Homo sapiens	170-176
26528626-7	2015	Furthermore, metformin as well as other drugs including phenformin, chloroquine, verapamil, famotidine, and amprolium inhibited hTHTR-2 mediated uptake of both thiamine and metformin.	Chloroquine	68-79	solute carrier family 19 member 3	Homo sapiens	128-135
26318599-6	2015	WT MEF treated with chloroquine accumulated both anMan-HS and Abeta, first in the nucleus then in autophagosomes.	Chloroquine	20-31	amyloid beta (A4) precursor protein	Mus musculus	62-67
26715839-7	2015	Activation of cisplatin-induced autophagic flux was increased by using chloroquine (CQ), which can accumulate LC3B-II protein and increase punctate distribution of LC3B localization.	Chloroquine	71-82	microtubule associated protein 1 light chain 3 beta	Homo sapiens	110-114
26715839-7	2015	Activation of cisplatin-induced autophagic flux was increased by using chloroquine (CQ), which can accumulate LC3B-II protein and increase punctate distribution of LC3B localization.	Chloroquine	71-82	microtubule associated protein 1 light chain 3 beta	Homo sapiens	164-168
26715839-7	2015	Activation of cisplatin-induced autophagic flux was increased by using chloroquine (CQ), which can accumulate LC3B-II protein and increase punctate distribution of LC3B localization.	Chloroquine	84-86	microtubule associated protein 1 light chain 3 beta	Homo sapiens	110-114
26715839-7	2015	Activation of cisplatin-induced autophagic flux was increased by using chloroquine (CQ), which can accumulate LC3B-II protein and increase punctate distribution of LC3B localization.	Chloroquine	84-86	microtubule associated protein 1 light chain 3 beta	Homo sapiens	164-168
26715839-9	2015	Compared to cisplatin treatment alone, the combination of cisplatin and CQ decreased p-AMPK and increased p-mTOR protein expressions, in addition, the AMPK inhibitor Compound C plus cisplatin downregulated p-AMPK and upregulated p-mTOR as well as depressed LC3B cleavage.	Chloroquine	72-74	protein kinase AMP-activated catalytic subunit alpha 1	Homo sapiens	87-91
26715839-9	2015	Compared to cisplatin treatment alone, the combination of cisplatin and CQ decreased p-AMPK and increased p-mTOR protein expressions, in addition, the AMPK inhibitor Compound C plus cisplatin downregulated p-AMPK and upregulated p-mTOR as well as depressed LC3B cleavage.	Chloroquine	72-74	mechanistic target of rapamycin kinase	Homo sapiens	108-112
26715839-9	2015	Compared to cisplatin treatment alone, the combination of cisplatin and CQ decreased p-AMPK and increased p-mTOR protein expressions, in addition, the AMPK inhibitor Compound C plus cisplatin downregulated p-AMPK and upregulated p-mTOR as well as depressed LC3B cleavage.	Chloroquine	72-74	protein kinase AMP-activated catalytic subunit alpha 1	Homo sapiens	151-155
26715839-9	2015	Compared to cisplatin treatment alone, the combination of cisplatin and CQ decreased p-AMPK and increased p-mTOR protein expressions, in addition, the AMPK inhibitor Compound C plus cisplatin downregulated p-AMPK and upregulated p-mTOR as well as depressed LC3B cleavage.	Chloroquine	72-74	protein kinase AMP-activated catalytic subunit alpha 1	Homo sapiens	151-155
26715839-9	2015	Compared to cisplatin treatment alone, the combination of cisplatin and CQ decreased p-AMPK and increased p-mTOR protein expressions, in addition, the AMPK inhibitor Compound C plus cisplatin downregulated p-AMPK and upregulated p-mTOR as well as depressed LC3B cleavage.	Chloroquine	72-74	mechanistic target of rapamycin kinase	Homo sapiens	231-235
26715839-9	2015	Compared to cisplatin treatment alone, the combination of cisplatin and CQ decreased p-AMPK and increased p-mTOR protein expressions, in addition, the AMPK inhibitor Compound C plus cisplatin downregulated p-AMPK and upregulated p-mTOR as well as depressed LC3B cleavage.	Chloroquine	72-74	microtubule associated protein 1 light chain 3 beta	Homo sapiens	257-261
26212201-7	2015	Collectively, results unravel the effects of resveratrol on TIGAR in mediating its ROS dependent influence and suggest a better combination therapy of resveratrol and chloroquine for probable cancer treatment.	Chloroquine	167-178	TP53 induced glycolysis regulatory phosphatase	Homo sapiens	60-65
26807181-0	2015	Chloroquine attenuates LPS-mediated macrophage activation through miR-669n-regulated SENP6 protein translation.	Chloroquine	0-11	toll-like receptor 4	Mus musculus	23-26
26807181-0	2015	Chloroquine attenuates LPS-mediated macrophage activation through miR-669n-regulated SENP6 protein translation.	Chloroquine	0-11	microRNA 669n	Mus musculus	66-74
26807181-0	2015	Chloroquine attenuates LPS-mediated macrophage activation through miR-669n-regulated SENP6 protein translation.	Chloroquine	0-11	SUMO/sentrin specific peptidase 6	Mus musculus	85-90
26807181-1	2015	Chloroquine (CQ) has been shown to inhibit Toll-like receptor 4 (TLR4)-mediated monocyte and macrophage activation induced by lipopolysaccharide (LPS).	Chloroquine	0-11	toll-like receptor 4	Mus musculus	43-63
26807181-1	2015	Chloroquine (CQ) has been shown to inhibit Toll-like receptor 4 (TLR4)-mediated monocyte and macrophage activation induced by lipopolysaccharide (LPS).	Chloroquine	0-11	toll-like receptor 4	Mus musculus	65-69
26807181-1	2015	Chloroquine (CQ) has been shown to inhibit Toll-like receptor 4 (TLR4)-mediated monocyte and macrophage activation induced by lipopolysaccharide (LPS).	Chloroquine	0-11	toll-like receptor 4	Mus musculus	146-149
26807181-1	2015	Chloroquine (CQ) has been shown to inhibit Toll-like receptor 4 (TLR4)-mediated monocyte and macrophage activation induced by lipopolysaccharide (LPS).	Chloroquine	13-15	toll-like receptor 4	Mus musculus	43-63
26807181-1	2015	Chloroquine (CQ) has been shown to inhibit Toll-like receptor 4 (TLR4)-mediated monocyte and macrophage activation induced by lipopolysaccharide (LPS).	Chloroquine	13-15	toll-like receptor 4	Mus musculus	65-69
26807181-1	2015	Chloroquine (CQ) has been shown to inhibit Toll-like receptor 4 (TLR4)-mediated monocyte and macrophage activation induced by lipopolysaccharide (LPS).	Chloroquine	13-15	toll-like receptor 4	Mus musculus	146-149
26807181-4	2015	Here, we studied whether this molecular pathway may also be involved in CQ/LPS model.	Chloroquine	72-74	toll-like receptor 4	Mus musculus	75-78
26807181-5	2015	We found that CQ dose-dependently increased SENP6 protein, but not mRNA, in mouse macrophages, RAW264.7 cells.	Chloroquine	14-16	SUMO/sentrin specific peptidase 6	Mus musculus	44-49
26327526-11	2015	Furthermore, we found that CQ could suppress MWCNTs-induced autophagic flux and partly rescue the synapse deficits, which occurred with the down-regulation of NR2B (a subunit of NMDA receptor) and synaptophysin (SYP) in the hippocampus.	Chloroquine	27-29	glutamate ionotropic receptor NMDA type subunit 2B	Rattus norvegicus	159-163
26327526-11	2015	Furthermore, we found that CQ could suppress MWCNTs-induced autophagic flux and partly rescue the synapse deficits, which occurred with the down-regulation of NR2B (a subunit of NMDA receptor) and synaptophysin (SYP) in the hippocampus.	Chloroquine	27-29	synaptophysin	Rattus norvegicus	197-210
26327526-11	2015	Furthermore, we found that CQ could suppress MWCNTs-induced autophagic flux and partly rescue the synapse deficits, which occurred with the down-regulation of NR2B (a subunit of NMDA receptor) and synaptophysin (SYP) in the hippocampus.	Chloroquine	27-29	synaptophysin	Rattus norvegicus	212-215
26491898-6	2015	By employing an embryonic bone culture system, we demonstrated that treatment with autophagy inhibitor 3-MA or chloroquine led to cartilage growth retardation, which mimics the effect of activated-FGFR3 signaling on chondrogenesis.	Chloroquine	111-122	fibroblast growth factor receptor 3	Homo sapiens	197-202
26338968-10	2015	Altogether, our results suggest that co-treatment with crizotinib and chloroquine (two drugs already used in clinics) could be beneficial for ALK-positive ALCL patients.	Chloroquine	70-81	ALK receptor tyrosine kinase	Homo sapiens	142-145
26682054-4	2015	Bafilomycin and chloroquine, agents that inhibit the function of endosomal toll-like receptors (TLRs), significantly reduced the capacity of TLR3-, TLR7- and TLR-9-stimulated cells to produce IFN-alpha and the IFN-induced chemokine CXCL10 (IP-10).	Chloroquine	16-27	interferon alpha 1	Homo sapiens	192-201
26372376-7	2015	Secondly, autophagy is activated during PMA-induced THP-1 monocyte differentiation, and the autophagy inhibitor chloroquine (CQ) can inhibit this process.	Chloroquine	112-123	GLI family zinc finger 2	Homo sapiens	52-57
26458814-9	2015	Blockade of autophagy by silencing ATG5, ATG7, and BECN1 or the administration of autophagy inhibitor chloroquine markedly reduced the CSC populations, ALDH1 activity, sphere formation, and resistance to gemcitabine in vitro and in vivo.	Chloroquine	102-113	aldehyde dehydrogenase 1 family member A1	Homo sapiens	152-157
25979647-10	2015	However, the addition of chloroquine (CQ), an autophagy inhibitor, overcame the antagonistic effects, as demonstrated by CDI analysis and Annexin V-FITC/propidium iodide (PI) assays.	Chloroquine	25-36	annexin A5	Homo sapiens	138-147
26163137-7	2015	The decrease in claudin-2 content was inhibited by chloroquine (CQ), a lysosomal inhibitor, but not by MG-132, a proteasome inhibitor.	Chloroquine	51-62	claudin 2	Homo sapiens	16-25
26163137-7	2015	The decrease in claudin-2 content was inhibited by chloroquine (CQ), a lysosomal inhibitor, but not by MG-132, a proteasome inhibitor.	Chloroquine	64-66	claudin 2	Homo sapiens	16-25
26163137-8	2015	In the presence of DFYSP peptide and CQ, claudin-2 was co-localized with LAMP-1, a lysosomal marker.	Chloroquine	37-39	claudin 2	Homo sapiens	41-50
26163137-8	2015	In the presence of DFYSP peptide and CQ, claudin-2 was co-localized with LAMP-1, a lysosomal marker.	Chloroquine	37-39	lysosomal associated membrane protein 1	Homo sapiens	73-79
26271735-7	2015	Gelatin zymography and Matrigel(TM)-coated transwell invasion assays also revealed a 50 % CQ induced inhibition of MMP-2 activity and GBM invasion.	Chloroquine	90-92	matrix metallopeptidase 2	Homo sapiens	115-120
26405051-8	2015	Lerp mutant flies exhibit a 30-40% decrease in the level of several lysosomal hydrolases, and are hypersensitive to dietary chloroquine and starvation, consistent with impaired lysosome function.	Chloroquine	124-135	lysosomal enzyme receptor protein	Drosophila melanogaster	0-4
26254351-8	2015	CONCLUSION: ALL cells expressing WNT16 are sensitive to ER stress, and show enhanced killing after addition of chloroquine.	Chloroquine	111-122	Wnt family member 16	Homo sapiens	33-38
26158232-7	2015	Furthermore, an AAF/CCl4-mediated increase in DR and fibrosis were attenuated after chloroquine treatment, suggesting that the autophagy-lysosome pathway was essential for AAF/CCl4-induced DR-fibrosis.	Chloroquine	84-95	C-C motif chemokine ligand 4	Homo sapiens	20-24
26158232-7	2015	Furthermore, an AAF/CCl4-mediated increase in DR and fibrosis were attenuated after chloroquine treatment, suggesting that the autophagy-lysosome pathway was essential for AAF/CCl4-induced DR-fibrosis.	Chloroquine	84-95	C-C motif chemokine ligand 4	Homo sapiens	176-180
25979647-10	2015	However, the addition of chloroquine (CQ), an autophagy inhibitor, overcame the antagonistic effects, as demonstrated by CDI analysis and Annexin V-FITC/propidium iodide (PI) assays.	Chloroquine	38-40	annexin A5	Homo sapiens	138-147
25979647-13	2015	The Annexin V-FITC/PI assays showed that the addition of CQ significantly the increased the ratio of apoptosis cells.	Chloroquine	57-59	annexin A5	Homo sapiens	4-13
25979647-14	2015	Also, immunoblotting assays exhibited increased Bax and decreased Bcl-2, suggesting that autophagy inhibition by CQ could increase cell apoptosis and thus overcome the antagonistic effects.	Chloroquine	113-115	BCL2 associated X, apoptosis regulator	Homo sapiens	48-51
25979647-14	2015	Also, immunoblotting assays exhibited increased Bax and decreased Bcl-2, suggesting that autophagy inhibition by CQ could increase cell apoptosis and thus overcome the antagonistic effects.	Chloroquine	113-115	BCL2 apoptosis regulator	Homo sapiens	66-71
25979647-16	2015	However, inhibiting autophagy produces a synergistic effect, suggesting that gefitinib and cisplatin combined with an autophagy inhibitor (especially CQ) might be a beneficial strategy to overcome the antagonistic effects between EGFR-TKIs and chemotherapeutic agents.	Chloroquine	150-152	epidermal growth factor receptor	Homo sapiens	230-234
26525066-10	2015	Although CQ-treatment groups suppressed the levels of the potent autophagy inducer, BNIP3, p62 levels were decreased in only the CE group.	Chloroquine	9-11	KH RNA binding domain containing, signal transduction associated 1	Rattus norvegicus	91-94
26071760-10	2015	The combination of high-fat feeding and acute chloroquine treatment induced CHOP, p-eIF2alpha and caspase-3, but not either treatment alone.	Chloroquine	46-57	DNA-damage inducible transcript 3	Mus musculus	76-80
26071760-10	2015	The combination of high-fat feeding and acute chloroquine treatment induced CHOP, p-eIF2alpha and caspase-3, but not either treatment alone.	Chloroquine	46-57	caspase 3	Mus musculus	98-107
26525066-8	2015	CQ treatment caused significant increases in the levels of Beclin-1 and p62, and decreases in the levels of LAMP-2 proteins.	Chloroquine	0-2	beclin 1	Rattus norvegicus	59-67
26525066-8	2015	CQ treatment caused significant increases in the levels of Beclin-1 and p62, and decreases in the levels of LAMP-2 proteins.	Chloroquine	0-2	KH RNA binding domain containing, signal transduction associated 1	Rattus norvegicus	72-75
26525066-8	2015	CQ treatment caused significant increases in the levels of Beclin-1 and p62, and decreases in the levels of LAMP-2 proteins.	Chloroquine	0-2	lysosomal-associated membrane protein 2	Rattus norvegicus	108-114
26026799-1	2015	OBJECTIVES: The photoinitiator diphenyl-(2,4,6-trimethylbenzoyl)phosphine oxide (TPO) is more reactive than a camphorquinone/amine (CQ) system, and TPO-based adhesives obtained a higher degree of conversion (DC) with fewer leached monomers.	Chloroquine	132-134	thyroid peroxidase	Homo sapiens	81-84
26525066-10	2015	Although CQ-treatment groups suppressed the levels of the potent autophagy inducer, BNIP3, p62 levels were decreased in only the CE group.	Chloroquine	9-11	BCL2 interacting protein 3	Rattus norvegicus	84-89
26136140-13	2015	In conclusion, an enhanced antitumor effect was demonstrated following treatment with HNK combined with CQ by inhibiting autophagy and inducing apoptosis via a caspase-dependent and cathepsin D-involved manner.	Chloroquine	104-106	cathepsin D	Homo sapiens	182-193
26043797-8	2015	Pretreatment with the autophagy inhibitors LY294002, 3-methyladenine, chloroquine, and bafilomycin A1 enhanced the induction of apoptosis by MHY218, and this was accompanied by an increase in PARP cleavage.	Chloroquine	70-81	poly(ADP-ribose) polymerase 1	Homo sapiens	192-196
25843701-10	2015	When silkworm NPC2 was used to inhibit FM3A cell growth, that inhibition was attenuated by chloroquine, which inhibits autophagic activity by preventing lysosomal acidification.	Chloroquine	91-102	NPC intracellular cholesterol transporter 2	Mus musculus	14-18
25649430-6	2015	Furthermore, NS5ATP9-mediated autophagy is required for promotion of tumour cell growth, and this effect could be inhibited with 3-methyladenine, chloroquine or by Beclin 1-silencing.	Chloroquine	146-157	PCNA clamp associated factor	Homo sapiens	13-20
26067645-8	2015	The autophagy inhibitor chloroquine, which functions at the late stage of autophagy, significantly reduced resveratrol-induced cell death and caspase 3 activity in human ovarian cancer cells.	Chloroquine	24-35	caspase 3	Homo sapiens	142-151
25872478-11	2015	Following the induction of cerebral trauma, CQ treatment significantly suppressed neuronal autophagy and reduced expression levels of the inflammatory cytokines, interleukin-1beta (IL-1beta) and tumor necrosis factor-alpha (TNF-alpha), in the rat hippocampus.	Chloroquine	44-46	interleukin 1 beta	Rattus norvegicus	162-179
25872478-11	2015	Following the induction of cerebral trauma, CQ treatment significantly suppressed neuronal autophagy and reduced expression levels of the inflammatory cytokines, interleukin-1beta (IL-1beta) and tumor necrosis factor-alpha (TNF-alpha), in the rat hippocampus.	Chloroquine	44-46	interleukin 1 beta	Rattus norvegicus	181-189
25872478-11	2015	Following the induction of cerebral trauma, CQ treatment significantly suppressed neuronal autophagy and reduced expression levels of the inflammatory cytokines, interleukin-1beta (IL-1beta) and tumor necrosis factor-alpha (TNF-alpha), in the rat hippocampus.	Chloroquine	44-46	tumor necrosis factor	Rattus norvegicus	195-222
25872478-11	2015	Following the induction of cerebral trauma, CQ treatment significantly suppressed neuronal autophagy and reduced expression levels of the inflammatory cytokines, interleukin-1beta (IL-1beta) and tumor necrosis factor-alpha (TNF-alpha), in the rat hippocampus.	Chloroquine	44-46	tumor necrosis factor	Rattus norvegicus	224-233
26022120-10	2015	Lysosomal inhibitor chloroquine restored Bcl-xL and Bcr/Abl protein levels and inhibited caspase-3 activation.	Chloroquine	20-31	BCL2 like 1	Homo sapiens	41-47
26022120-10	2015	Lysosomal inhibitor chloroquine restored Bcl-xL and Bcr/Abl protein levels and inhibited caspase-3 activation.	Chloroquine	20-31	ABL proto-oncogene 1, non-receptor tyrosine kinase	Homo sapiens	52-59
26022120-10	2015	Lysosomal inhibitor chloroquine restored Bcl-xL and Bcr/Abl protein levels and inhibited caspase-3 activation.	Chloroquine	20-31	caspase 3	Homo sapiens	89-98
25997470-6	2015	Autophagy flux inhibitor, chloroquine treatment blocked the enhancing effects of TRAIL-induced apoptosis by quercetin.	Chloroquine	26-37	TNF superfamily member 10	Homo sapiens	81-86
26206937-7	2015	In LRBA-deficient cells, inhibition of lysosome degradation with chloroquine prevented CTLA4 loss.	Chloroquine	65-76	LPS responsive beige-like anchor protein	Homo sapiens	3-7
26206937-7	2015	In LRBA-deficient cells, inhibition of lysosome degradation with chloroquine prevented CTLA4 loss.	Chloroquine	65-76	cytotoxic T-lymphocyte associated protein 4	Homo sapiens	87-92
26124091-6	2015	In particular, we found that two antimalarial drugs, amodiaquine and chloroquine stimulate the transcriptional function of Nurr1 through physical interaction with its ligand binding domain (LBD).	Chloroquine	69-80	nuclear receptor subfamily 4, group A, member 2	Rattus norvegicus	123-128
25752684-5	2015	CQ and HCQ significantly increased ARPE-19 monolayer permeability after 3 and 18 h, respectively, and enhanced mRNA levels for claudin-1 and occludin.	Chloroquine	0-2	claudin 1	Homo sapiens	127-136
25752684-5	2015	CQ and HCQ significantly increased ARPE-19 monolayer permeability after 3 and 18 h, respectively, and enhanced mRNA levels for claudin-1 and occludin.	Chloroquine	0-2	occludin	Homo sapiens	141-149
26040000-6	2015	Immunofluorescence showed that PLN and the autophagy marker, microtubule light chain 3, became increasingly colocalized in response to chloroquine and bafilomycin treatments.	Chloroquine	135-146	phospholamban	Mus musculus	31-34
25842161-10	2015	Inhibition of autophagy via knockdown of either ATG5 or ATG7 decreased the sensitivity to CQ.	Chloroquine	90-92	autophagy related 5	Homo sapiens	48-52
25842161-10	2015	Inhibition of autophagy via knockdown of either ATG5 or ATG7 decreased the sensitivity to CQ.	Chloroquine	90-92	autophagy related 7	Homo sapiens	56-60
25023698-6	2015	Strikingly, we found that REV-ERBbeta is a determinant of sensitivity to chloroquine, a clinically relevant lysosomotropic agent that suppresses autophagy.	Chloroquine	73-84	nuclear receptor subfamily 1 group D member 2	Homo sapiens	26-37
26261684-0	2015	Inhibitory effect of chloroquine derivatives on presenilin 1 and ubiquilin 1 expression in Alzheimer"s disease.	Chloroquine	21-32	presenilin 1	Homo sapiens	48-60
26261684-0	2015	Inhibitory effect of chloroquine derivatives on presenilin 1 and ubiquilin 1 expression in Alzheimer"s disease.	Chloroquine	21-32	ubiquilin 1	Homo sapiens	65-76
26261684-4	2015	The results from western blot analysis showed the inhibition of presenilin 1 protein expression on treatment with chloroquine derivative D5 in Daudi cells.	Chloroquine	114-125	presenilin 1	Homo sapiens	64-76
26261684-6	2015	It was observed that chloroquine derivative D5 downregulates presenilin expression via the inhibition of ubiquilin 1 expression.	Chloroquine	21-32	ubiquilin 1	Homo sapiens	105-116
25950487-7	2015	Autophagy blockade by chloroquine in combination with the dual PI3K/mTOR inhibitors significantly induced caspase-independent cell death involving RIP1 in the sensitive cell line SPC212.	Chloroquine	22-33	receptor interacting serine/threonine kinase 1	Homo sapiens	147-151
25521075-10	2015	Lack of p21 protein (p21(-/-) HCT116 cells) increased sensitivity to the apoptotic effects of the combination of tetrandrine and chloroquine.	Chloroquine	129-140	H3 histone pseudogene 16	Homo sapiens	8-11
25691631-1	2015	A nearly complete reversal of chloroquine (CQ) resistance in the CQ-resistant Plasmodium falciparum K-1 strain, with a significant decrease in the mean +- standard deviation (SD) 50% inhibitory concentration (IC50) from 1,050 +- 95 nM to 14 +- 2 nM, was achieved in vitro by the simultaneous administration of 2-aminoethyl diphenylborinate (2-APB).	Chloroquine	30-41	arginyl aminopeptidase (aminopeptidase B)	Mus musculus	343-346
25691631-1	2015	A nearly complete reversal of chloroquine (CQ) resistance in the CQ-resistant Plasmodium falciparum K-1 strain, with a significant decrease in the mean +- standard deviation (SD) 50% inhibitory concentration (IC50) from 1,050 +- 95 nM to 14 +- 2 nM, was achieved in vitro by the simultaneous administration of 2-aminoethyl diphenylborinate (2-APB).	Chloroquine	43-45	arginyl aminopeptidase (aminopeptidase B)	Mus musculus	343-346
25691631-1	2015	A nearly complete reversal of chloroquine (CQ) resistance in the CQ-resistant Plasmodium falciparum K-1 strain, with a significant decrease in the mean +- standard deviation (SD) 50% inhibitory concentration (IC50) from 1,050 +- 95 nM to 14 +- 2 nM, was achieved in vitro by the simultaneous administration of 2-aminoethyl diphenylborinate (2-APB).	Chloroquine	65-67	arginyl aminopeptidase (aminopeptidase B)	Mus musculus	343-346
25691631-2	2015	The CQ resistance-reversing activity of 2-APB, which showed the same efficacy as verapamil, was also observed in an in vivo mouse infection model with the CQ-resistant Plasmodium chabaudi AS(30CQ) strain.	Chloroquine	4-6	arginyl aminopeptidase (aminopeptidase B)	Mus musculus	42-45
25691631-2	2015	The CQ resistance-reversing activity of 2-APB, which showed the same efficacy as verapamil, was also observed in an in vivo mouse infection model with the CQ-resistant Plasmodium chabaudi AS(30CQ) strain.	Chloroquine	155-157	arginyl aminopeptidase (aminopeptidase B)	Mus musculus	42-45
25521075-10	2015	Lack of p21 protein (p21(-/-) HCT116 cells) increased sensitivity to the apoptotic effects of the combination of tetrandrine and chloroquine.	Chloroquine	129-140	H3 histone pseudogene 16	Homo sapiens	21-24
25734693-8	2015	Chloroquine has been shown to stabilize p53 and induce p53-dependent apoptosis or cell cycle arrest.	Chloroquine	0-11	tumor protein p53	Homo sapiens	40-43
25681668-0	2015	The synergistic effect of combination temozolomide and chloroquine treatment is dependent on autophagy formation and p53 status in glioma cells.	Chloroquine	55-66	tumor protein p53	Homo sapiens	117-120
25681668-2	2015	The late autophagy inhibitor chloroquine (CQ) inhibits glioblastoma tumors in a p53-independent and p53-dependent manner.	Chloroquine	29-40	tumor protein p53	Homo sapiens	80-83
25681668-2	2015	The late autophagy inhibitor chloroquine (CQ) inhibits glioblastoma tumors in a p53-independent and p53-dependent manner.	Chloroquine	29-40	tumor protein p53	Homo sapiens	100-103
25681668-2	2015	The late autophagy inhibitor chloroquine (CQ) inhibits glioblastoma tumors in a p53-independent and p53-dependent manner.	Chloroquine	42-44	tumor protein p53	Homo sapiens	80-83
25681668-2	2015	The late autophagy inhibitor chloroquine (CQ) inhibits glioblastoma tumors in a p53-independent and p53-dependent manner.	Chloroquine	42-44	tumor protein p53	Homo sapiens	100-103
25681668-4	2015	Combination treatment of U87 cell (wild type p53) with TMZ and CQ synergistically reduced cell proliferation and enhanced apoptosis, with increased sub-G1 hypodiploid cells and caspase activation.	Chloroquine	63-65	tumor protein p53	Homo sapiens	45-48
25681668-12	2015	Our data support the beneficial effect of combination treatment with TMZ and CQ in glioma via differential autophagy-associated mechanisms, depending on p53 status.	Chloroquine	77-79	tumor protein p53	Homo sapiens	153-156
25734693-8	2015	Chloroquine has been shown to stabilize p53 and induce p53-dependent apoptosis or cell cycle arrest.	Chloroquine	0-11	tumor protein p53	Homo sapiens	55-58
26018263-3	2015	q-PCR was used to assess the expression of MDR1 mRNA and Western blotting was employed to detect P-glycoprotein (P-gp) expression in HNE1 and HNE1/DDP cells exposed to 5 and 10 micromol/L chloroquine.	Chloroquine	188-199	ATP binding cassette subfamily B member 1	Homo sapiens	97-111
26018263-6	2015	The expressions of MDR1 mRNA and P-gp protein were significantly lowered in the cells treated with chloroquine.	Chloroquine	99-110	ATP binding cassette subfamily B member 1	Homo sapiens	19-23
26018263-6	2015	The expressions of MDR1 mRNA and P-gp protein were significantly lowered in the cells treated with chloroquine.	Chloroquine	99-110	ATP binding cassette subfamily B member 1	Homo sapiens	33-37
26018263-7	2015	CONCLUSION: Chloroquine can reverse multidrug resistance in HNE1&lt;DDP cells possibly through down-regulation of MDR1 and inhibition of P-gp protein.	Chloroquine	12-23	ATP binding cassette subfamily B member 1	Homo sapiens	114-118
26018263-7	2015	CONCLUSION: Chloroquine can reverse multidrug resistance in HNE1&lt;DDP cells possibly through down-regulation of MDR1 and inhibition of P-gp protein.	Chloroquine	12-23	ATP binding cassette subfamily B member 1	Homo sapiens	137-141
25637161-5	2015	BEZ235 and CQ cooperate to activate caspase-9, -3 and -8, which is crucial for apoptosis induction given that the broad-range caspase inhibitor N-benzyloxycarbonyl-Val-Ala-Asp-fluoromethylketone (zVAD.fmk) blocks BEZ235/CQ-induced apoptosis.	Chloroquine	11-13	caspase 9	Homo sapiens	36-56
25637161-5	2015	BEZ235 and CQ cooperate to activate caspase-9, -3 and -8, which is crucial for apoptosis induction given that the broad-range caspase inhibitor N-benzyloxycarbonyl-Val-Ala-Asp-fluoromethylketone (zVAD.fmk) blocks BEZ235/CQ-induced apoptosis.	Chloroquine	220-222	caspase 9	Homo sapiens	36-56
25637161-9	2015	Also, overexpression of antiapoptotic BCL-2 leads to a significant reduction of BEZ235/CQ-induced apoptosis, emphasizing that an intact mitochondrial pathway of apoptosis is required for BEZ235/CQ-induced cell death.	Chloroquine	87-89	BCL2 apoptosis regulator	Homo sapiens	38-43
25637161-9	2015	Also, overexpression of antiapoptotic BCL-2 leads to a significant reduction of BEZ235/CQ-induced apoptosis, emphasizing that an intact mitochondrial pathway of apoptosis is required for BEZ235/CQ-induced cell death.	Chloroquine	194-196	BCL2 apoptosis regulator	Homo sapiens	38-43
25637161-8	2015	Importantly, our molecular studies reveal that BEZ235/CQ-induced apoptosis is mediated by cooperative downregulation of the antiapoptotic BCL-2 family protein MCL-1, since stabilization of MCL-1 by expression of a non-degradable MCL-1 phospho-defective mutant significantly decreases BEZ235/CQ-induced apoptosis.	Chloroquine	54-56	BCL2 apoptosis regulator	Homo sapiens	138-143
25637161-8	2015	Importantly, our molecular studies reveal that BEZ235/CQ-induced apoptosis is mediated by cooperative downregulation of the antiapoptotic BCL-2 family protein MCL-1, since stabilization of MCL-1 by expression of a non-degradable MCL-1 phospho-defective mutant significantly decreases BEZ235/CQ-induced apoptosis.	Chloroquine	54-56	MCL1 apoptosis regulator, BCL2 family member	Homo sapiens	159-164
25637161-8	2015	Importantly, our molecular studies reveal that BEZ235/CQ-induced apoptosis is mediated by cooperative downregulation of the antiapoptotic BCL-2 family protein MCL-1, since stabilization of MCL-1 by expression of a non-degradable MCL-1 phospho-defective mutant significantly decreases BEZ235/CQ-induced apoptosis.	Chloroquine	54-56	MCL1 apoptosis regulator, BCL2 family member	Homo sapiens	189-194
25923669-4	2015	Chloroquine (CQ) has been reported to enhance the effectiveness of chemotherapy and radiotherapy in liver, pancreas, breast, prostate and colon tumors, but it is unclear whether CQ could increase the efficacy of DDP for treating HSCC.	Chloroquine	0-11	translocase of inner mitochondrial membrane 8A	Homo sapiens	212-215
25923669-8	2015	We found that CQ inhibited autophagy and increased DDP-induced apoptosis in the xenograft mouse model.	Chloroquine	14-16	translocase of inner mitochondrial membrane 8A	Homo sapiens	51-54
25637161-8	2015	Importantly, our molecular studies reveal that BEZ235/CQ-induced apoptosis is mediated by cooperative downregulation of the antiapoptotic BCL-2 family protein MCL-1, since stabilization of MCL-1 by expression of a non-degradable MCL-1 phospho-defective mutant significantly decreases BEZ235/CQ-induced apoptosis.	Chloroquine	54-56	MCL1 apoptosis regulator, BCL2 family member	Homo sapiens	189-194
25915936-9	2015	This IL-8-stimulated activity was blocked by chloroquine and NH4Cl, indicating that endosomal acidification is important for this effect.	Chloroquine	45-56	C-X-C motif chemokine ligand 8	Homo sapiens	5-9
25923669-9	2015	CQ enhanced the efficacy of DDP, resulting in decreased tumor growth and prolonged survival of the mice.	Chloroquine	0-2	translocase of inner mitochondrial membrane 8A	Homo sapiens	28-31
25778869-9	2015	CQ was found to block the Cd-induced decrease in Cx43 and GJIC inhibition, whereas RAP had opposite effect.	Chloroquine	0-2	gap junction protein, alpha 1	Rattus norvegicus	49-53
25831526-9	2015	A 2-muM concentration of chloroquine fully arrests layer generation and step advancement, which is ~10(4)x less than hematin"s physiological concentration.	Chloroquine	25-36	latexin	Homo sapiens	4-7
25797246-5	2015	Mechanistically, chloroquine enhanced MLN4924-induced up-regulation of pro-apoptotic proteins (e.g. NOXA) and down-regulation of anti-apoptotic proteins.	Chloroquine	17-28	phorbol-12-myristate-13-acetate-induced protein 1	Homo sapiens	100-104
25900832-9	2015	Inhibition of endosomal vacuolar adenosine triphosphatase (V-ATPase) with chloroquine or bafilomycin A1 blocked p45-IKKalpha phosphorylation and induced apoptosis in BRAF-mutant CRC cells independent of autophagy.	Chloroquine	74-85	ATPase, H+ transporting, lysosomal V0 subunit D2	Mus musculus	24-57
25900832-9	2015	Inhibition of endosomal vacuolar adenosine triphosphatase (V-ATPase) with chloroquine or bafilomycin A1 blocked p45-IKKalpha phosphorylation and induced apoptosis in BRAF-mutant CRC cells independent of autophagy.	Chloroquine	74-85	ATPase, H+ transporting, lysosomal V0 subunit D2	Mus musculus	59-67
25900832-9	2015	Inhibition of endosomal vacuolar adenosine triphosphatase (V-ATPase) with chloroquine or bafilomycin A1 blocked p45-IKKalpha phosphorylation and induced apoptosis in BRAF-mutant CRC cells independent of autophagy.	Chloroquine	74-85	nuclear factor, erythroid derived 2	Mus musculus	112-124
25900832-9	2015	Inhibition of endosomal vacuolar adenosine triphosphatase (V-ATPase) with chloroquine or bafilomycin A1 blocked p45-IKKalpha phosphorylation and induced apoptosis in BRAF-mutant CRC cells independent of autophagy.	Chloroquine	74-85	Braf transforming gene	Mus musculus	166-170
25721154-3	2015	In this cross-sectional study, we investigated the association of MIF and TNFalpha serum levels with methotrexate (MTX) and in combination with chloroquine (CLQ) and sulfasalazine (SSZ) in RA patients classified according to the ACR/EULAR 2010 criteria.	Chloroquine	144-155	macrophage migration inhibitory factor	Homo sapiens	66-69
25884947-8	2015	Conversely, chloroquine-treated VCPR155H/+ mice revealed progressive muscle weakness, cytoplasmic accumulation of TDP-43, ubiquitin-positive inclusion bodies and increased LC3-I/II, p62/SQSTM1, and optineurin expression levels.	Chloroquine	12-23	sequestosome 1	Homo sapiens	186-192
25884947-8	2015	Conversely, chloroquine-treated VCPR155H/+ mice revealed progressive muscle weakness, cytoplasmic accumulation of TDP-43, ubiquitin-positive inclusion bodies and increased LC3-I/II, p62/SQSTM1, and optineurin expression levels.	Chloroquine	12-23	optineurin	Homo sapiens	198-208
25884947-8	2015	Conversely, chloroquine-treated VCPR155H/+ mice revealed progressive muscle weakness, cytoplasmic accumulation of TDP-43, ubiquitin-positive inclusion bodies and increased LC3-I/II, p62/SQSTM1, and optineurin expression levels.	Chloroquine	12-23	TAR DNA binding protein	Homo sapiens	114-120
25884947-8	2015	Conversely, chloroquine-treated VCPR155H/+ mice revealed progressive muscle weakness, cytoplasmic accumulation of TDP-43, ubiquitin-positive inclusion bodies and increased LC3-I/II, p62/SQSTM1, and optineurin expression levels.	Chloroquine	12-23	ubiquitin C	Homo sapiens	122-131
25884947-8	2015	Conversely, chloroquine-treated VCPR155H/+ mice revealed progressive muscle weakness, cytoplasmic accumulation of TDP-43, ubiquitin-positive inclusion bodies and increased LC3-I/II, p62/SQSTM1, and optineurin expression levels.	Chloroquine	12-23	sequestosome 1	Homo sapiens	182-185
25721154-3	2015	In this cross-sectional study, we investigated the association of MIF and TNFalpha serum levels with methotrexate (MTX) and in combination with chloroquine (CLQ) and sulfasalazine (SSZ) in RA patients classified according to the ACR/EULAR 2010 criteria.	Chloroquine	157-160	macrophage migration inhibitory factor	Homo sapiens	66-69
25721154-3	2015	In this cross-sectional study, we investigated the association of MIF and TNFalpha serum levels with methotrexate (MTX) and in combination with chloroquine (CLQ) and sulfasalazine (SSZ) in RA patients classified according to the ACR/EULAR 2010 criteria.	Chloroquine	157-160	tumor necrosis factor	Homo sapiens	74-82
25721154-7	2015	Furthermore, we subclassified 97 patients with established RA (&gt;=2 years of disease duration) and found that TNFalpha serum levels were lower in the combination therapy group (MTX + CLQ + SSZ) in comparison with the monotherapy MTX group (16.7 pg/mL versus 13.6 pg/mL, p = 0.02).	Chloroquine	185-188	tumor necrosis factor	Homo sapiens	112-120
25775599-8	2015	The lysosomal inhibitor chloroquine or siRNA knockdown of Atg7 inhibited ORMDL1 degradation by cholesterol, whereas proteasome inhibitors showed no effect.	Chloroquine	24-35	ORMDL sphingolipid biosynthesis regulator 1	Homo sapiens	73-79
25647735-8	2015	In addition, CQ plus RES synergistically decreased the levels of both autophagy initiator beclin-1 and autophagy supporter p62.	Chloroquine	13-15	beclin 1, autophagy related	Mus musculus	90-98
25647735-8	2015	In addition, CQ plus RES synergistically decreased the levels of both autophagy initiator beclin-1 and autophagy supporter p62.	Chloroquine	13-15	nucleoporin 62	Mus musculus	123-126
25807554-6	2015	Compared with PC-9/wt cells, both PC-9/gefB4 and PC-9/gefE3 cells demonstrated higher basal LC3-II levels which were inhibited by 3-methyladenine (3-MA, an autophagy inhibitor) and potentiated by chloroquine (CQ, an inhibitor of autophagolysosomes formation), indicating elevated autophagy in PC-9/gef cells.	Chloroquine	196-207	proprotein convertase subtilisin/kexin type 9	Homo sapiens	34-38
25807554-6	2015	Compared with PC-9/wt cells, both PC-9/gefB4 and PC-9/gefE3 cells demonstrated higher basal LC3-II levels which were inhibited by 3-methyladenine (3-MA, an autophagy inhibitor) and potentiated by chloroquine (CQ, an inhibitor of autophagolysosomes formation), indicating elevated autophagy in PC-9/gef cells.	Chloroquine	196-207	proprotein convertase subtilisin/kexin type 9	Homo sapiens	34-38
25807554-6	2015	Compared with PC-9/wt cells, both PC-9/gefB4 and PC-9/gefE3 cells demonstrated higher basal LC3-II levels which were inhibited by 3-methyladenine (3-MA, an autophagy inhibitor) and potentiated by chloroquine (CQ, an inhibitor of autophagolysosomes formation), indicating elevated autophagy in PC-9/gef cells.	Chloroquine	196-207	proprotein convertase subtilisin/kexin type 9	Homo sapiens	34-38
25807554-6	2015	Compared with PC-9/wt cells, both PC-9/gefB4 and PC-9/gefE3 cells demonstrated higher basal LC3-II levels which were inhibited by 3-methyladenine (3-MA, an autophagy inhibitor) and potentiated by chloroquine (CQ, an inhibitor of autophagolysosomes formation), indicating elevated autophagy in PC-9/gef cells.	Chloroquine	209-211	proprotein convertase subtilisin/kexin type 9	Homo sapiens	34-38
25807554-6	2015	Compared with PC-9/wt cells, both PC-9/gefB4 and PC-9/gefE3 cells demonstrated higher basal LC3-II levels which were inhibited by 3-methyladenine (3-MA, an autophagy inhibitor) and potentiated by chloroquine (CQ, an inhibitor of autophagolysosomes formation), indicating elevated autophagy in PC-9/gef cells.	Chloroquine	209-211	proprotein convertase subtilisin/kexin type 9	Homo sapiens	34-38
25807554-6	2015	Compared with PC-9/wt cells, both PC-9/gefB4 and PC-9/gefE3 cells demonstrated higher basal LC3-II levels which were inhibited by 3-methyladenine (3-MA, an autophagy inhibitor) and potentiated by chloroquine (CQ, an inhibitor of autophagolysosomes formation), indicating elevated autophagy in PC-9/gef cells.	Chloroquine	209-211	proprotein convertase subtilisin/kexin type 9	Homo sapiens	34-38
25807554-7	2015	3-MA and CQ concentration-dependently inhibited cell survival of both PC-9wt and PC-9/gef cells, suggesting that autophagy may be pro-survival.	Chloroquine	9-11	proprotein convertase subtilisin/kexin type 9	Homo sapiens	70-74
25807554-9	2015	In PC-9/wt cells, CQ potentiated the cytotoxicity by low gefitinib (3 nM).	Chloroquine	18-20	proprotein convertase subtilisin/kexin type 9	Homo sapiens	3-7
25807554-10	2015	Moreover, CQ overcame the acquired gefitinib resistance in PC-9/gef cells by enhancing gefitinib-induced cytotoxicity, activation of caspase 3 and poly (ADP-ribose) polymerase cleavage.	Chloroquine	10-12	proprotein convertase subtilisin/kexin type 9	Homo sapiens	59-63
25807554-10	2015	Moreover, CQ overcame the acquired gefitinib resistance in PC-9/gef cells by enhancing gefitinib-induced cytotoxicity, activation of caspase 3 and poly (ADP-ribose) polymerase cleavage.	Chloroquine	10-12	caspase 3	Homo sapiens	133-175
25572822-6	2015	We demonstrated that chloroquine (CQ) and 2-(4-morpholinyl)-8-phenylchromone (LY294002) could effectively reduce TRAIL-refractory breast cancer cell viability.	Chloroquine	21-32	TNF superfamily member 10	Homo sapiens	113-118
25542417-8	2015	Treatment with chloroquine, a drug known to inhibit the secretion of many proteins, abolished the MMP-9-mCherry secretion, demonstrating the utility of this method in a biological experiment.	Chloroquine	15-26	matrix metallopeptidase 9	Homo sapiens	98-103
25884411-12	2015	CONCLUSIONS: Our findings demonstrate that minor alleles of common genetic variants in ABCA4 significantly reduce susceptibility to develop toxic maculopathy under CQ treatment.	Chloroquine	164-166	ATP binding cassette subfamily A member 4	Homo sapiens	87-92
25601714-7	2015	Both lysosome inhibitors (chloroquine, pepstatin A plus E64d) and proteasome inhibitor MG132 can inhibit Hsf4-mediated Hsf1 protein degradation, but MG132 can induce Hsf1 activation as well.	Chloroquine	26-37	heat shock transcription factor 4	Homo sapiens	105-109
25601714-7	2015	Both lysosome inhibitors (chloroquine, pepstatin A plus E64d) and proteasome inhibitor MG132 can inhibit Hsf4-mediated Hsf1 protein degradation, but MG132 can induce Hsf1 activation as well.	Chloroquine	26-37	heat shock transcription factor 1	Homo sapiens	119-123
25884411-0	2015	Common synonymous variants in ABCA4 are protective for chloroquine induced maculopathy (toxic maculopathy).	Chloroquine	55-66	ATP binding cassette subfamily A member 4	Homo sapiens	30-35
25624003-8	2015	We report here that both restoring the PGRN content, by suberoylanilide hydroxamic acid (SAHA) or chloroquine (CQ), as blocking ERK1/2 activation by selumetinib (AZD6244) or MEK162 (ARRY-162), normalized the CDK6/pRb pathway and the proliferative activity of PGRN deficient cells.	Chloroquine	98-109	granulin precursor	Homo sapiens	39-43
25624003-8	2015	We report here that both restoring the PGRN content, by suberoylanilide hydroxamic acid (SAHA) or chloroquine (CQ), as blocking ERK1/2 activation by selumetinib (AZD6244) or MEK162 (ARRY-162), normalized the CDK6/pRb pathway and the proliferative activity of PGRN deficient cells.	Chloroquine	98-109	mitogen-activated protein kinase 3	Homo sapiens	128-134
25624003-8	2015	We report here that both restoring the PGRN content, by suberoylanilide hydroxamic acid (SAHA) or chloroquine (CQ), as blocking ERK1/2 activation by selumetinib (AZD6244) or MEK162 (ARRY-162), normalized the CDK6/pRb pathway and the proliferative activity of PGRN deficient cells.	Chloroquine	111-113	granulin precursor	Homo sapiens	39-43
25624003-8	2015	We report here that both restoring the PGRN content, by suberoylanilide hydroxamic acid (SAHA) or chloroquine (CQ), as blocking ERK1/2 activation by selumetinib (AZD6244) or MEK162 (ARRY-162), normalized the CDK6/pRb pathway and the proliferative activity of PGRN deficient cells.	Chloroquine	111-113	mitogen-activated protein kinase 3	Homo sapiens	128-134
25624003-8	2015	We report here that both restoring the PGRN content, by suberoylanilide hydroxamic acid (SAHA) or chloroquine (CQ), as blocking ERK1/2 activation by selumetinib (AZD6244) or MEK162 (ARRY-162), normalized the CDK6/pRb pathway and the proliferative activity of PGRN deficient cells.	Chloroquine	111-113	cyclin dependent kinase 6	Homo sapiens	208-212
25624003-8	2015	We report here that both restoring the PGRN content, by suberoylanilide hydroxamic acid (SAHA) or chloroquine (CQ), as blocking ERK1/2 activation by selumetinib (AZD6244) or MEK162 (ARRY-162), normalized the CDK6/pRb pathway and the proliferative activity of PGRN deficient cells.	Chloroquine	111-113	RB transcriptional corepressor 1	Homo sapiens	213-216
25624003-8	2015	We report here that both restoring the PGRN content, by suberoylanilide hydroxamic acid (SAHA) or chloroquine (CQ), as blocking ERK1/2 activation by selumetinib (AZD6244) or MEK162 (ARRY-162), normalized the CDK6/pRb pathway and the proliferative activity of PGRN deficient cells.	Chloroquine	111-113	granulin precursor	Homo sapiens	259-263
25572822-6	2015	We demonstrated that chloroquine (CQ) and 2-(4-morpholinyl)-8-phenylchromone (LY294002) could effectively reduce TRAIL-refractory breast cancer cell viability.	Chloroquine	34-36	TNF superfamily member 10	Homo sapiens	113-118
25572822-7	2015	Combination of TRAIL with CQ could effectively reverse the resistance of MDA-MB-231 TRAIL-refractory cells to TRAIL.	Chloroquine	26-28	TNF superfamily member 10	Homo sapiens	84-89
25572822-7	2015	Combination of TRAIL with CQ could effectively reverse the resistance of MDA-MB-231 TRAIL-refractory cells to TRAIL.	Chloroquine	26-28	TNF superfamily member 10	Homo sapiens	84-89
25645145-8	2015	Intrathecal chloroquine injection in naive mice induced spinal accumulation of LC3 and p62 paralleled by significant mechanical hypersensitivity thus confirming the block in autophagosome clearance and suggesting the participation of the autophagic process in spinal mechanisms of pain processing.	Chloroquine	12-23	nucleoporin 62	Mus musculus	87-90
25528635-7	2015	TMZ (100-1,000 muM) alone did not affect mitochondrial ROS or cell death in C6 cells, but when administered with CQ (10 muM), it increased mitochondrial ROS and cell death.	Chloroquine	113-115	latexin	Homo sapiens	120-123
25498902-0	2015	Endoplasmic reticulum stress and cell death in mTORC1-overactive cells is induced by nelfinavir and enhanced by chloroquine.	Chloroquine	112-123	CREB regulated transcription coactivator 1	Mus musculus	47-53
25498902-7	2015	Combination of nelfinavir and chloroquine significantly increased ER stress and caused selective cell death in multiple cell line models with hyper-active mTORC1, whilst control cells with normalised mTORC1 signalling tolerated treatment.	Chloroquine	30-41	CREB regulated transcription coactivator 1	Mus musculus	155-161
25498902-9	2015	Our research demonstrates that combination of nelfinavir and chloroquine has therapeutic potential for treatment of mTORC1-driven tumours.	Chloroquine	61-72	CREB regulated transcription coactivator 1	Mus musculus	116-122
25738356-5	2015	Moreover, blocking autophagy using pharmacological inhibitors LY294002, chloroquine (CQ) and quinacrine (QN) enhanced asparaginase-induced cell death and apoptosis, indicating the cytoprotective role of autophagy in asparaginase-treated K562 and KU812 cells.	Chloroquine	72-83	asparaginase	Homo sapiens	118-130
25738356-5	2015	Moreover, blocking autophagy using pharmacological inhibitors LY294002, chloroquine (CQ) and quinacrine (QN) enhanced asparaginase-induced cell death and apoptosis, indicating the cytoprotective role of autophagy in asparaginase-treated K562 and KU812 cells.	Chloroquine	72-83	asparaginase	Homo sapiens	216-228
25738356-5	2015	Moreover, blocking autophagy using pharmacological inhibitors LY294002, chloroquine (CQ) and quinacrine (QN) enhanced asparaginase-induced cell death and apoptosis, indicating the cytoprotective role of autophagy in asparaginase-treated K562 and KU812 cells.	Chloroquine	85-87	asparaginase	Homo sapiens	118-130
25738356-5	2015	Moreover, blocking autophagy using pharmacological inhibitors LY294002, chloroquine (CQ) and quinacrine (QN) enhanced asparaginase-induced cell death and apoptosis, indicating the cytoprotective role of autophagy in asparaginase-treated K562 and KU812 cells.	Chloroquine	85-87	asparaginase	Homo sapiens	216-228
25622137-6	2015	Gossypetin triggered autophagic flux was further confirmed by an increase in the level of LC3-II under pretreatment conditions with an autophagy inhibitor, chloroquine (CQ).	Chloroquine	156-167	microtubule associated protein 1 light chain 3 alpha	Homo sapiens	90-93
25622137-6	2015	Gossypetin triggered autophagic flux was further confirmed by an increase in the level of LC3-II under pretreatment conditions with an autophagy inhibitor, chloroquine (CQ).	Chloroquine	169-171	microtubule associated protein 1 light chain 3 alpha	Homo sapiens	90-93
24990399-9	2015	TLR7 and TLR9 inhibition using IRS-954 or chloroquine significantly reduced HuH7 cell proliferation in vitro and inhibited tumour growth in the mouse xenograft model.	Chloroquine	42-53	toll like receptor 7	Homo sapiens	0-4
24990399-9	2015	TLR7 and TLR9 inhibition using IRS-954 or chloroquine significantly reduced HuH7 cell proliferation in vitro and inhibited tumour growth in the mouse xenograft model.	Chloroquine	42-53	toll like receptor 9	Homo sapiens	9-13
24990399-9	2015	TLR7 and TLR9 inhibition using IRS-954 or chloroquine significantly reduced HuH7 cell proliferation in vitro and inhibited tumour growth in the mouse xenograft model.	Chloroquine	42-53	MIR7-3 host gene	Homo sapiens	76-80
24990399-11	2015	CONCLUSION: The data suggest that inhibiting TLR7 and TLR9 with IRS-954 or chloroquine could potentially be used as a novel therapeutic approach for preventing HCC development and/or progression in susceptible patients.	Chloroquine	75-86	toll like receptor 7	Homo sapiens	45-49
24990399-11	2015	CONCLUSION: The data suggest that inhibiting TLR7 and TLR9 with IRS-954 or chloroquine could potentially be used as a novel therapeutic approach for preventing HCC development and/or progression in susceptible patients.	Chloroquine	75-86	toll like receptor 9	Homo sapiens	54-58
25524470-5	2015	Furthermore, DFO treatment induced autophagy flux, and chloroquine, an autophagy inhibitor, blocked DFO-mediated inhibition of TRAIL-induced apoptosis.	Chloroquine	55-66	TNF superfamily member 10	Homo sapiens	127-132
25774384-8	2015	Inversely, restoration of CREG1 activates cardiac autophagy, Furthermore, chloroquine, an inhibitor of lysosomal acidification, was used to confirm that CREG1 protected the heart tissue against Ang II-induced fibrosis by activating autophagy.	Chloroquine	74-85	cellular repressor of E1A-stimulated genes 1	Mus musculus	153-158
25774384-8	2015	Inversely, restoration of CREG1 activates cardiac autophagy, Furthermore, chloroquine, an inhibitor of lysosomal acidification, was used to confirm that CREG1 protected the heart tissue against Ang II-induced fibrosis by activating autophagy.	Chloroquine	74-85	angiotensinogen (serpin peptidase inhibitor, clade A, member 8)	Mus musculus	194-200
25484071-4	2015	LC3 lipidation by this mechanism is induced by treatment of cells with the lysosomotropic agent chloroquine, and through exposure to the Heliobacter pylori pore-forming toxin VacA.	Chloroquine	96-107	microtubule associated protein 1 light chain 3 alpha	Homo sapiens	0-3
25376834-4	2015	Inhibition of autophagy by bafilomycin A1 or chloroquine treatment during amino acid scarcity abolished mTORC1 signaling, an effect that could be rescued by inhibiting protein synthesis or amino acid supplementation, respectively.	Chloroquine	45-56	CREB regulated transcription coactivator 1	Mus musculus	104-110
25558916-4	2015	In this study, we investigated the novel PKC isoform PKCdelta as an intracellular modulator of itch signaling in response to histamine and the non-histaminergic pruritogens chloroquine and beta-alanine.	Chloroquine	173-184	protein kinase C, delta	Mus musculus	41-44
25558916-4	2015	In this study, we investigated the novel PKC isoform PKCdelta as an intracellular modulator of itch signaling in response to histamine and the non-histaminergic pruritogens chloroquine and beta-alanine.	Chloroquine	173-184	protein kinase C, delta	Mus musculus	53-61
25369757-0	2015	Chloroquine inhibits MGC803 gastric cancer cell migration via the Toll-like receptor 9/nuclear factor kappa B signaling pathway.	Chloroquine	0-11	toll like receptor 9	Homo sapiens	66-86
25369757-2	2015	The present study aimed to evaluate the expression of TLR9 in MGC803 gastric cancer cells and investigate the effect of a non-specific TLR9 inhibitor, chloroquine (CQ), on MGC803 cell migration via the TLR9/nuclear factor kappa B (NFkappaB) signaling pathway.	Chloroquine	151-162	toll like receptor 9	Homo sapiens	135-139
25369757-2	2015	The present study aimed to evaluate the expression of TLR9 in MGC803 gastric cancer cells and investigate the effect of a non-specific TLR9 inhibitor, chloroquine (CQ), on MGC803 cell migration via the TLR9/nuclear factor kappa B (NFkappaB) signaling pathway.	Chloroquine	151-162	nuclear factor kappa B subunit 1	Homo sapiens	202-229
25369757-2	2015	The present study aimed to evaluate the expression of TLR9 in MGC803 gastric cancer cells and investigate the effect of a non-specific TLR9 inhibitor, chloroquine (CQ), on MGC803 cell migration via the TLR9/nuclear factor kappa B (NFkappaB) signaling pathway.	Chloroquine	151-162	nuclear factor kappa B subunit 1	Homo sapiens	231-239
25369757-2	2015	The present study aimed to evaluate the expression of TLR9 in MGC803 gastric cancer cells and investigate the effect of a non-specific TLR9 inhibitor, chloroquine (CQ), on MGC803 cell migration via the TLR9/nuclear factor kappa B (NFkappaB) signaling pathway.	Chloroquine	164-166	toll like receptor 9	Homo sapiens	135-139
25369757-2	2015	The present study aimed to evaluate the expression of TLR9 in MGC803 gastric cancer cells and investigate the effect of a non-specific TLR9 inhibitor, chloroquine (CQ), on MGC803 cell migration via the TLR9/nuclear factor kappa B (NFkappaB) signaling pathway.	Chloroquine	164-166	nuclear factor kappa B subunit 1	Homo sapiens	202-229
25369757-2	2015	The present study aimed to evaluate the expression of TLR9 in MGC803 gastric cancer cells and investigate the effect of a non-specific TLR9 inhibitor, chloroquine (CQ), on MGC803 cell migration via the TLR9/nuclear factor kappa B (NFkappaB) signaling pathway.	Chloroquine	164-166	nuclear factor kappa B subunit 1	Homo sapiens	231-239
25369757-7	2015	The results indicated that MGC803 cells expressed TLR9 and that CQ had anti-proliferative effects on MGC803 cells and inhibited mRNA expression of COX-2, MMP-2, MMP-7 and NFkappaB p65 (P&lt;0.05).	Chloroquine	64-66	prostaglandin-endoperoxide synthase 2	Homo sapiens	147-152
25369757-7	2015	The results indicated that MGC803 cells expressed TLR9 and that CQ had anti-proliferative effects on MGC803 cells and inhibited mRNA expression of COX-2, MMP-2, MMP-7 and NFkappaB p65 (P&lt;0.05).	Chloroquine	64-66	matrix metallopeptidase 2	Homo sapiens	154-159
25369757-7	2015	The results indicated that MGC803 cells expressed TLR9 and that CQ had anti-proliferative effects on MGC803 cells and inhibited mRNA expression of COX-2, MMP-2, MMP-7 and NFkappaB p65 (P&lt;0.05).	Chloroquine	64-66	matrix metallopeptidase 7	Homo sapiens	161-166
25369757-7	2015	The results indicated that MGC803 cells expressed TLR9 and that CQ had anti-proliferative effects on MGC803 cells and inhibited mRNA expression of COX-2, MMP-2, MMP-7 and NFkappaB p65 (P&lt;0.05).	Chloroquine	64-66	nuclear factor kappa B subunit 1	Homo sapiens	171-179
25369757-7	2015	The results indicated that MGC803 cells expressed TLR9 and that CQ had anti-proliferative effects on MGC803 cells and inhibited mRNA expression of COX-2, MMP-2, MMP-7 and NFkappaB p65 (P&lt;0.05).	Chloroquine	64-66	RELA proto-oncogene, NF-kB subunit	Homo sapiens	180-183
25369757-8	2015	Furthermore, CQ inhibited the bioactivity of NFkappaB p65 and prevented the migration of MGC803 cells in a dose-dependent manner (P&lt;0.05).	Chloroquine	13-15	nuclear factor kappa B subunit 1	Homo sapiens	45-53
25369757-8	2015	Furthermore, CQ inhibited the bioactivity of NFkappaB p65 and prevented the migration of MGC803 cells in a dose-dependent manner (P&lt;0.05).	Chloroquine	13-15	RELA proto-oncogene, NF-kB subunit	Homo sapiens	54-57
25369757-9	2015	In conclusion, the results indicated that the TLR9/NFkappaB signaling pathway was involved in gastric cancer cell migration and that CQ had anti-tumor activity.	Chloroquine	133-135	toll like receptor 9	Homo sapiens	46-50
25617421-6	2015	Inhibition of autophagy with a PI3K inhibitor (3-MA), a ROS scavenger (NAC) or autophagosomal-lysosomal fusion inhibitors (bafilomycin A1 and chloroquine) rescued rMIF-induced vascular leakage, suggesting that autophagy mediates MIF-induced vascular leakage.	Chloroquine	142-153	macrophage migration inhibitory factor	Homo sapiens	164-167
25773848-5	2015	Moreover, chloroquine stabilized the protein level of prolyl hydroxylase domain proteins (PHD-2) but reduced the levels of hypoxic responsive proteins such as hypoxia-inducible factor (HIF-1alpha) and vascular endothelial growth factor (VEGF).	Chloroquine	10-21	egl-9 family hypoxia inducible factor 1	Homo sapiens	90-95
25773848-5	2015	Moreover, chloroquine stabilized the protein level of prolyl hydroxylase domain proteins (PHD-2) but reduced the levels of hypoxic responsive proteins such as hypoxia-inducible factor (HIF-1alpha) and vascular endothelial growth factor (VEGF).	Chloroquine	10-21	hypoxia inducible factor 1 subunit alpha	Homo sapiens	185-195
25773848-5	2015	Moreover, chloroquine stabilized the protein level of prolyl hydroxylase domain proteins (PHD-2) but reduced the levels of hypoxic responsive proteins such as hypoxia-inducible factor (HIF-1alpha) and vascular endothelial growth factor (VEGF).	Chloroquine	10-21	vascular endothelial growth factor A	Homo sapiens	201-235
25773848-5	2015	Moreover, chloroquine stabilized the protein level of prolyl hydroxylase domain proteins (PHD-2) but reduced the levels of hypoxic responsive proteins such as hypoxia-inducible factor (HIF-1alpha) and vascular endothelial growth factor (VEGF).	Chloroquine	10-21	vascular endothelial growth factor A	Homo sapiens	237-241
25773848-7	2015	In conclusion, chloroquine can inhibit hypoxia-stimulated metastasis via HIF-1alpha/VEGF/EMT which may serve as a useful additional strategy for CCA therapy.	Chloroquine	15-26	hypoxia inducible factor 1 subunit alpha	Homo sapiens	73-83
25773848-7	2015	In conclusion, chloroquine can inhibit hypoxia-stimulated metastasis via HIF-1alpha/VEGF/EMT which may serve as a useful additional strategy for CCA therapy.	Chloroquine	15-26	vascular endothelial growth factor A	Homo sapiens	84-88
25484071-5	2015	These data add novel mechanistic insights into the regulation of noncanonical LC3 lipidation and its associated processes, including LC3-associated phagocytosis (LAP), and demonstrate that the widely and therapeutically used drug chloroquine, which is conventionally used to inhibit autophagy flux, is an inducer of LC3 lipidation.	Chloroquine	230-241	microtubule associated protein 1 light chain 3 alpha	Homo sapiens	78-81
25484071-5	2015	These data add novel mechanistic insights into the regulation of noncanonical LC3 lipidation and its associated processes, including LC3-associated phagocytosis (LAP), and demonstrate that the widely and therapeutically used drug chloroquine, which is conventionally used to inhibit autophagy flux, is an inducer of LC3 lipidation.	Chloroquine	230-241	microtubule associated protein 1 light chain 3 alpha	Homo sapiens	133-136
25484071-5	2015	These data add novel mechanistic insights into the regulation of noncanonical LC3 lipidation and its associated processes, including LC3-associated phagocytosis (LAP), and demonstrate that the widely and therapeutically used drug chloroquine, which is conventionally used to inhibit autophagy flux, is an inducer of LC3 lipidation.	Chloroquine	230-241	microtubule associated protein 1 light chain 3 alpha	Homo sapiens	133-136
25789785-4	2015	We showed that elevated Notch signaling in lgl(-) tissue can be rescued by feeding larvae the vesicle de-acidifying drug chloroquine, revealing that Lgl attenuates Notch signaling by limiting vesicle acidification.	Chloroquine	121-132	lethal (2) giant larvae	Drosophila melanogaster	43-46
25789785-4	2015	We showed that elevated Notch signaling in lgl(-) tissue can be rescued by feeding larvae the vesicle de-acidifying drug chloroquine, revealing that Lgl attenuates Notch signaling by limiting vesicle acidification.	Chloroquine	121-132	lethal (2) giant larvae	Drosophila melanogaster	149-152
25789785-5	2015	Strikingly, chloroquine also rescued the lgl(-) overgrowth phenotype, suggesting that the Hippo pathway defects were also rescued.	Chloroquine	12-23	lethal (2) giant larvae	Drosophila melanogaster	41-44
25925287-5	2015	RESULTS: In murine CD4(+) thymocytes, chloroquine decreased the TG-triggered intracellular Ca(2+) increase in a dose-dependent manner.	Chloroquine	38-49	CD4 antigen	Mus musculus	19-22
25721868-12	2015	Moreover, depletion of Beclin 1 abolished the synergistic effect of ATO and CQ by reducing autophagy and apoptosis.	Chloroquine	76-78	beclin 1	Homo sapiens	23-31
25925287-0	2015	Chloroquine Inhibits Ca(2+) Signaling in Murine CD4(+) Thymocytes.	Chloroquine	0-11	CD4 antigen	Mus musculus	48-51
25925287-4	2015	Pyrazole-3 (Pyr3), thapsigargin (TG), and caffeine were used to assess the effects of chloroquine on the intracellular Ca(2+) content of CD4(+) T cells.	Chloroquine	86-97	CD4 antigen	Mus musculus	137-140
25925287-8	2015	This elevation was completely blocked by chloroquine and was markedly inhibited by Pyr3, a selective antagonist of transient receptor potential C3 (TRPC3) channel and stromal interaction molecule (STIM)/Orai channel.	Chloroquine	41-52	transient receptor potential cation channel, subfamily C, member 3	Mus musculus	115-146
25925287-8	2015	This elevation was completely blocked by chloroquine and was markedly inhibited by Pyr3, a selective antagonist of transient receptor potential C3 (TRPC3) channel and stromal interaction molecule (STIM)/Orai channel.	Chloroquine	41-52	transient receptor potential cation channel, subfamily C, member 3	Mus musculus	148-153
25925287-12	2015	CONCLUSION: These data indicate that chloroquine inhibits the elevation of intracellular Ca(2+) in thymic CD4(+) T cells by inhibiting IP3 receptor-mediated Ca(2+) release from intracellular stores and TRPC3 channel-mediated and/or STIM/Orai channel-mediated Ca(2+) influx.	Chloroquine	37-48	CD4 antigen	Mus musculus	106-109
25925287-12	2015	CONCLUSION: These data indicate that chloroquine inhibits the elevation of intracellular Ca(2+) in thymic CD4(+) T cells by inhibiting IP3 receptor-mediated Ca(2+) release from intracellular stores and TRPC3 channel-mediated and/or STIM/Orai channel-mediated Ca(2+) influx.	Chloroquine	37-48	inositol 1,4,5-triphosphate receptor 3	Mus musculus	135-147
25925287-12	2015	CONCLUSION: These data indicate that chloroquine inhibits the elevation of intracellular Ca(2+) in thymic CD4(+) T cells by inhibiting IP3 receptor-mediated Ca(2+) release from intracellular stores and TRPC3 channel-mediated and/or STIM/Orai channel-mediated Ca(2+) influx.	Chloroquine	37-48	transient receptor potential cation channel, subfamily C, member 3	Mus musculus	202-207
25472474-7	2014	TNF-alpha expression induced by BAG was reduced by either pretreatment with TLR9 inhibitors (ODN2088 and chloroquine (CQ)) or transfection with TLR9 siRNA.	Chloroquine	105-116	tumor necrosis factor	Mus musculus	0-9
25339175-7	2014	We confirm the involvement of TLR3 in this process using chloroquine (IC50 11.9 mum) and a dominant negative TLR3 construct (pZERO-hTLR3).	Chloroquine	57-68	toll-like receptor 3	Mus musculus	30-34
24889179-0	2015	Assessment of chloroquine as a modulator of immune activation to improve CD4 recovery in immune nonresponding HIV-infected patients receiving antiretroviral therapy.	Chloroquine	14-25	CD4 molecule	Homo sapiens	73-76
24889179-2	2015	The effect of CQ on CD4 T-cell recovery and immune activation in immune nonresponding patients receiving successful ART was therefore studied.	Chloroquine	14-16	CD4 molecule	Homo sapiens	20-23
24889179-7	2015	Among nine cytokines/chemokines measured, only levels of interferon (IFN)-alpha2 were significantly increased by CQ treatment.	Chloroquine	113-115	interferon alpha 2	Homo sapiens	57-80
25613602-6	2015	Chloroquine combined with low-dose dexamethasone significantly lessened inflammations around the bronchioles (P&lt;0.05) and blood vessels (P&lt;0.01) in the lung tissue, and obviously lowered IL-6 (P&lt;0.05) and PGF2alpha (P&lt;0.001) in the BALF in the asthmatic mice.	Chloroquine	0-11	interleukin 6	Mus musculus	193-197
25385822-0	2014	Chloroquine promotes IL-17 production by CD4+ T cells via p38-dependent IL-23 release by monocyte-derived Langerhans-like cells.	Chloroquine	0-11	interleukin 17A	Homo sapiens	21-26
25385822-0	2014	Chloroquine promotes IL-17 production by CD4+ T cells via p38-dependent IL-23 release by monocyte-derived Langerhans-like cells.	Chloroquine	0-11	mitogen-activated protein kinase 14	Homo sapiens	58-61
25385822-0	2014	Chloroquine promotes IL-17 production by CD4+ T cells via p38-dependent IL-23 release by monocyte-derived Langerhans-like cells.	Chloroquine	0-11	interleukin 23 subunit alpha	Homo sapiens	72-77
25385822-3	2014	In this study, we investigated the effect of CHQ on human monocyte-derived Langerhans-like cells (MoLC) and dendritic cells (MoDC) in response to IL-1beta.	Chloroquine	45-48	interleukin 1 beta	Homo sapiens	146-154
25385822-5	2014	Importantly, CHQ-treated MoLC promoted IL-17A secretion by CD4(+) T cells and elevated RORC mRNA levels, whereas IFN-gamma release was reduced.	Chloroquine	13-16	interleukin 17A	Homo sapiens	39-45
25472474-7	2014	TNF-alpha expression induced by BAG was reduced by either pretreatment with TLR9 inhibitors (ODN2088 and chloroquine (CQ)) or transfection with TLR9 siRNA.	Chloroquine	118-120	tumor necrosis factor	Mus musculus	0-9
25308836-7	2014	Inhibition of autophagy by CQ pre-treatment led to accumulation of acidic vacuoles (AVOs) which acquainted with unprocessed damage mitochondria that subsequently promoted ROS generation, and resulted releases of Cyt C in cytosol that caused caspase-3 dependent apoptosis cell death in ART-treated A549 cells.	Chloroquine	27-29	caspase 3	Homo sapiens	241-250
25434381-6	2014	RESULTS: Knockdown of the autophagy-associated proteins (GRP78 and Beclin) or treatment with the autophagy inhibitor, 3-methyl adenine (3-MA), blocked autophagosome formation and reduced CQ cytotoxicity, suggesting that autophagosome accumulation precedes CQ-induced cell death.	Chloroquine	187-189	heat shock protein 5	Mus musculus	57-62
25949192-6	2014	Cotreatment of CQ with antitumor agent NVP-BEZ235, a dual inhibitor of PI3K/mTOR, rescued the cell viability at low concentrations meaning that CQ acted as an autophagy inhibitor, but CQ induced the lethal effect at high concentrations.	Chloroquine	15-17	mechanistic target of rapamycin kinase	Homo sapiens	76-80
25949192-8	2014	High doses of CQ produced cellular reactive oxygen species (ROS) and cotreatment of antioxidants, such as NAC and trolox, with high doses of CQ rescued the cell viability.	Chloroquine	141-143	X-linked Kx blood group	Homo sapiens	106-109
24477737-7	2014	The decrease in the TDP-43 level after cycloheximide treatment was partially recovered upon co-treatment with the proteasome inhibitor, epoxomicin, but not the lysosomotropic agent, chloroquine, suggesting involvement of the proteasomal pathway in TDP-43 degradation.	Chloroquine	182-193	TAR DNA binding protein	Homo sapiens	20-26
25015090-6	2014	To reveal the role of autophagy, the autophagy-blocker, chloroquine (CQ), was used in glioma cells downregulating EFTUD1.	Chloroquine	56-67	elongation factor like GTPase 1	Homo sapiens	114-120
25015090-6	2014	To reveal the role of autophagy, the autophagy-blocker, chloroquine (CQ), was used in glioma cells downregulating EFTUD1.	Chloroquine	69-71	elongation factor like GTPase 1	Homo sapiens	114-120
25434381-6	2014	RESULTS: Knockdown of the autophagy-associated proteins (GRP78 and Beclin) or treatment with the autophagy inhibitor, 3-methyl adenine (3-MA), blocked autophagosome formation and reduced CQ cytotoxicity, suggesting that autophagosome accumulation precedes CQ-induced cell death.	Chloroquine	256-258	heat shock protein 5	Mus musculus	57-62
25434381-8	2014	CQ in combination with TMZ significantly increased the amounts of LC3B-II (a marker for autophagosome levels), CHOP/GADD-153, and cleaved PARP (a marker for apoptosis) over those with untreated or individual drug-treated glioma cells.	Chloroquine	0-2	DNA-damage inducible transcript 3	Mus musculus	111-115
25434381-8	2014	CQ in combination with TMZ significantly increased the amounts of LC3B-II (a marker for autophagosome levels), CHOP/GADD-153, and cleaved PARP (a marker for apoptosis) over those with untreated or individual drug-treated glioma cells.	Chloroquine	0-2	DNA-damage inducible transcript 3	Mus musculus	116-124
25333301-10	2014	CQ significantly enhanced GX15-070-induced apoptosis in the cell line models, possibly due to downregulation of Bcl-2, Bcl-xL and Mcl-1 in the cells by the two agents.	Chloroquine	0-2	BCL2 apoptosis regulator	Homo sapiens	112-117
25333301-10	2014	CQ significantly enhanced GX15-070-induced apoptosis in the cell line models, possibly due to downregulation of Bcl-2, Bcl-xL and Mcl-1 in the cells by the two agents.	Chloroquine	0-2	BCL2 like 1	Homo sapiens	119-125
25434381-8	2014	CQ in combination with TMZ significantly increased the amounts of LC3B-II (a marker for autophagosome levels), CHOP/GADD-153, and cleaved PARP (a marker for apoptosis) over those with untreated or individual drug-treated glioma cells.	Chloroquine	0-2	poly (ADP-ribose) polymerase family, member 1	Mus musculus	138-142
25333301-10	2014	CQ significantly enhanced GX15-070-induced apoptosis in the cell line models, possibly due to downregulation of Bcl-2, Bcl-xL and Mcl-1 in the cells by the two agents.	Chloroquine	0-2	MCL1 apoptosis regulator, BCL2 family member	Homo sapiens	130-135
25434381-10	2014	Subcutaneously implanted U87MG tumors from mice treated with CQ in combination with TMZ displayed higher levels of CHOP/GADD-153 than did untreated or individual drug-treated tumors.	Chloroquine	61-63	DNA-damage inducible transcript 3	Mus musculus	115-119
25434381-10	2014	Subcutaneously implanted U87MG tumors from mice treated with CQ in combination with TMZ displayed higher levels of CHOP/GADD-153 than did untreated or individual drug-treated tumors.	Chloroquine	61-63	DNA-damage inducible transcript 3	Mus musculus	120-128
25194467-6	2014	RESULTS: A positive association was found between ACE and the CQ total score.	Chloroquine	62-64	angiotensin I converting enzyme	Homo sapiens	50-53
25122701-7	2014	Of 26 chloroquine-sensitive units tested, most responded to SLIGRL, half responded to histamine and/or BAM8-22, and most responded to capsaicin and/or AITC as well as noxious thermal and mechanical stimuli.	Chloroquine	6-17	myeloid/lymphoid or mixed-lineage leukemia; translocated to, 1	Mus musculus	103-110
24946279-9	2014	Moreover, autophagy suppression by chloroquine and brefeldin A caused ER stress in PMH from ASMase(+/+) mice but not in ASMase(-/-) mice.	Chloroquine	35-46	sphingomyelin phosphodiesterase 1, acid lysosomal	Mus musculus	92-98
24789918-6	2014	Gpnmb was potently induced by lysosomal stress inducers, including palmitate and chloroquine, or Torin1, an inhibitor of mammalian target of rapamycin complex 1 (mTORC1).	Chloroquine	81-92	glycoprotein nmb	Homo sapiens	0-5
25157434-0	2014	The antimalarial drugs chloroquine and primaquine inhibit pyridoxal kinase, an essential enzyme for vitamin B6 production.	Chloroquine	23-34	pyridoxal kinase	Homo sapiens	58-74
25157434-6	2014	Thus, we have identified pyridoxal kinase as a possible target molecule of the antimalarial drugs chloroquine and primaquine.	Chloroquine	98-109	pyridoxal kinase	Homo sapiens	25-41
25208888-7	2014	In Bim(low) cells, autophagy disruption by chloroquine (CQ) was required for HDACI/ABT-737 to induce Bim expression and lethality.	Chloroquine	43-54	BCL2-like 11 (apoptosis facilitator)	Mus musculus	3-6
25208888-7	2014	In Bim(low) cells, autophagy disruption by chloroquine (CQ) was required for HDACI/ABT-737 to induce Bim expression and lethality.	Chloroquine	43-54	BCL2-like 11 (apoptosis facilitator)	Mus musculus	101-104
25208888-7	2014	In Bim(low) cells, autophagy disruption by chloroquine (CQ) was required for HDACI/ABT-737 to induce Bim expression and lethality.	Chloroquine	56-58	BCL2-like 11 (apoptosis facilitator)	Mus musculus	3-6
25208888-7	2014	In Bim(low) cells, autophagy disruption by chloroquine (CQ) was required for HDACI/ABT-737 to induce Bim expression and lethality.	Chloroquine	56-58	BCL2-like 11 (apoptosis facilitator)	Mus musculus	101-104
25036266-7	2014	Chloroquine, denatonium, dextromethorphan, noscapine and quinine, agonists for TAS2R3, TAS2R4, TAS2R10 and TAS2R14, induced strong endothelium-independent relaxations (responses between 82-96% of maximal relaxations) in phenylephrine pre-contracted guinea-pig aorta that persisted in the presence of L-type Ca2+ and KCa1.1-channel blockers.	Chloroquine	0-11	taste 2 receptor member 3	Homo sapiens	79-85
25036266-7	2014	Chloroquine, denatonium, dextromethorphan, noscapine and quinine, agonists for TAS2R3, TAS2R4, TAS2R10 and TAS2R14, induced strong endothelium-independent relaxations (responses between 82-96% of maximal relaxations) in phenylephrine pre-contracted guinea-pig aorta that persisted in the presence of L-type Ca2+ and KCa1.1-channel blockers.	Chloroquine	0-11	taste 2 receptor member 4	Homo sapiens	87-93
25036266-7	2014	Chloroquine, denatonium, dextromethorphan, noscapine and quinine, agonists for TAS2R3, TAS2R4, TAS2R10 and TAS2R14, induced strong endothelium-independent relaxations (responses between 82-96% of maximal relaxations) in phenylephrine pre-contracted guinea-pig aorta that persisted in the presence of L-type Ca2+ and KCa1.1-channel blockers.	Chloroquine	0-11	taste 2 receptor member 10	Homo sapiens	95-102
25036266-7	2014	Chloroquine, denatonium, dextromethorphan, noscapine and quinine, agonists for TAS2R3, TAS2R4, TAS2R10 and TAS2R14, induced strong endothelium-independent relaxations (responses between 82-96% of maximal relaxations) in phenylephrine pre-contracted guinea-pig aorta that persisted in the presence of L-type Ca2+ and KCa1.1-channel blockers.	Chloroquine	0-11	taste 2 receptor member 14	Homo sapiens	107-114
25036266-11	2014	Chloroquine and noscapine mediated relaxations of human pulmonary arteries that expressed also mRNA for TAS2R3, TAS2R4, TAS2R10 and TAS2R14, at levels similar to that of the alpha1A adrenoceptor.	Chloroquine	0-11	taste 2 receptor member 3	Homo sapiens	104-110
25036266-11	2014	Chloroquine and noscapine mediated relaxations of human pulmonary arteries that expressed also mRNA for TAS2R3, TAS2R4, TAS2R10 and TAS2R14, at levels similar to that of the alpha1A adrenoceptor.	Chloroquine	0-11	taste 2 receptor member 4	Homo sapiens	112-118
25036266-11	2014	Chloroquine and noscapine mediated relaxations of human pulmonary arteries that expressed also mRNA for TAS2R3, TAS2R4, TAS2R10 and TAS2R14, at levels similar to that of the alpha1A adrenoceptor.	Chloroquine	0-11	taste 2 receptor member 10	Homo sapiens	120-127
25036266-11	2014	Chloroquine and noscapine mediated relaxations of human pulmonary arteries that expressed also mRNA for TAS2R3, TAS2R4, TAS2R10 and TAS2R14, at levels similar to that of the alpha1A adrenoceptor.	Chloroquine	0-11	taste 2 receptor member 14	Homo sapiens	132-139
25128814-4	2014	Use of the autophagy inhibitors chloroquine and bafilomycin A1, or RNA interference of ATG7, suggested that these increases in LC3B and SQSTM1 levels were in part attributed to altered autophagic flux.	Chloroquine	32-43	microtubule associated protein 1 light chain 3 beta	Homo sapiens	127-131
25128814-4	2014	Use of the autophagy inhibitors chloroquine and bafilomycin A1, or RNA interference of ATG7, suggested that these increases in LC3B and SQSTM1 levels were in part attributed to altered autophagic flux.	Chloroquine	32-43	sequestosome 1	Homo sapiens	136-142
25115400-6	2014	Notably inhibition of autophagy by si-ATG5, 3-methyladenine and chloroquine, but not si-Beclin-1, significantly reverses nutrient deprivation-induced HIF-1alpha responses.	Chloroquine	64-75	hypoxia inducible factor 1 subunit alpha	Homo sapiens	150-160
25286360-9	2014	These beneficial effects of zacopride were partially abolished by the IK1 channel blocker chloroquine.	Chloroquine	90-101	potassium calcium-activated channel subfamily N member 4	Rattus norvegicus	70-73
25187658-3	2014	Using high-throughput screening, we identified certain statins and antimalarial agents including chloroquine, hydroxychloroquine, and quinacrine as strong ERK5 activators.	Chloroquine	97-108	mitogen-activated protein kinase 7	Mus musculus	155-159
25187658-5	2014	Chloroquine and hydroxychloroquine upregulated ERK5 kinase activity and inhibited VCAM-1 expression in an ERK5-dependent but MAPK/ERK kinase 5- and Kruppel-like factor 2/4-independent manner.	Chloroquine	0-11	mitogen-activated protein kinase 7	Mus musculus	47-51
25187658-5	2014	Chloroquine and hydroxychloroquine upregulated ERK5 kinase activity and inhibited VCAM-1 expression in an ERK5-dependent but MAPK/ERK kinase 5- and Kruppel-like factor 2/4-independent manner.	Chloroquine	0-11	vascular cell adhesion molecule 1	Mus musculus	82-88
25187658-5	2014	Chloroquine and hydroxychloroquine upregulated ERK5 kinase activity and inhibited VCAM-1 expression in an ERK5-dependent but MAPK/ERK kinase 5- and Kruppel-like factor 2/4-independent manner.	Chloroquine	0-11	mitogen-activated protein kinase 7	Mus musculus	106-110
25268357-8	2014	Chloroquine, a late stage inhibitor of autophagy which promoted cytoplasmic vacuolization, led to significantly enhanced apoptosis and cytotoxicity when combined with EF25-(GSH)2.	Chloroquine	0-11	GS homeobox 2	Homo sapiens	167-178
25268357-9	2014	Taken together, these data imply a fail-safe mechanism regulated by autophagy in the action of EF25-(GSH)2, suggesting the therapeutic potential of the novel curcumin analog against hepatocellular carcinoma (HCC), while offering a novel and effective combination strategy with chloroquine for the treatment of patients with HCC.	Chloroquine	277-288	GS homeobox 2	Homo sapiens	95-106
24880125-4	2014	Pharmacological inhibitors of lysosomal degradation, such as chloroquine, increased AF1Q levels, whereas activators of CMA, including 6-aminonicotinamide and nutrient starvation, decreased AF1Q levels.	Chloroquine	61-72	MLLT11 transcription factor 7 cofactor	Homo sapiens	84-88
25209280-6	2014	These results suggest that NMBR and GRPR could compensate for the loss of each other to maintain normal histamine-evoked itch, whereas GRPR is exclusively required for CQ-evoked scratching behavior.	Chloroquine	168-170	gastrin releasing peptide receptor	Mus musculus	135-139
25022582-0	2014	Signaling of chloroquine-induced stress in the yeast Saccharomyces cerevisiae requires the Hog1 and Slt2 mitogen-activated protein kinase pathways.	Chloroquine	13-24	mitogen-activated protein kinase HOG1	Saccharomyces cerevisiae S288C	91-95
25022582-0	2014	Signaling of chloroquine-induced stress in the yeast Saccharomyces cerevisiae requires the Hog1 and Slt2 mitogen-activated protein kinase pathways.	Chloroquine	13-24	mitogen-activated serine/threonine-protein kinase SLT2	Saccharomyces cerevisiae S288C	100-104
25022582-4	2014	Here, we also describe the novel role of mitogen-activated protein kinases Hog1 and Slt2, which aid in survival in the presence of CQ.	Chloroquine	131-133	mitogen-activated protein kinase HOG1	Saccharomyces cerevisiae S288C	75-79
25022582-4	2014	Here, we also describe the novel role of mitogen-activated protein kinases Hog1 and Slt2, which aid in survival in the presence of CQ.	Chloroquine	131-133	mitogen-activated serine/threonine-protein kinase SLT2	Saccharomyces cerevisiae S288C	84-88
25022582-5	2014	Cells deficient in Hog1 or Slt2 are found to be CQ hypersensitive, and both proteins were phosphorylated in response to CQ exposure.	Chloroquine	48-50	mitogen-activated protein kinase HOG1	Saccharomyces cerevisiae S288C	19-23
25022582-5	2014	Cells deficient in Hog1 or Slt2 are found to be CQ hypersensitive, and both proteins were phosphorylated in response to CQ exposure.	Chloroquine	48-50	mitogen-activated serine/threonine-protein kinase SLT2	Saccharomyces cerevisiae S288C	27-31
25022582-5	2014	Cells deficient in Hog1 or Slt2 are found to be CQ hypersensitive, and both proteins were phosphorylated in response to CQ exposure.	Chloroquine	120-122	mitogen-activated protein kinase HOG1	Saccharomyces cerevisiae S288C	19-23
25022582-5	2014	Cells deficient in Hog1 or Slt2 are found to be CQ hypersensitive, and both proteins were phosphorylated in response to CQ exposure.	Chloroquine	120-122	mitogen-activated serine/threonine-protein kinase SLT2	Saccharomyces cerevisiae S288C	27-31
25022582-8	2014	The deletion of SOD1, the superoxide dismutase in yeast, resulted in hypersensitivity to CQ.	Chloroquine	89-91	superoxide dismutase SOD1	Saccharomyces cerevisiae S288C	16-20
24865278-4	2014	Importantly, accumulation of LC3B-II protein occurred in CQ (chloroquine)-treated cells throughout differentiation.	Chloroquine	57-59	microtubule-associated protein 1 light chain 3 beta	Mus musculus	29-33
25060788-9	2014	Lysosomal stress induced by chloroquine or atherogenic lipids leads to TFEB nuclear translocation and activation of lysosomal and autophagy genes.	Chloroquine	28-39	transcription factor EB	Mus musculus	71-75
24865278-4	2014	Importantly, accumulation of LC3B-II protein occurred in CQ (chloroquine)-treated cells throughout differentiation.	Chloroquine	61-72	microtubule-associated protein 1 light chain 3 beta	Mus musculus	29-33
25152362-5	2014	Compensatory responses to restore lysosomal pH are observed; new data illustrate that chronic chloroquine treatment increases mRNA expression of the lysosomal/autophagy master transcription factor TcFEB and of the vesicular proton pump vHATPase in the RPE/choroid of mice.	Chloroquine	94-105	transcription factor EB	Mus musculus	197-202
24809620-0	2014	Chloroquine eliminates cancer stem cells through deregulation of Jak2 and DNMT1.	Chloroquine	0-11	Janus kinase 2	Homo sapiens	65-69
25150934-12	2014	Additionally, the utility of MDCK-MDR1 permeability measurements was demonstrated in probing the role of P-glycoprotein transport in Primaquine-Chloroquine drug-drug interactions in comparison with in vivo pharmacokinetic changes.	Chloroquine	144-155	ATP binding cassette subfamily B member 1	Homo sapiens	29-38
24809620-0	2014	Chloroquine eliminates cancer stem cells through deregulation of Jak2 and DNMT1.	Chloroquine	0-11	DNA methyltransferase 1	Homo sapiens	74-79
24809620-3	2014	CQ was identified as a potential CSC inhibitor through in silico gene expression signature analysis of the CD44(+) /CD24(-/low) CSC population.	Chloroquine	0-2	CD44 molecule (Indian blood group)	Homo sapiens	107-111
24809620-3	2014	CQ was identified as a potential CSC inhibitor through in silico gene expression signature analysis of the CD44(+) /CD24(-/low) CSC population.	Chloroquine	0-2	CD24 molecule	Homo sapiens	116-120
24809620-6	2014	Herein, we report that CQ sensitizes TNBC cells to paclitaxel through inhibition of autophagy and reduces the CD44(+) /CD24(-/low) CSC population in both preclinical and clinical settings.	Chloroquine	23-25	CD44 molecule (Indian blood group)	Homo sapiens	110-114
24809620-6	2014	Herein, we report that CQ sensitizes TNBC cells to paclitaxel through inhibition of autophagy and reduces the CD44(+) /CD24(-/low) CSC population in both preclinical and clinical settings.	Chloroquine	23-25	CD24 molecule	Homo sapiens	119-123
24809620-7	2014	Also, we are the first to report a mechanism by which CQ regulates the CSCs in TNBC through inhibition of the Janus-activated kinase 2 (Jak2)-signal transducer and activator of transcription 3 signaling pathway by reducing the expression of Jak2 and DNA methyltransferase 1.	Chloroquine	54-56	Janus kinase 2	Homo sapiens	110-134
24809620-7	2014	Also, we are the first to report a mechanism by which CQ regulates the CSCs in TNBC through inhibition of the Janus-activated kinase 2 (Jak2)-signal transducer and activator of transcription 3 signaling pathway by reducing the expression of Jak2 and DNA methyltransferase 1.	Chloroquine	54-56	Janus kinase 2	Homo sapiens	136-140
24809620-7	2014	Also, we are the first to report a mechanism by which CQ regulates the CSCs in TNBC through inhibition of the Janus-activated kinase 2 (Jak2)-signal transducer and activator of transcription 3 signaling pathway by reducing the expression of Jak2 and DNA methyltransferase 1.	Chloroquine	54-56	Janus kinase 2	Homo sapiens	241-245
24809620-7	2014	Also, we are the first to report a mechanism by which CQ regulates the CSCs in TNBC through inhibition of the Janus-activated kinase 2 (Jak2)-signal transducer and activator of transcription 3 signaling pathway by reducing the expression of Jak2 and DNA methyltransferase 1.	Chloroquine	54-56	DNA methyltransferase 1	Homo sapiens	250-273
25026290-4	2014	Furthermore, miR-100 overexpression caused massive cell death, which was abrogated by both the Atg7 silencing and chloroquine treatment.	Chloroquine	114-125	microRNA 100	Homo sapiens	13-20
24946858-0	2014	Combining AKT inhibition with chloroquine and gefitinib prevents compensatory autophagy and induces cell death in EGFR mutated NSCLC cells.	Chloroquine	30-41	epidermal growth factor receptor	Homo sapiens	114-118
24793486-9	2014	Blocking autophagy using chloroquine magnified CCT128930-induced apoptotic cell death and the phosphorylation of H2AX.	Chloroquine	25-36	H2A.X variant histone	Homo sapiens	113-117
25089120-8	2014	TLR inhibitors (OxPAPC, CI-095 and chloroquine) blocked IL-8 secretion in Poly(I:C), LPS or MALP-2-treated IPE and RPE.	Chloroquine	35-46	C-X-C motif chemokine ligand 8	Homo sapiens	56-60
24927684-1	2014	An amphiphilic carboxymethyl chitosan-quercetin (CQ) conjugate was designed and synthesized for oral delivery of paclitaxel (PTX) to improve its oral bioavailability by increasing its water solubility and bypassing the P-gp drug efflux pumps.	Chloroquine	49-51	phosphoglycolate phosphatase	Homo sapiens	219-223
24859061-4	2014	Effect of chloroquine on TLR9 signaling is well reported, while there are limited studies on non-endosomal TLRs as well as T cell responses.	Chloroquine	10-21	toll-like receptor 9	Mus musculus	25-29
24859061-6	2014	Chloroquine significantly suppressed the TLR2 as well as TLR9 signaling in both in vitro as well as in vivo experimental settings, while it had no effect on TLR4 pathway.	Chloroquine	0-11	toll-like receptor 2	Mus musculus	41-45
24859061-6	2014	Chloroquine significantly suppressed the TLR2 as well as TLR9 signaling in both in vitro as well as in vivo experimental settings, while it had no effect on TLR4 pathway.	Chloroquine	0-11	toll-like receptor 9	Mus musculus	57-61
25197362-6	2014	Transforming growth factor-beta1 (TGF-beta1), known as an inducer of epithelial-mesenchymal transition (EMT), increased the invasive activity of both cells, and chloroquine also significantly reduced TGF-beta1-induced cell invasion.	Chloroquine	161-172	transforming growth factor beta 1	Homo sapiens	200-209
24946858-4	2014	Consequently, inhibiting autophagy with chloroquine significantly enhanced tumor cell death induced by gefitinib and AKT inhibitors in EGFR M+ cells in vitro, and produced greater tumor shrinkage in EGFR M+ xenografts in vivo.	Chloroquine	40-51	AKT serine/threonine kinase 1	Homo sapiens	117-120
24946858-4	2014	Consequently, inhibiting autophagy with chloroquine significantly enhanced tumor cell death induced by gefitinib and AKT inhibitors in EGFR M+ cells in vitro, and produced greater tumor shrinkage in EGFR M+ xenografts in vivo.	Chloroquine	40-51	epidermal growth factor receptor	Homo sapiens	135-139
24946858-4	2014	Consequently, inhibiting autophagy with chloroquine significantly enhanced tumor cell death induced by gefitinib and AKT inhibitors in EGFR M+ cells in vitro, and produced greater tumor shrinkage in EGFR M+ xenografts in vivo.	Chloroquine	40-51	epidermal growth factor receptor	Homo sapiens	199-203
24946858-5	2014	Together, our findings suggest that adding chloroquine to EGFR and AKT inhibition has the potential to improve tumor responses in EGFR M+ NSCLC, and that selective targeting of AKT2 may provide a new treatment option in NSCLC.	Chloroquine	43-54	epidermal growth factor receptor	Homo sapiens	130-134
24804820-8	2014	Furthermore, as shown by our results, the inhibition of gemcitabine-induced autophagy by chloroquine shifts the expression of the p53 protein, Bcl-2 family proteins and the relative Bax/Bcl-xL ratio in favor of promoting apoptosis.	Chloroquine	89-100	tumor protein p53	Homo sapiens	130-133
24799628-7	2014	3-Methyladenine and chloroquine, inhibitors of autophagy, decreased the induction of inflammatory responses in TLR2 KO macrophages.	Chloroquine	20-31	toll-like receptor 2	Mus musculus	111-115
24804820-8	2014	Furthermore, as shown by our results, the inhibition of gemcitabine-induced autophagy by chloroquine shifts the expression of the p53 protein, Bcl-2 family proteins and the relative Bax/Bcl-xL ratio in favor of promoting apoptosis.	Chloroquine	89-100	BCL2 apoptosis regulator	Homo sapiens	143-148
24804820-8	2014	Furthermore, as shown by our results, the inhibition of gemcitabine-induced autophagy by chloroquine shifts the expression of the p53 protein, Bcl-2 family proteins and the relative Bax/Bcl-xL ratio in favor of promoting apoptosis.	Chloroquine	89-100	BCL2 associated X, apoptosis regulator	Homo sapiens	182-185
24804820-8	2014	Furthermore, as shown by our results, the inhibition of gemcitabine-induced autophagy by chloroquine shifts the expression of the p53 protein, Bcl-2 family proteins and the relative Bax/Bcl-xL ratio in favor of promoting apoptosis.	Chloroquine	89-100	BCL2 like 1	Homo sapiens	186-192
24725889-7	2014	Further treatment with TLR9 ligand CpG-ODN, TLR9 inhibitor chloroquine (CQ) or ERK1/2 inhibitor U0126 demonstrated that TLR9-ERK1/2 pathway was involved in the NSCs-induced microglial activation.	Chloroquine	59-70	toll-like receptor 9	Mus musculus	44-48
24725889-7	2014	Further treatment with TLR9 ligand CpG-ODN, TLR9 inhibitor chloroquine (CQ) or ERK1/2 inhibitor U0126 demonstrated that TLR9-ERK1/2 pathway was involved in the NSCs-induced microglial activation.	Chloroquine	59-70	toll-like receptor 9	Mus musculus	44-48
24725889-7	2014	Further treatment with TLR9 ligand CpG-ODN, TLR9 inhibitor chloroquine (CQ) or ERK1/2 inhibitor U0126 demonstrated that TLR9-ERK1/2 pathway was involved in the NSCs-induced microglial activation.	Chloroquine	59-70	mitogen-activated protein kinase 3	Mus musculus	125-131
24725889-7	2014	Further treatment with TLR9 ligand CpG-ODN, TLR9 inhibitor chloroquine (CQ) or ERK1/2 inhibitor U0126 demonstrated that TLR9-ERK1/2 pathway was involved in the NSCs-induced microglial activation.	Chloroquine	72-74	toll-like receptor 9	Mus musculus	44-48
24725889-7	2014	Further treatment with TLR9 ligand CpG-ODN, TLR9 inhibitor chloroquine (CQ) or ERK1/2 inhibitor U0126 demonstrated that TLR9-ERK1/2 pathway was involved in the NSCs-induced microglial activation.	Chloroquine	72-74	toll-like receptor 9	Mus musculus	44-48
24725889-7	2014	Further treatment with TLR9 ligand CpG-ODN, TLR9 inhibitor chloroquine (CQ) or ERK1/2 inhibitor U0126 demonstrated that TLR9-ERK1/2 pathway was involved in the NSCs-induced microglial activation.	Chloroquine	72-74	mitogen-activated protein kinase 3	Mus musculus	125-131
24647486-9	2014	CpG ODN significantly enhanced the invasion of TE10 cells, which could be abrogated by a TLR9 inhibitor CQ.	Chloroquine	104-106	toll like receptor 9	Homo sapiens	89-93
24487305-7	2014	Blocking studies with mAbs to HLA-DR (but not HLA-A, -B, -C) or chloroquine significantly reduced this nickel-specific IL-9 production.	Chloroquine	64-75	interleukin 9	Homo sapiens	119-123
24785256-9	2014	The coaddition of ERbeta agonist and the autophagy inhibitor chloroquine resulted in a significant accumulation of sub-G1 DNA which was completely prevented by the addition of the caspase inhibitor Z-VAD-FMK.	Chloroquine	61-72	estrogen receptor 2	Homo sapiens	18-24
24785258-0	2014	Chloroquine targets pancreatic cancer stem cells via inhibition of CXCR4 and hedgehog signaling.	Chloroquine	0-11	C-X-C motif chemokine receptor 4	Homo sapiens	67-72
24785258-6	2014	The inhibitory effect of chloroquine was not related to inhibition of autophagy, but was due to inhibition of CXCL12/CXCR4 signaling, resulting in reduced phosphorylation of ERK and STAT3.	Chloroquine	25-36	C-X-C motif chemokine ligand 12	Homo sapiens	110-116
24785258-6	2014	The inhibitory effect of chloroquine was not related to inhibition of autophagy, but was due to inhibition of CXCL12/CXCR4 signaling, resulting in reduced phosphorylation of ERK and STAT3.	Chloroquine	25-36	C-X-C motif chemokine receptor 4	Homo sapiens	117-122
24785258-6	2014	The inhibitory effect of chloroquine was not related to inhibition of autophagy, but was due to inhibition of CXCL12/CXCR4 signaling, resulting in reduced phosphorylation of ERK and STAT3.	Chloroquine	25-36	mitogen-activated protein kinase 1	Homo sapiens	174-177
24785258-6	2014	The inhibitory effect of chloroquine was not related to inhibition of autophagy, but was due to inhibition of CXCL12/CXCR4 signaling, resulting in reduced phosphorylation of ERK and STAT3.	Chloroquine	25-36	signal transducer and activator of transcription 3	Homo sapiens	182-187
24751611-5	2014	We found that chloroquine synergistically augmented sunitinib cytotoxicity on human breast (MCF-7 and T-47D), cervical (Hela), colorectal (Caco-2 and HCT116), hepatocellular (HepG2), laryngeal (HEp-2) and prostate (PC3) cancer cell lines as indicated by combination and concentration reduction indices.	Chloroquine	14-25	proprotein convertase subtilisin/kexin type 1	Homo sapiens	215-218
24751611-7	2014	Sunitinib induced autophagy via upregulating beclin-1 expression which was blocked by chloroquine as evidenced by accumulated SQTSM1/p62 level.	Chloroquine	86-97	beclin 1	Homo sapiens	45-53
24751611-7	2014	Sunitinib induced autophagy via upregulating beclin-1 expression which was blocked by chloroquine as evidenced by accumulated SQTSM1/p62 level.	Chloroquine	86-97	nucleoporin 62	Homo sapiens	133-136
24751611-8	2014	Furthermore, chloroquine augmented sunitinib-induced apoptosis by decreasing survivin level and increasing caspase 3 activity.	Chloroquine	13-24	caspase 3	Homo sapiens	107-116
24751611-9	2014	Chloroquine also enhanced the antiangiogenic capacity of sunitinib as indicated by decreased CD34 expression and peritoneal/skin angiogenesis.	Chloroquine	0-11	CD34 molecule	Homo sapiens	93-97
24924335-14	2014	Cathepsin B activity, measured by FRAP, significantly decreased in HUPECs exposed to albumin (12.5% of activity in controls) and chloroquine (12.8%), and declined further with exposure to albumin plus chloroquine (8.2%, p&lt;0.05).	Chloroquine	129-140	cathepsin B	Mus musculus	0-11
24924335-14	2014	Cathepsin B activity, measured by FRAP, significantly decreased in HUPECs exposed to albumin (12.5% of activity in controls) and chloroquine (12.8%), and declined further with exposure to albumin plus chloroquine (8.2%, p&lt;0.05).	Chloroquine	201-212	cathepsin B	Mus musculus	0-11
24491919-11	2014	3-MA, CQ, and a lysosomal inhibitor, E64c, inhibited cTnI proteolysis and improved contractile dysfunction after MDMA administration.	Chloroquine	6-8	troponin I3, cardiac type	Rattus norvegicus	53-57
24680477-9	2014	On the other hand, the analysis of the antimalarial effect showed that chloroquine was able to inhibit in vitro the expression of TNFalpha and STAT4 enhanced by IFNalpha.	Chloroquine	71-82	tumor necrosis factor	Homo sapiens	130-138
24680477-9	2014	On the other hand, the analysis of the antimalarial effect showed that chloroquine was able to inhibit in vitro the expression of TNFalpha and STAT4 enhanced by IFNalpha.	Chloroquine	71-82	signal transducer and activator of transcription 4	Homo sapiens	143-148
24680477-9	2014	On the other hand, the analysis of the antimalarial effect showed that chloroquine was able to inhibit in vitro the expression of TNFalpha and STAT4 enhanced by IFNalpha.	Chloroquine	71-82	interferon alpha 1	Homo sapiens	161-169
24680477-11	2014	CONCLUSIONS: IFNalpha treatment enhances the induction of TNFalpha and STAT4 in stimulated monocytes, an effect inhibited in vitro by chloroquine treatment.	Chloroquine	134-145	interferon alpha 1	Homo sapiens	13-21
24680477-11	2014	CONCLUSIONS: IFNalpha treatment enhances the induction of TNFalpha and STAT4 in stimulated monocytes, an effect inhibited in vitro by chloroquine treatment.	Chloroquine	134-145	tumor necrosis factor	Homo sapiens	58-66
24680477-11	2014	CONCLUSIONS: IFNalpha treatment enhances the induction of TNFalpha and STAT4 in stimulated monocytes, an effect inhibited in vitro by chloroquine treatment.	Chloroquine	134-145	signal transducer and activator of transcription 4	Homo sapiens	71-76
24440234-9	2014	Autophagy inhibition by wortmannin, 3-methyladenine and chloroquine increased mitochondrial hypopolarization as well as caspase-9 and 3 dependent cell death.	Chloroquine	56-67	caspase 9	Homo sapiens	120-129
24884548-13	2014	Minocycline, chloroquine or simvastatin attenuated upregulation of IL-1beta and iNOS transcripts in different brain regions.	Chloroquine	13-24	interleukin 1 beta	Homo sapiens	67-75
24884548-14	2014	In CSF, minocycline suppressed TNF-alpha and IL-1beta secretion, whereas chloroquine attenuated IL-1beta secretion.	Chloroquine	73-84	interleukin 1 beta	Homo sapiens	96-104
24727941-15	2014	CONCLUSION: The synergistic anticancer effect of LDM and CQ in vitro results from activation of a caspase-dependent and p53-independent apoptosis pathway as well as inhibition of cytoprotective autophagy.	Chloroquine	57-59	tumor protein p53	Homo sapiens	120-123
24785348-5	2014	TfR and VEGFR2 exhibited differences in endosome-to-plasma membrane recycling in the presence of chloroquine.	Chloroquine	97-108	kinase insert domain receptor like	Danio rerio	8-14
24553345-5	2014	In melanoma, DeltaPK infection also induces light chain 3 (LC3)-II accumulation and p62/SQSTM1 clearance, both markers of autophagy, and 3D growth is restored by treatment with the autophagy inhibitor chloroquine (CQ).	Chloroquine	201-212	microtubule associated protein 1 light chain 3 alpha	Homo sapiens	59-62
24736371-7	2014	Moreover, the inhibition of lysosomal function obtained by chloroquine demonstrates that, in addition to 26S proteasome-mediated receptor elimination, lysosome-based degradation also contributes to the E2-dependent ERalpha breakdown.	Chloroquine	59-70	estrogen receptor 1	Homo sapiens	215-222
24229417-9	2014	Conversely, 6-DFQs and CQ had similar inhibitory effects on HIV-induced monocyte activation, consistent with the primary mechanism being associated with IFN-alpha signaling.	Chloroquine	23-25	interferon alpha 1	Homo sapiens	153-162
24251542-3	2014	Chloroquine (CQ) has been used in the treatment or prevention of malaria and has recently been shown to cause a decrease of immune activation and CD4 cell loss in HIV-infected individuals treated with antiretroviral therapy.	Chloroquine	0-11	CD4 molecule	Homo sapiens	146-149
24251542-3	2014	Chloroquine (CQ) has been used in the treatment or prevention of malaria and has recently been shown to cause a decrease of immune activation and CD4 cell loss in HIV-infected individuals treated with antiretroviral therapy.	Chloroquine	13-15	CD4 molecule	Homo sapiens	146-149
24251542-5	2014	Contrary to what was expected, CQ treatment resulted in a temporary increased expression of interferon (IFN)-stimulating genes and it worsened the recovery of CD4(+) T cells in the blood.	Chloroquine	31-33	CD4 molecule	Homo sapiens	159-162
24521562-3	2014	Here, we demonstrate that an anti-malaria drug, chloroquine, decreases the amount of an ER-resident mutant PLP1 containing an alanine-243 to valine (A243V) substitution, which induces severe PMD in human.	Chloroquine	48-59	proteolipid protein 1	Homo sapiens	107-111
24521562-4	2014	By preventing mutant PLP1 translation through enhancing the phosphorylation of eukaryotic initiation factor 2 alpha, chloroquine ameliorated the ER stress induced by the mutant protein in HeLa cells.	Chloroquine	117-128	proteolipid protein 1	Homo sapiens	21-25
24553345-5	2014	In melanoma, DeltaPK infection also induces light chain 3 (LC3)-II accumulation and p62/SQSTM1 clearance, both markers of autophagy, and 3D growth is restored by treatment with the autophagy inhibitor chloroquine (CQ).	Chloroquine	201-212	sequestosome 1	Homo sapiens	84-87
24553345-5	2014	In melanoma, DeltaPK infection also induces light chain 3 (LC3)-II accumulation and p62/SQSTM1 clearance, both markers of autophagy, and 3D growth is restored by treatment with the autophagy inhibitor chloroquine (CQ).	Chloroquine	201-212	sequestosome 1	Homo sapiens	88-94
24658385-7	2014	Endogenous TRPV1 was degraded in starvation conditions; this degradation was blocked by chloroquine (CLQ), 3MA, or downregulation of Atg7.	Chloroquine	88-99	transient receptor potential cation channel subfamily V member 1	Homo sapiens	11-16
24418614-6	2014	PS1-fAD cells had increased LC3B-II/-I ratios and p62 levels, consistent with impaired lysosomal degradation and analogous to changes induced by lysosomal alkalinization with chloroquine.	Chloroquine	175-186	presenilin 1	Homo sapiens	0-3
24391139-1	2014	This phase II study evaluated the effect of chloroquine on the specific CD8(+) T-cell responses to and the safety of a booster dose of investigational human immunodeficiency virus type 1 (HIV-1) F4/AS01(B) vaccine containing 10 mug of recombinant fusion protein (F4) adjuvanted with the AS01(B) adjuvant system.	Chloroquine	44-55	CD8a molecule	Homo sapiens	72-75
24655592-12	2014	Inhibition of autophagic flux using chloroquine prevented clearance of p62 aggregates, leading to caspase-8 activation and cell death in C4-2 cells.	Chloroquine	36-47	sequestosome 1	Homo sapiens	71-74
24655592-12	2014	Inhibition of autophagic flux using chloroquine prevented clearance of p62 aggregates, leading to caspase-8 activation and cell death in C4-2 cells.	Chloroquine	36-47	caspase 8	Homo sapiens	98-107
24658385-7	2014	Endogenous TRPV1 was degraded in starvation conditions; this degradation was blocked by chloroquine (CLQ), 3MA, or downregulation of Atg7.	Chloroquine	101-104	transient receptor potential cation channel subfamily V member 1	Homo sapiens	11-16
24658385-9	2014	Cortisol increased cellular conversion of LC3-I to LC-3II, leading autophagy and resulting in TRPV1 degradation, which was similarly inhibited by treatment with CLQ, 3MA, or downregulation of Atg7.	Chloroquine	161-164	transient receptor potential cation channel subfamily V member 1	Homo sapiens	94-99
24469080-4	2014	As chloroquine analogs it was expected that these compounds might inhibit the heme polymerization and SAR studies were performed aiming to explain their antimalarial profile.	Chloroquine	3-14	sarcosine dehydrogenase	Homo sapiens	102-105
24577912-1	2014	The present study deals with the erythrocytic acetylcholinesterase inhibitory activity of paracetamol and chloroquine in an in vitro protocol using Michaelis Menten parameters (Apparent Michaelis Constant (aKm) and Apparent Maximum Velocity (aVm).	Chloroquine	106-117	acetylcholinesterase (Cartwright blood group)	Homo sapiens	46-66
23847175-4	2014	LC3B showed an increase with CQ treatment although this was different to LysoTracker signals in terms of dose and time.	Chloroquine	29-31	microtubule associated protein 1 light chain 3 beta	Homo sapiens	0-4
24276232-7	2014	In addition, following treatment with the ATM activator, chloroquine, and E(-)/B(48) lipoproteins, ATM interacted with class III phosphatidylinositol-3-kinases (PI3Ks) and the activated ATM protein enhanced class III PI3K activity.	Chloroquine	57-68	ataxia telangiectasia mutated	Mus musculus	99-102
24276232-7	2014	In addition, following treatment with the ATM activator, chloroquine, and E(-)/B(48) lipoproteins, ATM interacted with class III phosphatidylinositol-3-kinases (PI3Ks) and the activated ATM protein enhanced class III PI3K activity.	Chloroquine	57-68	ataxia telangiectasia mutated	Mus musculus	99-102
23847175-6	2014	CQ also induced apoptosis in cell lines, which was blocked by pan-caspase inhibitor z-VAD resulting in a reduction in cells undergoing apoptosis and a subsequent upregulation of autophagic markers LC3B and lysosomal dye signals.	Chloroquine	0-2	microtubule associated protein 1 light chain 3 beta	Homo sapiens	197-201
24368422-0	2014	Chloroquine synergizes with FTS to enhance cell growth inhibition and cell death.	Chloroquine	0-11	AKT interacting protein	Homo sapiens	28-31
24451478-8	2014	We speculated that the induction of autophagy might protect cells from the pro-apoptotic effects of 3PO and found that agents that disrupt autophagy, including chloroquine, increased 3PO-induced apoptosis as measured by double staining with Annexin V and propidium iodide in both HCT-116 cells and Lewis lung carcinoma (LLC) cells.	Chloroquine	160-171	annexin A5	Homo sapiens	241-250
24465696-10	2014	On the other hand, using small interference RNA targeting chloroquine autophagy-related gene Atg5 and beclin1 to inhibit autophagy signal, hepatoma cell death was dramatically enhanced.	Chloroquine	58-69	autophagy related 5	Homo sapiens	93-97
24498157-7	2014	Furosemide (10(-4) M), an inhibitor of Na(+)-K(+)-2Cl(-) co-transporter, also inhibited the increased ISC response to CQ, whereas another Cl(-) channel inhibitor, CFTR(inh)-172(10(-5) M), had no effect.	Chloroquine	118-120	CF transmembrane conductance regulator	Rattus norvegicus	163-167
24368422-7	2014	Since FTS is a non toxic drug we hypothesized that FTS and chloroquine (an autophagy inhibitor) will synergize in cell growth inhibition and cell death.	Chloroquine	59-70	AKT interacting protein	Homo sapiens	6-9
24368422-9	2014	Our results demonstrate that in HCT-116 and in Panc-1 cells, FTS induces autophagy, which can be inhibited by chloroquine.	Chloroquine	110-121	AKT interacting protein	Homo sapiens	61-64
24368422-12	2014	Thus, chloroquine treatment may promote FTS-mediated inhibition of tumor cell growth and may stimulate apoptotic cell death.	Chloroquine	6-17	AKT interacting protein	Homo sapiens	40-43
24830013-21	2014	In 2009, one of these receptors was found to be critical for the itch induced by the antimalarial drug chloroquine (Liu et al.	Chloroquine	103-114	itchy E3 ubiquitin protein ligase	Homo sapiens	65-69
24333414-8	2014	When the PAN-induced autophagy was inhibited by 3-methyladenine (3-MA) or chloroquine (CQ), podocyte apoptosis increased significantly along with the elevation of active caspase-3.	Chloroquine	87-89	caspase 3	Homo sapiens	170-179
24830023-6	2014	Interestingly, knockout mice lacking TRPV1 or TRPA1 exhibit less histamine- or chloroquine-evoked scratching behavior, respectively (Imamachi et al.	Chloroquine	79-90	transient receptor potential cation channel, subfamily V, member 1	Mus musculus	37-42
25551567-7	2014	The administration of the autophagy inhibitor chloroquine significantly increased the expression of proapoptotic genes (Trp53, Bax, Bak1, Pmaip1, Bcl2l11, Cdkn1a, and Cdkn1b) and DNA fragmentation in the frontal brain region of olanzapine-exposed animals.	Chloroquine	46-57	tumor protein p53	Homo sapiens	120-125
24830023-6	2014	Interestingly, knockout mice lacking TRPV1 or TRPA1 exhibit less histamine- or chloroquine-evoked scratching behavior, respectively (Imamachi et al.	Chloroquine	79-90	transient receptor potential cation channel, subfamily A, member 1	Mus musculus	46-51
24913775-8	2014	Mechanistically, we show that auranofin-induced VEGFR3 downregulation is blocked by antioxidant N-acetyl-L-cysteine (NAC) and lysosome inhibitor chloroquine, but is promoted by proteasomal inhibitor MG132.	Chloroquine	145-156	fms related receptor tyrosine kinase 4	Homo sapiens	48-54
25484091-3	2014	Our studies indicate CNS tumor cells with BRAF(V600E) mutant cells (but not wild type) display high rates of induced autophagy, are sensitive to autophagy inhibition, and display synergy when chloroquine is combined with the RAF kinase inhibitor vemurafenib or standard chemotherapeutics.	Chloroquine	192-203	B-Raf proto-oncogene, serine/threonine kinase	Homo sapiens	42-46
25484095-4	2014	By compromising autophagy in melanoma cells or using mice with a conditional knockout of ATG5 in ECs, we found that the favorable effects of CQ on the tumor vasculature do not rely on autophagy.	Chloroquine	141-143	autophagy related 5	Mus musculus	89-93
25551567-7	2014	The administration of the autophagy inhibitor chloroquine significantly increased the expression of proapoptotic genes (Trp53, Bax, Bak1, Pmaip1, Bcl2l11, Cdkn1a, and Cdkn1b) and DNA fragmentation in the frontal brain region of olanzapine-exposed animals.	Chloroquine	46-57	BCL2 associated X, apoptosis regulator	Homo sapiens	127-130
25484095-5	2014	CQ-induced vessel normalization relies mainly on altered endolysosomal trafficking and sustained NOTCH1 signaling in ECs.	Chloroquine	0-2	notch 1	Mus musculus	97-103
25484095-6	2014	Remarkably these CQ-mediated effects are abrogated when tumors are grown in mice harboring EC-specific deletion of NOTCH1.	Chloroquine	17-19	notch 1	Mus musculus	115-121
25551567-7	2014	The administration of the autophagy inhibitor chloroquine significantly increased the expression of proapoptotic genes (Trp53, Bax, Bak1, Pmaip1, Bcl2l11, Cdkn1a, and Cdkn1b) and DNA fragmentation in the frontal brain region of olanzapine-exposed animals.	Chloroquine	46-57	BCL2 antagonist/killer 1	Homo sapiens	132-136
25551567-7	2014	The administration of the autophagy inhibitor chloroquine significantly increased the expression of proapoptotic genes (Trp53, Bax, Bak1, Pmaip1, Bcl2l11, Cdkn1a, and Cdkn1b) and DNA fragmentation in the frontal brain region of olanzapine-exposed animals.	Chloroquine	46-57	phorbol-12-myristate-13-acetate-induced protein 1	Homo sapiens	138-144
25551567-7	2014	The administration of the autophagy inhibitor chloroquine significantly increased the expression of proapoptotic genes (Trp53, Bax, Bak1, Pmaip1, Bcl2l11, Cdkn1a, and Cdkn1b) and DNA fragmentation in the frontal brain region of olanzapine-exposed animals.	Chloroquine	46-57	BCL2 like 11	Homo sapiens	146-153
25551567-7	2014	The administration of the autophagy inhibitor chloroquine significantly increased the expression of proapoptotic genes (Trp53, Bax, Bak1, Pmaip1, Bcl2l11, Cdkn1a, and Cdkn1b) and DNA fragmentation in the frontal brain region of olanzapine-exposed animals.	Chloroquine	46-57	cyclin dependent kinase inhibitor 1A	Homo sapiens	155-161
25551567-7	2014	The administration of the autophagy inhibitor chloroquine significantly increased the expression of proapoptotic genes (Trp53, Bax, Bak1, Pmaip1, Bcl2l11, Cdkn1a, and Cdkn1b) and DNA fragmentation in the frontal brain region of olanzapine-exposed animals.	Chloroquine	46-57	cyclin dependent kinase inhibitor 1B	Homo sapiens	167-173
24316970-0	2014	Chloroquine reduces osteoclastogenesis in murine osteoporosis by preventing TRAF3 degradation.	Chloroquine	0-11	TNF receptor-associated factor 3	Mus musculus	76-81
24169003-5	2014	Furthermore, depression of protein aggregation clearance through the autophagy blockade has also been observed by using specific inhibitors (wortmannin and chloroquine), indicating that autophagy is involved in the degradation of huntingtin protein aggregation.	Chloroquine	156-167	huntingtin	Homo sapiens	230-240
24316970-6	2014	The autophagy/lysosome inhibitor chloroquine reduced RANKL-induced OC formation and function by increasing TRAF3 expression in OCPs in vitro and in vivo.	Chloroquine	33-44	tumor necrosis factor (ligand) superfamily, member 11	Mus musculus	53-58
24316970-6	2014	The autophagy/lysosome inhibitor chloroquine reduced RANKL-induced OC formation and function by increasing TRAF3 expression in OCPs in vitro and in vivo.	Chloroquine	33-44	TNF receptor-associated factor 3	Mus musculus	107-112
24316970-11	2014	Furthermore, treatments that increase TRAF3 levels in OCPs, including pharmacological inhibition of its degradation with compounds such as chloroquine, may limit bone destruction in common bone diseases.	Chloroquine	139-150	TNF receptor-associated factor 3	Mus musculus	38-43
25136646-8	2014	Our data indicate that pristane administration induces macrophage activation, oxidative stress, and Th1/Th2 skewness, which can be attenuated by chloroquine.	Chloroquine	145-156	heart and neural crest derivatives expressed 2	Mus musculus	104-107
25062859-9	2014	CQ treatment induced changes in LC3 II and p62 that were variable across regions and tissue preparations.	Chloroquine	0-2	nucleoporin 62	Mus musculus	43-46
24138918-2	2013	METHODS AND MATERIALS: Chloroquine given immediately after tumor irradiation increased the cure rate of MCaK breast cancer in C3H mice.	Chloroquine	23-34	kinesin family member 2C	Mus musculus	104-108
25062859-10	2014	HD(Q175/Q175) mice exposed to CQ had variable but diminished levels of LC3 II, p62 and LAMP-2A, and increased levels of RAB7.	Chloroquine	30-32	nucleoporin 62	Mus musculus	79-82
25062859-10	2014	HD(Q175/Q175) mice exposed to CQ had variable but diminished levels of LC3 II, p62 and LAMP-2A, and increased levels of RAB7.	Chloroquine	30-32	lysosomal-associated membrane protein 2	Mus musculus	87-94
25062859-10	2014	HD(Q175/Q175) mice exposed to CQ had variable but diminished levels of LC3 II, p62 and LAMP-2A, and increased levels of RAB7.	Chloroquine	30-32	RAB7, member RAS oncogene family	Mus musculus	120-124
25136646-8	2014	Our data indicate that pristane administration induces macrophage activation, oxidative stress, and Th1/Th2 skewness, which can be attenuated by chloroquine.	Chloroquine	145-156	negative elongation factor complex member C/D, Th1l	Mus musculus	100-103
24273604-5	2013	Chloroquine suppressed matrix metalloproteinase (MMP)-2 and MMP-9 mRNA expression and protein activity, whereas MMP-13 mRNA expression and proteolytic activity were increased.	Chloroquine	0-11	matrix metallopeptidase 2	Homo sapiens	23-55
24273604-5	2013	Chloroquine suppressed matrix metalloproteinase (MMP)-2 and MMP-9 mRNA expression and protein activity, whereas MMP-13 mRNA expression and proteolytic activity were increased.	Chloroquine	0-11	matrix metallopeptidase 9	Homo sapiens	60-65
24273604-6	2013	Despite enhancing TLR9 mRNA expression, chloroquine suppressed TLR9 protein expression in vitro.	Chloroquine	40-51	toll like receptor 9	Homo sapiens	63-67
24273604-10	2013	This may be explained by the activating effects of chloroquine on MMP-13 expression or by the fact that chloroquine, by suppressing TLR9 expression, permits the activation of currently unknown molecular pathways, which allow the aggressive behavior of TNBC cells with low TLR9 expression in hypoxia.	Chloroquine	104-115	toll like receptor 9	Homo sapiens	132-136
24273604-10	2013	This may be explained by the activating effects of chloroquine on MMP-13 expression or by the fact that chloroquine, by suppressing TLR9 expression, permits the activation of currently unknown molecular pathways, which allow the aggressive behavior of TNBC cells with low TLR9 expression in hypoxia.	Chloroquine	104-115	toll like receptor 9	Homo sapiens	272-276
24287900-7	2013	Our results showed that: (1) both autophagy and apoptosis could be induced by treatment with matrine; (2) using the autophagic inhibitor chloroquine and beclin-1 small-interfering RNA, cell apoptosis induced by matrine could be enhanced in a caspase-dependent manner; and (3) autophagy was induced via inhibition of PI3K/AKT/mTOR pathway and up-regulation of beclin-1.	Chloroquine	137-148	AKT serine/threonine kinase 1	Homo sapiens	321-324
24287900-7	2013	Our results showed that: (1) both autophagy and apoptosis could be induced by treatment with matrine; (2) using the autophagic inhibitor chloroquine and beclin-1 small-interfering RNA, cell apoptosis induced by matrine could be enhanced in a caspase-dependent manner; and (3) autophagy was induced via inhibition of PI3K/AKT/mTOR pathway and up-regulation of beclin-1.	Chloroquine	137-148	mechanistic target of rapamycin kinase	Homo sapiens	325-329
24287900-7	2013	Our results showed that: (1) both autophagy and apoptosis could be induced by treatment with matrine; (2) using the autophagic inhibitor chloroquine and beclin-1 small-interfering RNA, cell apoptosis induced by matrine could be enhanced in a caspase-dependent manner; and (3) autophagy was induced via inhibition of PI3K/AKT/mTOR pathway and up-regulation of beclin-1.	Chloroquine	137-148	beclin 1	Homo sapiens	359-367
24041961-8	2014	In behavioral studies, individual intrathecal administration of a GRPR, NK-1, or AMPA antagonist each significantly attenuated chloroquine-evoked scratching behavior.	Chloroquine	127-138	gastrin releasing peptide receptor	Mus musculus	66-70
24041961-8	2014	In behavioral studies, individual intrathecal administration of a GRPR, NK-1, or AMPA antagonist each significantly attenuated chloroquine-evoked scratching behavior.	Chloroquine	127-138	tachykinin 1	Mus musculus	72-76
24041961-13	2014	Subpopulations of chloroquine- and/or histamine-sensitive DRG cells were immunopositive for SP and/or GRP, with &gt;80% immunopositive for VGLUT2.	Chloroquine	18-29	tachykinin 1	Mus musculus	92-94
24041961-13	2014	Subpopulations of chloroquine- and/or histamine-sensitive DRG cells were immunopositive for SP and/or GRP, with &gt;80% immunopositive for VGLUT2.	Chloroquine	18-29	gastrin releasing peptide	Mus musculus	102-105
24041961-13	2014	Subpopulations of chloroquine- and/or histamine-sensitive DRG cells were immunopositive for SP and/or GRP, with &gt;80% immunopositive for VGLUT2.	Chloroquine	18-29	solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 6	Mus musculus	139-145
24741964-10	2014	Compared with hypoxia group, addition of CQ increased the number of autophagic vacuoles and the levels of LC3-II protein, but decreased the proliferation and migration of PASMCs.	Chloroquine	41-43	microtubule associated protein 1 light chain 3 alpha	Homo sapiens	106-109
24094936-5	2013	Furthermore, we found that autophagy inhibitors (wortmannin, 3-MA or chloroquine) suppressed QDs-induced autophagic flux, partly blocked LTP impairment, coincident with down-regulation of synapsin-I and synapse deficits by QDs in the hippocampal CA1 area.	Chloroquine	69-80	synapsin I	Homo sapiens	188-198
24094936-5	2013	Furthermore, we found that autophagy inhibitors (wortmannin, 3-MA or chloroquine) suppressed QDs-induced autophagic flux, partly blocked LTP impairment, coincident with down-regulation of synapsin-I and synapse deficits by QDs in the hippocampal CA1 area.	Chloroquine	69-80	carbonic anhydrase 1	Homo sapiens	246-249
24138918-3	2013	Chloroquine blocked radiation-induced autophagy and drove MCaK cells into a more rapid apoptotic and more immunogenic form of cell death.	Chloroquine	0-11	kinesin family member 2C	Mus musculus	58-62
23943044-5	2013	In a first screen 40 mostly heterocyclic, highly active compounds (in nmol range of growth inhibition) were identified with EC50 values &lt;=2 muM against chloroquine-resistant Plasmodium falciparum strains and a therapeutic window &gt;=10 against two mammalian cell lines.	Chloroquine	155-166	latexin	Homo sapiens	143-146
24244540-8	2013	Chloroquine antagonized the inhibition of the activity of Akt 4EBP1 axis mediated by everolimus and at the same time it blocked the feed-back activation of Erk-1/2 induced by RAD in EPCs.	Chloroquine	0-11	mitogen-activated protein kinase 3	Homo sapiens	156-163
24085292-6	2013	Treatment with lysosomal inhibitors (ammonium chloride or chloroquine) or inhibitors of cathepsins (Z-FF-FMK or Z-FA-FMK) or knock-down of LC3B expression by siRNAs suppressed PI-induced IkappaBalpha degradation.	Chloroquine	58-69	microtubule associated protein 1 light chain 3 beta	Homo sapiens	139-143
23880069-10	2013	Loss of NOD2 function impaired autophagy upstream of the autophagy inhibitor chloroquine by reducing the number of acidic vesicles.	Chloroquine	77-88	nucleotide binding oligomerization domain containing 2	Homo sapiens	8-12
24194639-6	2013	Moreover, we report here, for the first time, that in combined therapy, IFNalpha induces a clear process of autophagosome formation, and prior treatment with chloroquine, an autophagy inhibitor, is able to significantly reduce IFNalpha/bozepinib-induced cell death.	Chloroquine	158-169	interferon alpha 1	Homo sapiens	72-80
24062304-9	2013	This property was demonstrated using lysosomotropic weak bases (NH4Cl, chloroquine, or methylamine) that increased lysosomal pH and sensitized only Pgp-expressing cells to such cytotoxic drugs.	Chloroquine	71-82	ATP binding cassette subfamily B member 1	Homo sapiens	148-151
24265594-4	2013	Furthermore, we show that CQ-induced myopathy can be improved by reduction of either autophagy or glycogen synthesis, the latter possibly due to a direct role of Glycogen Synthase in regulating autophagy through its interaction with Atg8.	Chloroquine	26-28	Glycogen synthase	Drosophila melanogaster	162-179
24265594-4	2013	Furthermore, we show that CQ-induced myopathy can be improved by reduction of either autophagy or glycogen synthesis, the latter possibly due to a direct role of Glycogen Synthase in regulating autophagy through its interaction with Atg8.	Chloroquine	26-28	Autophagy-related 8a	Drosophila melanogaster	233-237
24194639-6	2013	Moreover, we report here, for the first time, that in combined therapy, IFNalpha induces a clear process of autophagosome formation, and prior treatment with chloroquine, an autophagy inhibitor, is able to significantly reduce IFNalpha/bozepinib-induced cell death.	Chloroquine	158-169	interferon alpha 1	Homo sapiens	227-235
23460482-7	2013	Functionally, we find that VMP1 regulates both autophagy and chemotherapeutic resistance even in the presence of chloroquin, ATG5 or Beclin 1 siRNAs, or a Beclin 1-binding VMP1 mutant.	Chloroquine	113-123	vacuole membrane protein 1	Homo sapiens	27-31
24147007-0	2013	Persistent inhibition of ABL tyrosine kinase causes enhanced apoptotic response to TRAIL and disrupts the pro-apoptotic effect of chloroquine.	Chloroquine	130-141	ABL proto-oncogene 1, non-receptor tyrosine kinase	Homo sapiens	25-28
24147007-7	2013	We found that lysosomal inhibition by chloroquine (CQ) could also enhance TRAIL-induced apoptosis.	Chloroquine	38-49	TNF superfamily member 10	Homo sapiens	74-79
24147007-7	2013	We found that lysosomal inhibition by chloroquine (CQ) could also enhance TRAIL-induced apoptosis.	Chloroquine	51-53	TNF superfamily member 10	Homo sapiens	74-79
24147007-8	2013	However, this pro-apoptotic effect of CQ was lost in the ABL-knockdown cells but restored by Abl re-expression.	Chloroquine	38-40	ABL proto-oncogene 1, non-receptor tyrosine kinase	Homo sapiens	57-60
24147007-8	2013	However, this pro-apoptotic effect of CQ was lost in the ABL-knockdown cells but restored by Abl re-expression.	Chloroquine	38-40	ABL proto-oncogene 1, non-receptor tyrosine kinase	Homo sapiens	93-96
23879969-10	2013	The autophagic inhibitor chloroquine (CQ) significantly increased apoptosis and decreased the clonogenic capacity of CD133+ cells under H/S.	Chloroquine	25-36	prominin 1	Homo sapiens	117-122
23879969-10	2013	The autophagic inhibitor chloroquine (CQ) significantly increased apoptosis and decreased the clonogenic capacity of CD133+ cells under H/S.	Chloroquine	38-40	prominin 1	Homo sapiens	117-122
23879969-14	2013	CD133+ cells were also found to have a higher tumor-forming ability in vivo, which could be inhibited by CQ administration.	Chloroquine	105-107	prominin 1	Homo sapiens	0-5
23938604-5	2013	We show that depletion of the essential autophagy gene, ATG5, by small interfering RNA (siRNA) or chloroquine, an autophagy inhibitor, markedly reduces GR cell viability under hypoxic conditions.	Chloroquine	98-109	autophagy related 5	Homo sapiens	56-60
23669347-0	2013	The lysosomal inhibitor, chloroquine, increases cell surface BMPR-II levels and restores BMP9 signalling in endothelial cells harbouring BMPR-II mutations.	Chloroquine	25-36	bone morphogenetic protein receptor type 2	Homo sapiens	61-68
23669347-0	2013	The lysosomal inhibitor, chloroquine, increases cell surface BMPR-II levels and restores BMP9 signalling in endothelial cells harbouring BMPR-II mutations.	Chloroquine	25-36	growth differentiation factor 2	Homo sapiens	89-93
23669347-0	2013	The lysosomal inhibitor, chloroquine, increases cell surface BMPR-II levels and restores BMP9 signalling in endothelial cells harbouring BMPR-II mutations.	Chloroquine	25-36	bone morphogenetic protein receptor type 2	Homo sapiens	137-144
23669347-4	2013	Here, we show that the antimalarial drug, chloroquine, markedly increased cell surface expression of BMPR-II protein independent of transcription in PAECs.	Chloroquine	42-53	bone morphogenetic protein receptor type 2	Homo sapiens	101-108
23669347-5	2013	Inhibition of protein synthesis experiments revealed a rapid turnover of cell surface BMPR-II, which was inhibited by chloroquine treatment.	Chloroquine	118-129	bone morphogenetic protein receptor type 2	Homo sapiens	86-93
23669347-6	2013	Chloroquine enhanced PAEC expression of BMPR-II following siRNA knockdown of the BMPR-II transcript.	Chloroquine	0-11	bone morphogenetic protein receptor type 2	Homo sapiens	40-47
23669347-6	2013	Chloroquine enhanced PAEC expression of BMPR-II following siRNA knockdown of the BMPR-II transcript.	Chloroquine	0-11	bone morphogenetic protein receptor type 2	Homo sapiens	81-88
23669347-8	2013	Chloroquine significantly increased gene expression of BMP9-BMPR-II signalling targets Id1, miR21 and miR27a in both mutant BMPR-II PAECs and BOECs.	Chloroquine	0-11	growth differentiation factor 2	Homo sapiens	55-59
23669347-8	2013	Chloroquine significantly increased gene expression of BMP9-BMPR-II signalling targets Id1, miR21 and miR27a in both mutant BMPR-II PAECs and BOECs.	Chloroquine	0-11	bone morphogenetic protein receptor type 2	Homo sapiens	60-67
23669347-8	2013	Chloroquine significantly increased gene expression of BMP9-BMPR-II signalling targets Id1, miR21 and miR27a in both mutant BMPR-II PAECs and BOECs.	Chloroquine	0-11	inhibitor of DNA binding 1, HLH protein	Homo sapiens	87-90
23669347-8	2013	Chloroquine significantly increased gene expression of BMP9-BMPR-II signalling targets Id1, miR21 and miR27a in both mutant BMPR-II PAECs and BOECs.	Chloroquine	0-11	microRNA 21	Homo sapiens	92-97
23669347-8	2013	Chloroquine significantly increased gene expression of BMP9-BMPR-II signalling targets Id1, miR21 and miR27a in both mutant BMPR-II PAECs and BOECs.	Chloroquine	0-11	microRNA 27a	Homo sapiens	102-108
23669347-8	2013	Chloroquine significantly increased gene expression of BMP9-BMPR-II signalling targets Id1, miR21 and miR27a in both mutant BMPR-II PAECs and BOECs.	Chloroquine	0-11	bone morphogenetic protein receptor type 2	Homo sapiens	124-131
23669347-9	2013	These findings provide support for the restoration of cell surface BMPR-II with agents such as chloroquine as a potential therapeutic approach for heritable PAH.	Chloroquine	95-106	bone morphogenetic protein receptor type 2	Homo sapiens	67-74
23800949-5	2013	Chloroquine partially inhibited mechanistic target of rapamycin (MTOR) activity, which would induce autophagy induction as well as block autophagosome maturation.	Chloroquine	0-11	mechanistic target of rapamycin kinase	Homo sapiens	32-63
23800949-5	2013	Chloroquine partially inhibited mechanistic target of rapamycin (MTOR) activity, which would induce autophagy induction as well as block autophagosome maturation.	Chloroquine	0-11	mechanistic target of rapamycin kinase	Homo sapiens	65-69
24171075-4	2013	MATERIALS AND METHODS: We applied polyethyleneimine (PEI) and oligoethyleneimine (OEI) derivatives alone or their co-formulation with different agents such as chloroquine (a drug known to alter lysosomal pH and thus to inhibit lysosomal degradation of macromolecules), DOPE (lipophilic agent), succinic acid (introduction of negatively charged to polymer) and transferrin (the ligand of transferring receptor which is over-expressed in many types of tumors and hematopoietic cells).	Chloroquine	159-170	transferrin	Homo sapiens	360-371
23970379-9	2013	Because VPA and CQ are well-tolerated drugs, combinatorial therapy with VPA and CQ could represent an attractive treatment option for AML1-ETO-positive leukemia.	Chloroquine	16-18	RUNX family transcription factor 1	Homo sapiens	134-138
23970379-9	2013	Because VPA and CQ are well-tolerated drugs, combinatorial therapy with VPA and CQ could represent an attractive treatment option for AML1-ETO-positive leukemia.	Chloroquine	16-18	RUNX1 partner transcriptional co-repressor 1	Homo sapiens	139-142
23970379-9	2013	Because VPA and CQ are well-tolerated drugs, combinatorial therapy with VPA and CQ could represent an attractive treatment option for AML1-ETO-positive leukemia.	Chloroquine	80-82	RUNX family transcription factor 1	Homo sapiens	134-138
23970379-9	2013	Because VPA and CQ are well-tolerated drugs, combinatorial therapy with VPA and CQ could represent an attractive treatment option for AML1-ETO-positive leukemia.	Chloroquine	80-82	RUNX1 partner transcriptional co-repressor 1	Homo sapiens	139-142
23939040-7	2013	The piperine-induced autophagic flux was further confirmed by assaying LC3-II accumulation and LC3B puncta formation in the presence of chloroquine, a well-known autophagy inhibitor.	Chloroquine	136-147	microtubule associated protein 1 light chain 3 beta	Homo sapiens	95-99
23706562-3	2013	We hypothesize that chloroquine (CQ), an antimalarial drug that inhibits autophagosome function, in combination with either echinomycin, a HIF-1alpha inhibitor, or 17-dimethylaminoethylamino-17-dimethoxygeldanamycin (17-DMAG), an Hsp 90 inhibitor, will result in cytotoxicity in melanoma.	Chloroquine	20-31	hypoxia inducible factor 1 subunit alpha	Homo sapiens	139-149
24187608-4	2013	Safety, tolerability and overall survival of this combination was also examined, along with allelic status of IDO2 (indoleamine 2,3-dioxygenase 2), an immune modulatory enzyme inhibited by chloroquine that may affect survival outcomes.	Chloroquine	189-200	indoleamine 2,3-dioxygenase 2	Homo sapiens	110-114
24187608-4	2013	Safety, tolerability and overall survival of this combination was also examined, along with allelic status of IDO2 (indoleamine 2,3-dioxygenase 2), an immune modulatory enzyme inhibited by chloroquine that may affect survival outcomes.	Chloroquine	189-200	indoleamine 2,3-dioxygenase 2	Homo sapiens	116-145
23706562-8	2013	Chloroquine combined with echinomycin achieved synergistic cytotoxicity under hypoxic conditions in multiple melanoma cell lines (BRAF wild-type and mutant).	Chloroquine	0-11	B-Raf proto-oncogene, serine/threonine kinase	Homo sapiens	130-134
23706562-3	2013	We hypothesize that chloroquine (CQ), an antimalarial drug that inhibits autophagosome function, in combination with either echinomycin, a HIF-1alpha inhibitor, or 17-dimethylaminoethylamino-17-dimethoxygeldanamycin (17-DMAG), an Hsp 90 inhibitor, will result in cytotoxicity in melanoma.	Chloroquine	20-31	heat shock protein 90 alpha family class A member 1	Homo sapiens	230-236
23706562-10	2013	Changes in LC3 flux indicated inhibition of autophagy at the level of the autophagosome by CQ therapy.	Chloroquine	91-93	microtubule associated protein 1 light chain 3 alpha	Homo sapiens	11-14
23706562-3	2013	We hypothesize that chloroquine (CQ), an antimalarial drug that inhibits autophagosome function, in combination with either echinomycin, a HIF-1alpha inhibitor, or 17-dimethylaminoethylamino-17-dimethoxygeldanamycin (17-DMAG), an Hsp 90 inhibitor, will result in cytotoxicity in melanoma.	Chloroquine	33-35	heat shock protein 90 alpha family class A member 1	Homo sapiens	230-236
23891088-3	2013	In the current study, we assessed the potential of autophagy inhibition (using chloroquine (CQ)) in treatment of EGFR expressing tumors.	Chloroquine	79-90	epidermal growth factor receptor	Homo sapiens	113-117
23891088-3	2013	In the current study, we assessed the potential of autophagy inhibition (using chloroquine (CQ)) in treatment of EGFR expressing tumors.	Chloroquine	92-94	epidermal growth factor receptor	Homo sapiens	113-117
23891088-5	2013	RESULTS: We show that EGFR overexpressing xenografts are sensitive to CQ treatment and are sensitized to irradiation by autophagy inhibition.	Chloroquine	70-72	epidermal growth factor receptor	Homo sapiens	22-26
23891088-7	2013	This observation was substantiated in cell lines, showing high EGFR expressing cells to be more sensitive to CQ addition as reflected by decreased proliferation and survival.	Chloroquine	109-111	epidermal growth factor receptor	Homo sapiens	63-67
23800883-5	2013	Treatment with CQ, shRNA-mediated knockdown, or genetic engineering-induced deletion of autophagy-related gene 5 (Atg5) promoted proteasome-dependent PPARgamma2 degradation and attenuated adipogenic differentiation.	Chloroquine	15-17	peroxisome proliferator activated receptor gamma	Mus musculus	150-160
23558035-6	2013	Chloroquine pretreatment significantly enhanced rats" short-term spatial memory capacity and attenuated the expression of TLR3, IFR3, and IFN-beta in the Hippocampus compared to non-treatment control in tGCI rats.	Chloroquine	0-11	toll-like receptor 3	Rattus norvegicus	122-126
23558035-6	2013	Chloroquine pretreatment significantly enhanced rats" short-term spatial memory capacity and attenuated the expression of TLR3, IFR3, and IFN-beta in the Hippocampus compared to non-treatment control in tGCI rats.	Chloroquine	0-11	interferon beta 1	Rattus norvegicus	138-146
23707973-0	2013	Chloroquine inhibits HMGB1 inflammatory signaling and protects mice from lethal sepsis.	Chloroquine	0-11	high mobility group box 1	Mus musculus	21-26
23872411-7	2013	Treatment of mice with the lysosome inhibitor, chloroquine, or the proteasome inhibitor, MG132, increased ileal ASBT protein levels in BBMVs.	Chloroquine	47-58	solute carrier family 10, member 2	Mus musculus	112-116
23872411-8	2013	CA-mediated reduction of ASBT protein levels in the ABPC-pretreated mice was attenuated by co-treatment with chloroquine or MG132.	Chloroquine	109-120	solute carrier family 10, member 2	Mus musculus	25-29
23707973-5	2013	The protective effects of chloroquine were mediated through inhibition of HMGB1 release in macrophages, monocytes, and endothelial cells, thereby preventing its cytokine-like activities.	Chloroquine	26-37	high mobility group box 1	Mus musculus	74-79
23707973-6	2013	As an inhibitor of autophagy, chloroquine specifically inhibited HMGB1-induced Ikappa-B degradation and NF-kappaB activation.	Chloroquine	30-41	high mobility group box 1	Mus musculus	65-70
23604568-8	2013	CQ, MB and ART treatment of infected mice caused a significant (p &lt; 0.05) increase in the levels of hepatic GSH and GST.	Chloroquine	0-2	hematopoietic prostaglandin D synthase	Mus musculus	119-122
23722646-0	2013	Chloroquine blocks the autophagic process in cisplatin-resistant osteosarcoma cells by regulating the expression of p62/SQSTM1.	Chloroquine	0-11	sequestosome 1	Homo sapiens	116-119
23722646-0	2013	Chloroquine blocks the autophagic process in cisplatin-resistant osteosarcoma cells by regulating the expression of p62/SQSTM1.	Chloroquine	0-11	sequestosome 1	Homo sapiens	120-126
23695424-12	2013	Chloroquine, NAC and bafilomycin A1 also decreased tetrandrine-induced cleaved caspase-3 and cleaved PARP in SAS cells.	Chloroquine	0-11	poly(ADP-ribose) polymerase 1	Homo sapiens	101-105
23883625-7	2013	Furthermore, inhibition of autophagy process by chloroquine administration immediately after CLP resulted in elevated serum transaminase levels and a significant increase in mortality.	Chloroquine	48-59	hyaluronan and proteoglycan link protein 1	Mus musculus	93-96
23331101-6	2013	Pre-treatment of OLCs with the inhibitory peptide MyD88, or chloroquine, attenuated the CpG ODN-induced expression of MMP-13.	Chloroquine	60-71	matrix metallopeptidase 13	Mus musculus	118-124
23482646-5	2013	Chloroquine exerted a direct pH-dependent antifungal effect on Aspergillus fumigatus and Aspergillus nidulans; it increased the antifungal activity of PMNs from patients with CGD at a significantly lower concentration, compared with the concentration for PMNs from healthy individuals; and decreased the hyperinflammatory state of PBMCs from patients with CGD, as observed by decreased tumor necrosis factor alpha and interleukin 1beta release.	Chloroquine	0-11	tumor necrosis factor	Homo sapiens	386-413
23807223-9	2013	The mechanism of protective action of chloroquine appeared to involve its ability to modulate mitogen-activated protein kinase activation, reduce high-mobility group box 1 release and inflammatory cytokines production, whereas chloroquine worsened liver injury via inhibition of autophagy and induction of hepatic apoptosis at the late phase.	Chloroquine	38-49	high mobility group box 1	Rattus norvegicus	146-171
23482646-5	2013	Chloroquine exerted a direct pH-dependent antifungal effect on Aspergillus fumigatus and Aspergillus nidulans; it increased the antifungal activity of PMNs from patients with CGD at a significantly lower concentration, compared with the concentration for PMNs from healthy individuals; and decreased the hyperinflammatory state of PBMCs from patients with CGD, as observed by decreased tumor necrosis factor alpha and interleukin 1beta release.	Chloroquine	0-11	interleukin 1 beta	Homo sapiens	418-435
23771660-8	2013	However, in the group F, NO concentration was markedly decreased, and the inhibitory effect of CQ on TLR4 expression and the relief of lung injury were weakened when compared with those in the group E (P&lt;0.05 or P&lt;0.01).	Chloroquine	95-97	toll-like receptor 4	Rattus norvegicus	101-105
23530461-4	2013	The aim of the current study was to test the hypothesis that combined inhibition of AKT signalling and autophagy by the lysosomal inhibitor chloroquine increases the susceptibility to docetaxel-induced apoptosis of cSCC cells isolated from a lymph-node metastasis.	Chloroquine	140-151	AKT serine/threonine kinase 1	Homo sapiens	84-87
23702482-0	2013	Chloroquine stimulates glucose uptake and glycogen synthase in muscle cells through activation of Akt.	Chloroquine	0-11	AKT serine/threonine kinase 1	Homo sapiens	98-101
23702482-4	2013	Chloroquine was recently reported to be an activator of ATM, the protein deficient in the Ataxia-telagiectasia (A-T) disease.	Chloroquine	0-11	ATM serine/threonine kinase	Homo sapiens	56-59
23702482-5	2013	Since ATM is also known as an insulin responsive protein that mediates Akt activation, we tested the effect of chloroquine on the activity of Akt and its downstream targets.	Chloroquine	111-122	ATM serine/threonine kinase	Homo sapiens	6-9
23702482-5	2013	Since ATM is also known as an insulin responsive protein that mediates Akt activation, we tested the effect of chloroquine on the activity of Akt and its downstream targets.	Chloroquine	111-122	AKT serine/threonine kinase 1	Homo sapiens	142-145
23702482-6	2013	In L6 muscle cells treated with insulin and chloroquine, the phosphorylation of Akt and glucose uptake were dramatically increased compared to cells treated with insulin alone, suggesting that chloroquine is a potent activator of Akt and glucose uptake in these cells.	Chloroquine	44-55	AKT serine/threonine kinase 1	Homo sapiens	80-83
23702482-6	2013	In L6 muscle cells treated with insulin and chloroquine, the phosphorylation of Akt and glucose uptake were dramatically increased compared to cells treated with insulin alone, suggesting that chloroquine is a potent activator of Akt and glucose uptake in these cells.	Chloroquine	44-55	insulin	Homo sapiens	162-169
23702482-6	2013	In L6 muscle cells treated with insulin and chloroquine, the phosphorylation of Akt and glucose uptake were dramatically increased compared to cells treated with insulin alone, suggesting that chloroquine is a potent activator of Akt and glucose uptake in these cells.	Chloroquine	44-55	AKT serine/threonine kinase 1	Homo sapiens	230-233
23702482-6	2013	In L6 muscle cells treated with insulin and chloroquine, the phosphorylation of Akt and glucose uptake were dramatically increased compared to cells treated with insulin alone, suggesting that chloroquine is a potent activator of Akt and glucose uptake in these cells.	Chloroquine	193-204	insulin	Homo sapiens	32-39
23702482-6	2013	In L6 muscle cells treated with insulin and chloroquine, the phosphorylation of Akt and glucose uptake were dramatically increased compared to cells treated with insulin alone, suggesting that chloroquine is a potent activator of Akt and glucose uptake in these cells.	Chloroquine	193-204	AKT serine/threonine kinase 1	Homo sapiens	80-83
23702482-6	2013	In L6 muscle cells treated with insulin and chloroquine, the phosphorylation of Akt and glucose uptake were dramatically increased compared to cells treated with insulin alone, suggesting that chloroquine is a potent activator of Akt and glucose uptake in these cells.	Chloroquine	193-204	insulin	Homo sapiens	162-169
23702482-6	2013	In L6 muscle cells treated with insulin and chloroquine, the phosphorylation of Akt and glucose uptake were dramatically increased compared to cells treated with insulin alone, suggesting that chloroquine is a potent activator of Akt and glucose uptake in these cells.	Chloroquine	193-204	AKT serine/threonine kinase 1	Homo sapiens	230-233
23702482-7	2013	We also found that the reduction of insulin-mediated Akt activity in muscle tissues of insulin resistant rats was partially reversed by chloroquine treatment.	Chloroquine	136-147	insulin	Homo sapiens	36-43
23702482-7	2013	We also found that the reduction of insulin-mediated Akt activity in muscle tissues of insulin resistant rats was partially reversed by chloroquine treatment.	Chloroquine	136-147	AKT serine/threonine kinase 1	Rattus norvegicus	53-56
23702482-7	2013	We also found that the reduction of insulin-mediated Akt activity in muscle tissues of insulin resistant rats was partially reversed by chloroquine treatment.	Chloroquine	136-147	insulin	Homo sapiens	87-94
23702482-8	2013	Moreover, insulin-mediated phosphorylation of glycogen synthase kinase-3beta in L6 cells was greatly enhanced by chloroquine.	Chloroquine	113-124	insulin	Homo sapiens	10-17
23702482-10	2013	Taken together, our results not only show that chloroquine is a novel activator of Akt that stimulates glucose uptake and glycogen synthase, but also validate chloroquine as a potential therapeutic agent for patients with type 2 diabetes mellitus.	Chloroquine	47-58	AKT serine/threonine kinase 1	Homo sapiens	83-86
23702482-10	2013	Taken together, our results not only show that chloroquine is a novel activator of Akt that stimulates glucose uptake and glycogen synthase, but also validate chloroquine as a potential therapeutic agent for patients with type 2 diabetes mellitus.	Chloroquine	159-170	AKT serine/threonine kinase 1	Homo sapiens	83-86
23755314-9	2013	Chloroquine treatment inhibited DENV-2-induced mTRAIL relocalization and IFN-alpha production by pDC.	Chloroquine	0-11	tumor necrosis factor (ligand) superfamily, member 10	Mus musculus	47-53
23755314-9	2013	Chloroquine treatment inhibited DENV-2-induced mTRAIL relocalization and IFN-alpha production by pDC.	Chloroquine	0-11	interferon alpha 1	Homo sapiens	73-82
23771660-10	2013	CQ could relieve ALI by decreasing the TLR4 expression and increasing the NO release.	Chloroquine	0-2	toll-like receptor 4	Rattus norvegicus	39-43
23575415-0	2013	The autophagy inhibitor chloroquine overcomes the innate resistance of wild-type EGFR non-small-cell lung cancer cells to erlotinib.	Chloroquine	24-35	epidermal growth factor receptor	Mus musculus	81-85
23151917-0	2013	The dual PI3K/mTOR inhibitor NVP-BEZ235 and chloroquine synergize to trigger apoptosis via mitochondrial-lysosomal cross-talk.	Chloroquine	44-55	mechanistic target of rapamycin kinase	Homo sapiens	14-18
23647678-0	2013	Relaxant effect of chloroquine in rat ileum: possible involvement of nitric oxide and BKCa.	Chloroquine	19-30	potassium calcium-activated channel subfamily M alpha 1	Rattus norvegicus	86-90
23647678-8	2013	Chloroquine-induced relaxation was not blocked by tetrodotoxin, but was partially reversed by the nitric oxide synthase inhibitor L-NAME or the large conductance Ca(2+) -activated K(+) (BKCa) channel antagonist iberiotoxin.	Chloroquine	0-11	potassium calcium-activated channel subfamily M alpha 1	Rattus norvegicus	186-190
23575415-11	2013	Inhibition of autophagy by CQ represents a novel strategy to broaden the spectrum of erlotinib efficacy in wild-type EGFR NSCLC tumors.	Chloroquine	27-29	epidermal growth factor receptor	Mus musculus	117-121
23700487-7	2013	The enhanced ISG expression by siRNA transfection were abolished by siRNA-specific 2"-O-methyl antisense RNA and the inhibitors 2-AP and chloroquine blocking PKR and other TLR-mediated signaling pathways.	Chloroquine	137-148	eukaryotic translation initiation factor 2 alpha kinase 2	Homo sapiens	158-161
23151917-5	2013	In combination, BEZ235 and CQ cooperate to trigger LMP, Bax activation, loss of mitochondrial membrane potential (MMP) and caspase-dependent apoptosis.	Chloroquine	27-29	BCL2 associated X, apoptosis regulator	Homo sapiens	56-59
23508958-0	2013	Excitation and modulation of TRPA1, TRPV1, and TRPM8 channel-expressing sensory neurons by the pruritogen chloroquine.	Chloroquine	106-117	transient receptor potential cation channel subfamily A member 1	Homo sapiens	29-34
23508958-0	2013	Excitation and modulation of TRPA1, TRPV1, and TRPM8 channel-expressing sensory neurons by the pruritogen chloroquine.	Chloroquine	106-117	transient receptor potential cation channel subfamily V member 1	Homo sapiens	36-41
23508958-0	2013	Excitation and modulation of TRPA1, TRPV1, and TRPM8 channel-expressing sensory neurons by the pruritogen chloroquine.	Chloroquine	106-117	transient receptor potential cation channel subfamily M member 8	Homo sapiens	47-52
23508958-4	2013	The pruritogen chloroquine (CQ) was reported to excite TRPA1, leading to the sensation of itch.	Chloroquine	15-26	transient receptor potential cation channel subfamily A member 1	Homo sapiens	55-60
23508958-4	2013	The pruritogen chloroquine (CQ) was reported to excite TRPA1, leading to the sensation of itch.	Chloroquine	28-30	transient receptor potential cation channel subfamily A member 1	Homo sapiens	55-60
23508958-6	2013	Here, we show that only 43% of CQ-excited dorsal root ganglion neurons expressed TRPA1; as expected, the responses of these neurons were completely prevented by the TRPA1 antagonist HC-030031.	Chloroquine	31-33	transient receptor potential cation channel subfamily A member 1	Homo sapiens	81-86
23508958-6	2013	Here, we show that only 43% of CQ-excited dorsal root ganglion neurons expressed TRPA1; as expected, the responses of these neurons were completely prevented by the TRPA1 antagonist HC-030031.	Chloroquine	31-33	transient receptor potential cation channel subfamily A member 1	Homo sapiens	165-170
23508958-8	2013	Furthermore, CQ caused potent sensitization of TRPV1 in 51.9% of TRPV1(+) neurons and concomitant inhibition of TRPM8 in 48.8% of TRPM8(+) dorsal root ganglion neurons.	Chloroquine	13-15	transient receptor potential cation channel subfamily V member 1	Homo sapiens	47-52
23508958-8	2013	Furthermore, CQ caused potent sensitization of TRPV1 in 51.9% of TRPV1(+) neurons and concomitant inhibition of TRPM8 in 48.8% of TRPM8(+) dorsal root ganglion neurons.	Chloroquine	13-15	transient receptor potential cation channel subfamily V member 1	Homo sapiens	65-70
23508958-8	2013	Furthermore, CQ caused potent sensitization of TRPV1 in 51.9% of TRPV1(+) neurons and concomitant inhibition of TRPM8 in 48.8% of TRPM8(+) dorsal root ganglion neurons.	Chloroquine	13-15	transient receptor potential cation channel subfamily M member 8	Homo sapiens	112-117
23508958-8	2013	Furthermore, CQ caused potent sensitization of TRPV1 in 51.9% of TRPV1(+) neurons and concomitant inhibition of TRPM8 in 48.8% of TRPM8(+) dorsal root ganglion neurons.	Chloroquine	13-15	transient receptor potential cation channel subfamily M member 8	Homo sapiens	130-135
23508958-11	2013	Our data suggest the involvement of the TRPC3 channel acting together with TRPA1 to mediate CQ-induced itch.	Chloroquine	92-94	transient receptor potential cation channel subfamily C member 3	Homo sapiens	40-45
23508958-11	2013	Our data suggest the involvement of the TRPC3 channel acting together with TRPA1 to mediate CQ-induced itch.	Chloroquine	92-94	transient receptor potential cation channel subfamily A member 1	Homo sapiens	75-80
23658644-9	2013	dsRNA- but not dsRNA/LyoVec-induced IFN expression was partly inhibited by chloroquine that suppresses endosomal TLR3 activation.	Chloroquine	75-86	interferon alpha 1	Homo sapiens	36-39
23493286-10	2013	Autophagic flux, estimated by a fluorescent light chain 3-II reporter and the increase in p62 levels after chloroquine treatment, was higher in AKR versus DBA/2 macrophages, which had an apparent decrease in autophagosome fusion with lysosomes.	Chloroquine	107-118	nucleoporin 62	Mus musculus	90-93
23213063-12	2013	The treatments of BDCA3(+) DCs with anti-CD81 antibody, cloroquine, or bafilomycin A1 reduced HCVcc-induced IL-28B release, whereas BDCA3(+) DCs comparably produced IL-28B upon replication-defective HCVcc.	Chloroquine	56-66	thrombomodulin	Homo sapiens	18-23
23213063-12	2013	The treatments of BDCA3(+) DCs with anti-CD81 antibody, cloroquine, or bafilomycin A1 reduced HCVcc-induced IL-28B release, whereas BDCA3(+) DCs comparably produced IL-28B upon replication-defective HCVcc.	Chloroquine	56-66	interferon lambda 3	Homo sapiens	108-114
23658644-9	2013	dsRNA- but not dsRNA/LyoVec-induced IFN expression was partly inhibited by chloroquine that suppresses endosomal TLR3 activation.	Chloroquine	75-86	toll like receptor 3	Homo sapiens	113-117
23471972-0	2013	Chloroquine binding reveals flavin redox switch function of quinone reductase 2.	Chloroquine	0-11	N-ribosyldihydronicotinamide:quinone reductase 2	Homo sapiens	60-79
23471972-1	2013	Quinone reductase 2 (NQO2) is an FAD-linked enzyme and the only known human target of two antimalarial drugs, primaquine (PQ) and chloroquine (CQ).	Chloroquine	130-141	N-ribosyldihydronicotinamide:quinone reductase 2	Homo sapiens	0-19
23471972-1	2013	Quinone reductase 2 (NQO2) is an FAD-linked enzyme and the only known human target of two antimalarial drugs, primaquine (PQ) and chloroquine (CQ).	Chloroquine	130-141	N-ribosyldihydronicotinamide:quinone reductase 2	Homo sapiens	21-25
23471972-1	2013	Quinone reductase 2 (NQO2) is an FAD-linked enzyme and the only known human target of two antimalarial drugs, primaquine (PQ) and chloroquine (CQ).	Chloroquine	143-145	N-ribosyldihydronicotinamide:quinone reductase 2	Homo sapiens	0-19
23471972-1	2013	Quinone reductase 2 (NQO2) is an FAD-linked enzyme and the only known human target of two antimalarial drugs, primaquine (PQ) and chloroquine (CQ).	Chloroquine	143-145	N-ribosyldihydronicotinamide:quinone reductase 2	Homo sapiens	21-25
23471972-2	2013	The structural differences between oxidized and reduced NQO2 and the structural basis for inhibition by PQ and CQ were investigated by x-ray crystallography.	Chloroquine	111-113	N-ribosyldihydronicotinamide:quinone reductase 2	Homo sapiens	56-60
23471972-3	2013	Structures of oxidized NQO2 in complex with PQ and CQ were solved at 1.4 A resolution.	Chloroquine	51-53	N-ribosyldihydronicotinamide:quinone reductase 2	Homo sapiens	23-27
23471972-4	2013	CQ binds preferentially to reduced NQO2, and upon reduction of NQO2-CQ crystals, the space group changed from P2(1)2(1)2(1) to P2(1), with 1-A decreases in all three unit cell dimensions.	Chloroquine	0-2	N-ribosyldihydronicotinamide:quinone reductase 2	Homo sapiens	35-39
23457305-3	2013	Pharmacological inhibitors of lysosomal degradation, such as bafilomycin and chloroquine, increased HIF-1alpha levels and HIF-1 activity, whereas activators of chaperone-mediated autophagy, including 6-aminonicotinamide and nutrient starvation, decreased HIF-1alpha levels and HIF-1 activity.	Chloroquine	77-88	hypoxia inducible factor 1 subunit alpha	Homo sapiens	100-110
23457305-3	2013	Pharmacological inhibitors of lysosomal degradation, such as bafilomycin and chloroquine, increased HIF-1alpha levels and HIF-1 activity, whereas activators of chaperone-mediated autophagy, including 6-aminonicotinamide and nutrient starvation, decreased HIF-1alpha levels and HIF-1 activity.	Chloroquine	77-88	hypoxia inducible factor 1 subunit alpha	Homo sapiens	100-105
23457305-3	2013	Pharmacological inhibitors of lysosomal degradation, such as bafilomycin and chloroquine, increased HIF-1alpha levels and HIF-1 activity, whereas activators of chaperone-mediated autophagy, including 6-aminonicotinamide and nutrient starvation, decreased HIF-1alpha levels and HIF-1 activity.	Chloroquine	77-88	hypoxia inducible factor 1 subunit alpha	Homo sapiens	255-265
23446737-0	2013	Chloroquine prevents progression of experimental pulmonary hypertension via inhibition of autophagy and lysosomal bone morphogenetic protein type II receptor degradation.	Chloroquine	0-11	bone morphogenetic protein receptor type 2	Rattus norvegicus	114-157
23446737-2	2013	OBJECTIVE: We reasoned that chloroquine, based on its ability to inhibit autophagy and block lysosomal degradation of the bone morphogenetic protein type II receptor (BMPR-II), might exert beneficial effects in this disease.	Chloroquine	28-39	bone morphogenetic protein receptor type 2	Rattus norvegicus	122-165
23457305-3	2013	Pharmacological inhibitors of lysosomal degradation, such as bafilomycin and chloroquine, increased HIF-1alpha levels and HIF-1 activity, whereas activators of chaperone-mediated autophagy, including 6-aminonicotinamide and nutrient starvation, decreased HIF-1alpha levels and HIF-1 activity.	Chloroquine	77-88	hypoxia inducible factor 1 subunit alpha	Homo sapiens	122-127
23446737-2	2013	OBJECTIVE: We reasoned that chloroquine, based on its ability to inhibit autophagy and block lysosomal degradation of the bone morphogenetic protein type II receptor (BMPR-II), might exert beneficial effects in this disease.	Chloroquine	28-39	bone morphogenetic protein receptor type 2	Rattus norvegicus	167-174
23500467-5	2013	Furthermore, we found that the inhibition of autophagy by chloroquine augmented apoptotic cell death of irradiated A172 cells transfected with IDPm siRNA.	Chloroquine	58-69	isocitrate dehydrogenase (NADP(+)) 2	Homo sapiens	143-147
23446737-7	2013	Chloroquine treatment increased whole lung and PASMC p62 protein levels consistent with inhibition of autophagy, and increased levels of BMPR-II protein.	Chloroquine	0-11	KH RNA binding domain containing, signal transduction associated 1	Rattus norvegicus	53-56
23446737-7	2013	Chloroquine treatment increased whole lung and PASMC p62 protein levels consistent with inhibition of autophagy, and increased levels of BMPR-II protein.	Chloroquine	0-11	bone morphogenetic protein receptor type 2	Rattus norvegicus	137-144
23446737-9	2013	In cultured rat PASMCs we confirmed that chloroquine both inhibited autophagy pathways and increased expression of BMPR-II protein via lysosomal inhibition.	Chloroquine	41-52	bone morphogenetic protein receptor type 2	Rattus norvegicus	115-122
23124112-5	2013	Furthermore, we demonstrate that autophagy induced by UCP2 inhibition determines a ROS-dependent cell death, as indicated by the apoptosis decrease in the presence of the autophagy inhibitors chloroquine (CQ) or 3-methyladenine (3-MA), or the radical scavenger NAC.	Chloroquine	192-203	uncoupling protein 2	Homo sapiens	54-58
23380587-5	2013	Lysosomotropic agents chloroquine and bafilomycin A 1, but not nutrient deprivation or rapamycin treatment, further increased LC3-II generation, as well as ATG12-positive puncta, indicating that hypertonic stress increases autophagic flux.	Chloroquine	22-33	microtubule associated protein 1 light chain 3 alpha	Homo sapiens	126-129
23380587-5	2013	Lysosomotropic agents chloroquine and bafilomycin A 1, but not nutrient deprivation or rapamycin treatment, further increased LC3-II generation, as well as ATG12-positive puncta, indicating that hypertonic stress increases autophagic flux.	Chloroquine	22-33	autophagy related 12	Homo sapiens	156-161
23534411-2	2013	Analogues 14h and 20l exhibited potential antimalarial activity against chloroquine-sensitive D6 strain with IC(50) 1.25 and 0.88 muM and chloroquine-resistant W2 strain with IC(50) 1.64 and 1.07 muM, respectively.	Chloroquine	72-83	latexin	Homo sapiens	130-133
23338979-1	2013	Compound 1-methyl-7-nitro-4-(5-(piperidin-1-yl)pentyl)-3,4-dihydroquinoxalin-2(1H)-one (VAM2-6) was evaluated against a blood-induced infection with chloroquine-sensitive Plasmodium yoelii yoelii lethal strain in CD1 mice in a 4-day test scheme.	Chloroquine	149-160	VPS39 HOPS complex subunit	Mus musculus	88-94
23286240-3	2013	Compounds 1 and 2 showed potent antimalarial activity against chloroquine-resistant Plasmodium falciparum, with IC50 values of 0.75 +- 0.30 and 0.14 +- 0.04 muM, while 3 was inactive in this assay.	Chloroquine	62-73	latexin	Homo sapiens	157-160
23452820-6	2013	RESULTS: Combination treatment of SCLC lines with ABT-737 and chloroquine decreased viability and increased caspase-3 activation over treatment with either single agent.	Chloroquine	62-73	caspase 3	Homo sapiens	108-117
23452820-8	2013	However, knockdown of beclin-1, a key regulator of entry into autophagy, diminished the efficacy of ABT-737, suggesting either that the effects of chloroquine were nonspecific or that induction but not completion of autophagy is necessary for the combined effect of ABT-737 and chloroquine.	Chloroquine	147-158	beclin 1	Homo sapiens	22-30
23452820-8	2013	However, knockdown of beclin-1, a key regulator of entry into autophagy, diminished the efficacy of ABT-737, suggesting either that the effects of chloroquine were nonspecific or that induction but not completion of autophagy is necessary for the combined effect of ABT-737 and chloroquine.	Chloroquine	278-289	beclin 1	Homo sapiens	22-30
23452820-9	2013	ABT-737 and chloroquine in SCLC cell lines downregulated Mcl-1 and upregulated NOXA, both of which may promote apoptosis.	Chloroquine	12-23	MCL1 apoptosis regulator, BCL2 family member	Homo sapiens	57-62
23452820-9	2013	ABT-737 and chloroquine in SCLC cell lines downregulated Mcl-1 and upregulated NOXA, both of which may promote apoptosis.	Chloroquine	12-23	phorbol-12-myristate-13-acetate-induced protein 1	Homo sapiens	79-83
23124112-5	2013	Furthermore, we demonstrate that autophagy induced by UCP2 inhibition determines a ROS-dependent cell death, as indicated by the apoptosis decrease in the presence of the autophagy inhibitors chloroquine (CQ) or 3-methyladenine (3-MA), or the radical scavenger NAC.	Chloroquine	205-207	uncoupling protein 2	Homo sapiens	54-58
23192368-4	2013	K(IR)2.1 trafficking in HEK293 cells was studied by live cell imaging, immunofluorescence microscopy, and Western blot following pharmacological intervention with dynasore (Dyn), chlorpromazine (CPZ), bafilomycin A1 (Baf), or chloroquine (CQ).	Chloroquine	226-237	potassium inwardly rectifying channel subfamily J member 2	Homo sapiens	0-8
23238993-6	2013	The protective role of autophagy in cell growth inhibition by CP-31398 and RITA is supported by the finding that the AMPK inhibitor compound C or the autophagy inhibitors chloroquine or 3-methyladenine sensitize both pancreatic adenocarcinoma cell lines to the apoptotic response induced by p53-reactivating molecules.	Chloroquine	171-182	tumor protein p53	Homo sapiens	291-294
23283972-8	2013	Furthermore, ECE-2 was detected in autophagic vesicles in cells treated with chloroquine.	Chloroquine	77-88	endothelin converting enzyme 2	Homo sapiens	13-18
23283972-9	2013	Under these conditions, ECE inhibition produced significantly higher elevations in intracellular Abeta than chloroquine treatment alone.	Chloroquine	108-119	endothelin converting enzyme 1	Homo sapiens	24-27
23155177-6	2013	In behavioral studies, both systemic and intrathecal administration of a NK-1 receptor antagonist significantly attenuated scratching evoked by chloroquine and a protease-activated receptor 2 agonist, SLIGRL, but not histamine, bovine adrenal medulla peptide 8-22 (BAM8-22), or serotonin.	Chloroquine	144-155	tachykinin precursor 1	Bos taurus	73-77
23155177-7	2013	Systemic or intrathecal administration of a GRP receptor antagonist attenuated scratching evoked by chloroquine and SLIGRL but not BAM8-22 or histamine.	Chloroquine	100-111	gastrin releasing peptide	Bos taurus	44-47
23258740-10	2013	Blocking autophagy using pharmacologic inhibitors (3-methyladenine, chloroquine, and bafilomycin A) or genetic inhibitors (siRNA targeting Atg3 and Atg7) enhanced cell death induced by Akt inhibitor AZD5363 in these tumor prostate cell lines.	Chloroquine	68-79	AKT serine/threonine kinase 1	Homo sapiens	185-188
23192368-4	2013	K(IR)2.1 trafficking in HEK293 cells was studied by live cell imaging, immunofluorescence microscopy, and Western blot following pharmacological intervention with dynasore (Dyn), chlorpromazine (CPZ), bafilomycin A1 (Baf), or chloroquine (CQ).	Chloroquine	239-241	potassium inwardly rectifying channel subfamily J member 2	Homo sapiens	0-8
23192368-6	2013	CQ induced lysosomal build-up of full length (3.8 +- 0.8-fold) and N-terminal cleaved K(IR)2.1 protein.	Chloroquine	0-2	potassium inwardly rectifying channel subfamily J member 2	Homo sapiens	86-94
23111416-0	2013	Chloroquine overcomes resistance of lung carcinoma cells to the dual PI3K/mTOR inhibitor PI103 by lysosome-mediated apoptosis.	Chloroquine	0-11	mechanistic target of rapamycin kinase	Homo sapiens	74-78
23262180-2	2013	Here, we show that autophagy inhibitor chloroquine (CQ) increases HIF-1 alpha accumulation, thus potentiating CoCl(2)-induced growth arrest and differentiation of leukemic cells.	Chloroquine	39-50	hypoxia inducible factor 1 subunit alpha	Homo sapiens	66-77
23262180-2	2013	Here, we show that autophagy inhibitor chloroquine (CQ) increases HIF-1 alpha accumulation, thus potentiating CoCl(2)-induced growth arrest and differentiation of leukemic cells.	Chloroquine	52-54	hypoxia inducible factor 1 subunit alpha	Homo sapiens	66-77
23262180-3	2013	Furthermore, the increased effect of CQ on differentiation induction is dependent of the inhibition of autophagosome maturation and degradation, since this sensitization could be mimicked by the suppression of expression of both lysosome-associated membrane proteins 1 and 2 (LAMP1 and LAMP2).	Chloroquine	37-39	lysosomal associated membrane protein 1	Homo sapiens	229-274
23262180-3	2013	Furthermore, the increased effect of CQ on differentiation induction is dependent of the inhibition of autophagosome maturation and degradation, since this sensitization could be mimicked by the suppression of expression of both lysosome-associated membrane proteins 1 and 2 (LAMP1 and LAMP2).	Chloroquine	37-39	lysosomal associated membrane protein 1	Homo sapiens	276-281
23262180-3	2013	Furthermore, the increased effect of CQ on differentiation induction is dependent of the inhibition of autophagosome maturation and degradation, since this sensitization could be mimicked by the suppression of expression of both lysosome-associated membrane proteins 1 and 2 (LAMP1 and LAMP2).	Chloroquine	37-39	lysosomal associated membrane protein 2	Homo sapiens	286-291
23111416-2	2013	Here, we report that the lysosomotropic agent chloroquine (CQ) reverses the resistance of lung carcinoma cells to PI3K/mTOR inhibition and primes cells for PI103-induced apoptosis.	Chloroquine	46-57	mechanistic target of rapamycin kinase	Homo sapiens	119-123
23111416-2	2013	Here, we report that the lysosomotropic agent chloroquine (CQ) reverses the resistance of lung carcinoma cells to PI3K/mTOR inhibition and primes cells for PI103-induced apoptosis.	Chloroquine	59-61	mechanistic target of rapamycin kinase	Homo sapiens	119-123
22865292-8	2013	The lysosomal inhibitor chloroquine significantly increased RCAN1 accumulation in +/+ cells, consistent with the hypothesis that higher lysosomal pH impairs RCAN1 degradation, leading to a higher RCAN1/NFATc1 ratio and consequently NFATc1 inhibition.	Chloroquine	24-35	regulator of calcineurin 1	Mus musculus	60-65
24083726-5	2013	After inhibition of autophagy by chloroquine, the rates of cell apoptosis were increased to (30.16+-3.54)%, and the level of Caspase-3 and P53 protein were increased, and Bcl-2 protein was decreased.	Chloroquine	33-44	tumor protein p53	Homo sapiens	139-142
24083726-5	2013	After inhibition of autophagy by chloroquine, the rates of cell apoptosis were increased to (30.16+-3.54)%, and the level of Caspase-3 and P53 protein were increased, and Bcl-2 protein was decreased.	Chloroquine	33-44	BCL2 apoptosis regulator	Homo sapiens	171-176
22865292-8	2013	The lysosomal inhibitor chloroquine significantly increased RCAN1 accumulation in +/+ cells, consistent with the hypothesis that higher lysosomal pH impairs RCAN1 degradation, leading to a higher RCAN1/NFATc1 ratio and consequently NFATc1 inhibition.	Chloroquine	24-35	regulator of calcineurin 1	Mus musculus	157-162
22865292-8	2013	The lysosomal inhibitor chloroquine significantly increased RCAN1 accumulation in +/+ cells, consistent with the hypothesis that higher lysosomal pH impairs RCAN1 degradation, leading to a higher RCAN1/NFATc1 ratio and consequently NFATc1 inhibition.	Chloroquine	24-35	nuclear factor of activated T cells, cytoplasmic, calcineurin dependent 1	Mus musculus	202-208
22865292-8	2013	The lysosomal inhibitor chloroquine significantly increased RCAN1 accumulation in +/+ cells, consistent with the hypothesis that higher lysosomal pH impairs RCAN1 degradation, leading to a higher RCAN1/NFATc1 ratio and consequently NFATc1 inhibition.	Chloroquine	24-35	nuclear factor of activated T cells, cytoplasmic, calcineurin dependent 1	Mus musculus	232-238
22865292-8	2013	The lysosomal inhibitor chloroquine significantly increased RCAN1 accumulation in +/+ cells, consistent with the hypothesis that higher lysosomal pH impairs RCAN1 degradation, leading to a higher RCAN1/NFATc1 ratio and consequently NFATc1 inhibition.	Chloroquine	24-35	regulator of calcineurin 1	Mus musculus	157-162
24080835-6	2013	To block TLR3 endosomal activity, chloroquine was injected intravitreously after laser injury.	Chloroquine	34-45	toll-like receptor 3	Mus musculus	9-13
23000623-4	2012	The MrgprA3 agonist chloroquine unidirectionally cross-sensitized BAM8-22-evoked scratching.	Chloroquine	20-31	MAS-related GPR, member A3	Mus musculus	4-11
23840921-6	2013	We found that chloroquine exposure impairs trafficking of Hb:Hp complexes through the endosomal-lysosomal compartment after internalization by CD163.	Chloroquine	14-25	CD163 molecule	Homo sapiens	143-148
23000623-4	2012	The MrgprA3 agonist chloroquine unidirectionally cross-sensitized BAM8-22-evoked scratching.	Chloroquine	20-31	myeloid/lymphoid or mixed-lineage leukemia; translocated to, 1	Mus musculus	66-73
22445004-1	2012	PURPOSE: We have previously shown that the antimalarial agent chloroquine can abrogate the lethal cellular effects of low-dose-rate (LDR) radiation in vitro, most likely by activating the ataxia-telangiectasia mutated (ATM) protein.	Chloroquine	62-73	ataxia telangiectasia mutated	Mus musculus	188-217
22962016-7	2012	The receptors for denatonium (TAS2R4, TAS2R10) and chloroquine (TAS2R3, TAS2R10) were expressed in GPT.	Chloroquine	51-62	taste receptor type 2 member 3	Cavia porcellus	64-70
23271297-3	2012	Our results provide several lines of evidence for an important role of nociceptive arcuate nucleus neurons in chloroquine-induced pruritic behavior: (1) Intradermal microinjection of chloroquine resulted in a dramatic increase in itch behaviors accompanied by the activation of c-Fos positive neurons in arcuate nucleus; (2) Microinjection of chloroquine significantly increased IBAT temperature in the mice.	Chloroquine	110-121	FBJ osteosarcoma oncogene	Mus musculus	278-283
23271297-3	2012	Our results provide several lines of evidence for an important role of nociceptive arcuate nucleus neurons in chloroquine-induced pruritic behavior: (1) Intradermal microinjection of chloroquine resulted in a dramatic increase in itch behaviors accompanied by the activation of c-Fos positive neurons in arcuate nucleus; (2) Microinjection of chloroquine significantly increased IBAT temperature in the mice.	Chloroquine	183-194	FBJ osteosarcoma oncogene	Mus musculus	278-283
23271297-3	2012	Our results provide several lines of evidence for an important role of nociceptive arcuate nucleus neurons in chloroquine-induced pruritic behavior: (1) Intradermal microinjection of chloroquine resulted in a dramatic increase in itch behaviors accompanied by the activation of c-Fos positive neurons in arcuate nucleus; (2) Microinjection of chloroquine significantly increased IBAT temperature in the mice.	Chloroquine	183-194	FBJ osteosarcoma oncogene	Mus musculus	278-283
22445004-1	2012	PURPOSE: We have previously shown that the antimalarial agent chloroquine can abrogate the lethal cellular effects of low-dose-rate (LDR) radiation in vitro, most likely by activating the ataxia-telangiectasia mutated (ATM) protein.	Chloroquine	62-73	ataxia telangiectasia mutated	Mus musculus	219-222
22445004-12	2012	CONCLUSION: Chloroquine administration before radiation had a significant effect on the survival of normal but not ATM null mice, strongly suggesting that the in vivo effect, like the in vitro effect, is also ATM dependent.	Chloroquine	12-23	ataxia telangiectasia mutated	Mus musculus	209-212
22851715-0	2012	Molecular mechanisms of chloroquine inhibition of heterologously expressed Kir6.2/SUR2A channels.	Chloroquine	24-35	potassium inwardly rectifying channel subfamily J member 11	Homo sapiens	75-81
22851715-0	2012	Molecular mechanisms of chloroquine inhibition of heterologously expressed Kir6.2/SUR2A channels.	Chloroquine	24-35	ATP-binding cassette sub-family C member 9	Oryctolagus cuniculus	82-87
22851715-2	2012	Motivated by reports that chloroquine inhibition of cardiac ATP-sensitive inward rectifier K(+) current (I(KATP)) is antifibrillatory in rabbit ventricle, we investigated the mechanism of chloroquine inhibition of ATP-sensitive potassium (K(ATP)) channels (Kir6.2/SUR2A) expressed in human embryonic kidney 293 cells, using inside-out patch-clamp recordings.	Chloroquine	26-37	ATP-sensitive inward rectifier potassium channel 11	Oryctolagus cuniculus	257-263
22851715-2	2012	Motivated by reports that chloroquine inhibition of cardiac ATP-sensitive inward rectifier K(+) current (I(KATP)) is antifibrillatory in rabbit ventricle, we investigated the mechanism of chloroquine inhibition of ATP-sensitive potassium (K(ATP)) channels (Kir6.2/SUR2A) expressed in human embryonic kidney 293 cells, using inside-out patch-clamp recordings.	Chloroquine	26-37	ATP-binding cassette sub-family C member 9	Oryctolagus cuniculus	264-269
22851715-3	2012	We found that chloroquine inhibits the Kir6.2/SUR2A channel by interacting with at least two different sites and by two mechanisms of action.	Chloroquine	14-25	potassium inwardly rectifying channel subfamily J member 11	Homo sapiens	39-45
22851715-3	2012	We found that chloroquine inhibits the Kir6.2/SUR2A channel by interacting with at least two different sites and by two mechanisms of action.	Chloroquine	14-25	ATP-binding cassette sub-family C member 9	Oryctolagus cuniculus	46-51
22851715-5	2012	Conversely, a slow-onset, voltage-independent inhibition of I(KATP) is regulated by chloroquine interaction with a different site and probably involves disruption of interactions between Kir6.2/SUR2A and phosphatidylinositol 4,5-bisphosphate.	Chloroquine	84-95	ATP-binding cassette sub-family C member 9	Oryctolagus cuniculus	194-199
22824846-6	2012	Furthermore, the inhibition of the activation of PKCdelta by rottlerin, an inhibitor of PKCdelta, not only suppressed the activation of PKCdelta, but also the apoptosis induced by the co-treatment of chloroquine and IBC, indicating the involvement of PKCdelta in chloroquine plus IBC-induced cell death.	Chloroquine	263-274	protein kinase C delta	Homo sapiens	49-57
22981315-5	2012	Finally, we found that chloroquine was only effective in sensitizing starvation-induced cell death in Atg5-expressing cells, but not in Atg5-deficient cells.	Chloroquine	23-34	autophagy related 5	Mus musculus	102-106
22638980-0	2012	Differential effects of the autophagy inhibitors 3-methyladenine and chloroquine on spontaneous and TNF-alpha-induced neutrophil apoptosis.	Chloroquine	69-80	tumor necrosis factor	Homo sapiens	100-109
22638980-4	2012	We first showed that the established autophagy inhibitors 3-methyladenine (MA) and chloroquine (CQ) markedly accelerated spontaneous neutrophil apoptosis as was evidenced by phosphatidylserine exposure, DNA fragmentation and caspase-3 activation.	Chloroquine	83-94	caspase 3	Homo sapiens	225-234
22638980-4	2012	We first showed that the established autophagy inhibitors 3-methyladenine (MA) and chloroquine (CQ) markedly accelerated spontaneous neutrophil apoptosis as was evidenced by phosphatidylserine exposure, DNA fragmentation and caspase-3 activation.	Chloroquine	96-98	caspase 3	Homo sapiens	225-234
22638980-6	2012	Unexpectedly, both MA and CQ significantly delayed neutrophil apoptosis induced by TNF-alpha, although the inhibitors did attenuate late pro-survival effect of the cytokine.	Chloroquine	26-28	tumor necrosis factor	Homo sapiens	83-92
22638980-9	2012	Both MA and CQ induced a marked down-regulation of a key anti-apoptotic protein Mcl-1 but did not affect significantly the levels of another anti-apoptotic protein Bcl-X(L).	Chloroquine	12-14	MCL1 apoptosis regulator, BCL2 family member	Homo sapiens	80-85
22804476-7	2012	Chloroquine reduced S100A9 but not LPS signalling, indicating that S100A9 may need to be internalized to be fully active as a TLR4 inducer.	Chloroquine	0-11	S100 calcium binding protein A9	Homo sapiens	20-26
22804476-7	2012	Chloroquine reduced S100A9 but not LPS signalling, indicating that S100A9 may need to be internalized to be fully active as a TLR4 inducer.	Chloroquine	0-11	S100 calcium binding protein A9	Homo sapiens	67-73
22804476-7	2012	Chloroquine reduced S100A9 but not LPS signalling, indicating that S100A9 may need to be internalized to be fully active as a TLR4 inducer.	Chloroquine	0-11	toll like receptor 4	Homo sapiens	126-130
22824846-5	2012	Moreover, we demonstrate that the collapse of the mitochondrial membrane potential contributes to chloroquine and IBC-induced cell death, which is accompanied by the activation of caspase-9, and -3, the cleavage of poly (ADP-ribose) polymerase (PARP) and the proteolytic activation of protein kinase Cdelta (PKCdelta).	Chloroquine	98-109	caspase 9	Homo sapiens	180-197
22824846-5	2012	Moreover, we demonstrate that the collapse of the mitochondrial membrane potential contributes to chloroquine and IBC-induced cell death, which is accompanied by the activation of caspase-9, and -3, the cleavage of poly (ADP-ribose) polymerase (PARP) and the proteolytic activation of protein kinase Cdelta (PKCdelta).	Chloroquine	98-109	poly(ADP-ribose) polymerase 1	Homo sapiens	215-243
22824846-5	2012	Moreover, we demonstrate that the collapse of the mitochondrial membrane potential contributes to chloroquine and IBC-induced cell death, which is accompanied by the activation of caspase-9, and -3, the cleavage of poly (ADP-ribose) polymerase (PARP) and the proteolytic activation of protein kinase Cdelta (PKCdelta).	Chloroquine	98-109	poly(ADP-ribose) polymerase 1	Homo sapiens	245-249
22824846-5	2012	Moreover, we demonstrate that the collapse of the mitochondrial membrane potential contributes to chloroquine and IBC-induced cell death, which is accompanied by the activation of caspase-9, and -3, the cleavage of poly (ADP-ribose) polymerase (PARP) and the proteolytic activation of protein kinase Cdelta (PKCdelta).	Chloroquine	98-109	protein kinase C delta	Homo sapiens	285-306
22824846-5	2012	Moreover, we demonstrate that the collapse of the mitochondrial membrane potential contributes to chloroquine and IBC-induced cell death, which is accompanied by the activation of caspase-9, and -3, the cleavage of poly (ADP-ribose) polymerase (PARP) and the proteolytic activation of protein kinase Cdelta (PKCdelta).	Chloroquine	98-109	protein kinase C delta	Homo sapiens	308-316
22824846-6	2012	Furthermore, the inhibition of the activation of PKCdelta by rottlerin, an inhibitor of PKCdelta, not only suppressed the activation of PKCdelta, but also the apoptosis induced by the co-treatment of chloroquine and IBC, indicating the involvement of PKCdelta in chloroquine plus IBC-induced cell death.	Chloroquine	200-211	protein kinase C delta	Homo sapiens	49-57
22824846-6	2012	Furthermore, the inhibition of the activation of PKCdelta by rottlerin, an inhibitor of PKCdelta, not only suppressed the activation of PKCdelta, but also the apoptosis induced by the co-treatment of chloroquine and IBC, indicating the involvement of PKCdelta in chloroquine plus IBC-induced cell death.	Chloroquine	200-211	protein kinase C delta	Homo sapiens	88-96
22824846-6	2012	Furthermore, the inhibition of the activation of PKCdelta by rottlerin, an inhibitor of PKCdelta, not only suppressed the activation of PKCdelta, but also the apoptosis induced by the co-treatment of chloroquine and IBC, indicating the involvement of PKCdelta in chloroquine plus IBC-induced cell death.	Chloroquine	200-211	protein kinase C delta	Homo sapiens	88-96
22824846-6	2012	Furthermore, the inhibition of the activation of PKCdelta by rottlerin, an inhibitor of PKCdelta, not only suppressed the activation of PKCdelta, but also the apoptosis induced by the co-treatment of chloroquine and IBC, indicating the involvement of PKCdelta in chloroquine plus IBC-induced cell death.	Chloroquine	200-211	protein kinase C delta	Homo sapiens	88-96
22824846-6	2012	Furthermore, the inhibition of the activation of PKCdelta by rottlerin, an inhibitor of PKCdelta, not only suppressed the activation of PKCdelta, but also the apoptosis induced by the co-treatment of chloroquine and IBC, indicating the involvement of PKCdelta in chloroquine plus IBC-induced cell death.	Chloroquine	263-274	protein kinase C delta	Homo sapiens	88-96
22824846-6	2012	Furthermore, the inhibition of the activation of PKCdelta by rottlerin, an inhibitor of PKCdelta, not only suppressed the activation of PKCdelta, but also the apoptosis induced by the co-treatment of chloroquine and IBC, indicating the involvement of PKCdelta in chloroquine plus IBC-induced cell death.	Chloroquine	263-274	protein kinase C delta	Homo sapiens	88-96
22824846-6	2012	Furthermore, the inhibition of the activation of PKCdelta by rottlerin, an inhibitor of PKCdelta, not only suppressed the activation of PKCdelta, but also the apoptosis induced by the co-treatment of chloroquine and IBC, indicating the involvement of PKCdelta in chloroquine plus IBC-induced cell death.	Chloroquine	263-274	protein kinase C delta	Homo sapiens	88-96
22750161-5	2012	The results demonstrated that there was a decrease in BDNF levels in the hippocampus of C57BL/6 mice infected with PbA when compared with C57BL/6 non-infected mice and C57BL/6 non-infected mice that received treatment with chloroquine.	Chloroquine	223-234	brain derived neurotrophic factor	Mus musculus	54-58
22791344-3	2012	Chronic administration of chloroquine also results in polyuria, which may be explained by suppression of the antidiuretic response of vasopressin.	Chloroquine	26-37	arginine vasopressin	Rattus norvegicus	134-145
22791344-9	2012	Immunohistochemistry showed a marked reduction of UT-A1 and AQP2 in the apical membrane in inner medullary collecting ducts of chloroquine-treated rats.	Chloroquine	127-138	aquaporin 2	Rattus norvegicus	60-64
23099154-6	2012	Therefore, impairment of lysosomal functions by azithromycin and chloroquine deregulate TLR4 recycling and signaling and phospholipases activation and lead to anti-inflammatory phenotype in LPS-stimulated J774A.1 cells.	Chloroquine	65-76	toll-like receptor 4	Mus musculus	88-92
22786771-8	2012	Inhibition of MMP-induced IFN-alpha secretion by cytochalasin D, chloroquine, and an inhibitory G-rich oligodeoxynucleotide identify TLR9 as the receptor for MMP-DNA.	Chloroquine	65-76	interferon alpha 1	Homo sapiens	26-35
23650606-2	2012	The interference of chloroquine with interferon-gamma-induced tryptophan breakdown and neopterin production has been investigated in human peripheral blood mononuclear cells (PBMC) in vitro.	Chloroquine	20-31	interferon gamma	Homo sapiens	37-53
22683571-10	2012	In human lung slices, chronic beta-agonist exposure culminated in 64 +- 5.7% (P &lt; 0.001) desensitization of beta(2)AR-mediated dilation of carbachol-constricted airways that was reversed by chloroquine.	Chloroquine	193-204	adrenoceptor beta 2	Homo sapiens	111-120
22394361-8	2012	Chloroquine caused a significant decrease in the expression of TLR1, 2, 3, 4, and 9 at 16 weeks compared with control mice who did not receive chloroquine.	Chloroquine	0-11	toll-like receptor 12	Mus musculus	63-70
22639870-6	2012	D1/D5 receptor agonists reacidified lysosomes in cells alkalinized by chloroquine or tamoxifen, with acidification dependent on protein kinase A. Knockdown with siRNA confirmed acidification was mediated by the D5 receptor.	Chloroquine	70-81	dopamine receptor D1	Mus musculus	0-14
22675041-6	2012	Importantly, cotargeting Hsp27 and autophagy by combining OGX-427 with the autophagy inhibitor, chloroquine, significantly delayed PC-3 prostate tumor growth in vivo.	Chloroquine	96-107	heat shock protein family B (small) member 1	Homo sapiens	25-30
22660171-7	2012	Limiting autophagy in mice with coadministration of chloroquine (CQ) diminishes serum levels of HMGB1, cytokines (IFNG and IL6 but not IL18), and autophagic flux, attenuating weight gain, enhancing DC, T-cell and NK cell numbers, and promoting long-term tumor control in a murine hepatic metastases model.	Chloroquine	52-63	high mobility group box 1	Mus musculus	96-101
22660171-7	2012	Limiting autophagy in mice with coadministration of chloroquine (CQ) diminishes serum levels of HMGB1, cytokines (IFNG and IL6 but not IL18), and autophagic flux, attenuating weight gain, enhancing DC, T-cell and NK cell numbers, and promoting long-term tumor control in a murine hepatic metastases model.	Chloroquine	52-63	interferon gamma	Mus musculus	114-118
22660171-7	2012	Limiting autophagy in mice with coadministration of chloroquine (CQ) diminishes serum levels of HMGB1, cytokines (IFNG and IL6 but not IL18), and autophagic flux, attenuating weight gain, enhancing DC, T-cell and NK cell numbers, and promoting long-term tumor control in a murine hepatic metastases model.	Chloroquine	52-63	interleukin 6	Mus musculus	123-126
22660171-7	2012	Limiting autophagy in mice with coadministration of chloroquine (CQ) diminishes serum levels of HMGB1, cytokines (IFNG and IL6 but not IL18), and autophagic flux, attenuating weight gain, enhancing DC, T-cell and NK cell numbers, and promoting long-term tumor control in a murine hepatic metastases model.	Chloroquine	65-67	high mobility group box 1	Mus musculus	96-101
22660171-7	2012	Limiting autophagy in mice with coadministration of chloroquine (CQ) diminishes serum levels of HMGB1, cytokines (IFNG and IL6 but not IL18), and autophagic flux, attenuating weight gain, enhancing DC, T-cell and NK cell numbers, and promoting long-term tumor control in a murine hepatic metastases model.	Chloroquine	65-67	interferon gamma	Mus musculus	114-118
22660171-7	2012	Limiting autophagy in mice with coadministration of chloroquine (CQ) diminishes serum levels of HMGB1, cytokines (IFNG and IL6 but not IL18), and autophagic flux, attenuating weight gain, enhancing DC, T-cell and NK cell numbers, and promoting long-term tumor control in a murine hepatic metastases model.	Chloroquine	65-67	interleukin 6	Mus musculus	123-126
22660171-7	2012	Limiting autophagy in mice with coadministration of chloroquine (CQ) diminishes serum levels of HMGB1, cytokines (IFNG and IL6 but not IL18), and autophagic flux, attenuating weight gain, enhancing DC, T-cell and NK cell numbers, and promoting long-term tumor control in a murine hepatic metastases model.	Chloroquine	65-67	interleukin 18	Mus musculus	135-139
22660171-10	2012	CQ increases autophagic vacuoles and LC3-II levels in tumor cells, associated with increased annexin V(+)/PI(-) cells, cleaved-PARP, cleaved-CASP3, and cytochrome c release from mitochondria.	Chloroquine	0-2	annexin A5	Mus musculus	93-102
22660171-10	2012	CQ increases autophagic vacuoles and LC3-II levels in tumor cells, associated with increased annexin V(+)/PI(-) cells, cleaved-PARP, cleaved-CASP3, and cytochrome c release from mitochondria.	Chloroquine	0-2	poly (ADP-ribose) polymerase family, member 1	Mus musculus	127-131
22660171-10	2012	CQ increases autophagic vacuoles and LC3-II levels in tumor cells, associated with increased annexin V(+)/PI(-) cells, cleaved-PARP, cleaved-CASP3, and cytochrome c release from mitochondria.	Chloroquine	0-2	caspase 3	Mus musculus	141-146
22659438-6	2012	Both CQ treatments significantly inhibited expression of TLR9 and MHC-II on DCs, and reduced the number of myeloid and plasmatocytoid DCs at 3 and 5 days after infection.	Chloroquine	5-7	toll-like receptor 9	Mus musculus	57-61
22659438-6	2012	Both CQ treatments significantly inhibited expression of TLR9 and MHC-II on DCs, and reduced the number of myeloid and plasmatocytoid DCs at 3 and 5 days after infection.	Chloroquine	5-7	histocompatibility-2, MHC	Mus musculus	66-72
22659438-7	2012	Consequently, activation of CD4+ T cells, especially the expansion of the Th1 subsets, was dramatically inhibited in CQ treated groups, which was accompanied by a remarkable decline in the production of Th1 type proinflammatory mediators IFN-gamma, TNF-alpha, and nitric oxide.	Chloroquine	117-119	negative elongation factor complex member C/D, Th1l	Mus musculus	74-77
22659438-7	2012	Consequently, activation of CD4+ T cells, especially the expansion of the Th1 subsets, was dramatically inhibited in CQ treated groups, which was accompanied by a remarkable decline in the production of Th1 type proinflammatory mediators IFN-gamma, TNF-alpha, and nitric oxide.	Chloroquine	117-119	negative elongation factor complex member C/D, Th1l	Mus musculus	203-206
22659438-7	2012	Consequently, activation of CD4+ T cells, especially the expansion of the Th1 subsets, was dramatically inhibited in CQ treated groups, which was accompanied by a remarkable decline in the production of Th1 type proinflammatory mediators IFN-gamma, TNF-alpha, and nitric oxide.	Chloroquine	117-119	interferon gamma	Mus musculus	238-247
22659438-7	2012	Consequently, activation of CD4+ T cells, especially the expansion of the Th1 subsets, was dramatically inhibited in CQ treated groups, which was accompanied by a remarkable decline in the production of Th1 type proinflammatory mediators IFN-gamma, TNF-alpha, and nitric oxide.	Chloroquine	117-119	tumor necrosis factor	Mus musculus	249-258
22166166-4	2012	METHODS: THP-1 cells were stimulated with Pg-DNA (100 ng/muL), Fn-DNA (100 ng/muL), Ss-DNA (100 ng/muL), Pg-LPS (10 ng/muL), and heat-killed whole bacteria (multiplicity of infection, 1:100) for 16 hours with or without chloroquine pretreatment (10 mug/mL).	Chloroquine	220-231	GLI family zinc finger 2	Homo sapiens	9-14
22166166-9	2012	Chloroquine pretreatment significantly decreased cytokine production from THP-1 cells with the exception of IL-6 production triggered by whole Fn and Ss (P &lt;0.05).	Chloroquine	0-11	GLI family zinc finger 2	Homo sapiens	74-79
22150760-12	2012	Moreover, laminin-111 decreased Cx43 labeling at the intercellular junction, whereas pretreatment with degradation inhibitors (lysosomal protease inhibitor, chloroquine; proteasome inhibitor, lactacystin) increased Cx43 expression, reversely.	Chloroquine	157-168	gap junction protein, alpha 1	Mus musculus	215-219
22472122-3	2012	Here, we hypothesized that the autophagy inhibitor chloroquine would enhance IL-2 immunotherapeutic efficacy and limit toxicity.	Chloroquine	51-62	interleukin 2	Homo sapiens	77-81
22391528-7	2012	All the other compounds blocked hERG, with IC(50)s ranging from 3- to 30-fold their C(max)s. In hERG trafficking studies, the facilitative effects of chloroquine at about 30-fold its C(max) were confirmed and DHA blocked it at a concentration about 300-fold its C(max).	Chloroquine	150-161	ETS transcription factor ERG	Homo sapiens	32-36
22391528-7	2012	All the other compounds blocked hERG, with IC(50)s ranging from 3- to 30-fold their C(max)s. In hERG trafficking studies, the facilitative effects of chloroquine at about 30-fold its C(max) were confirmed and DHA blocked it at a concentration about 300-fold its C(max).	Chloroquine	150-161	ETS transcription factor ERG	Homo sapiens	96-100
22716215-11	2012	The combination of 5-FU and chloroquine induced G1 arrest, up-regulation of p27 and p53, and down-regulation of CDK2 and cyclin D1.	Chloroquine	28-39	interferon alpha inducible protein 27	Homo sapiens	76-79
22716215-11	2012	The combination of 5-FU and chloroquine induced G1 arrest, up-regulation of p27 and p53, and down-regulation of CDK2 and cyclin D1.	Chloroquine	28-39	tumor protein p53	Homo sapiens	84-87
22716215-11	2012	The combination of 5-FU and chloroquine induced G1 arrest, up-regulation of p27 and p53, and down-regulation of CDK2 and cyclin D1.	Chloroquine	28-39	cyclin dependent kinase 2	Homo sapiens	112-116
22716215-11	2012	The combination of 5-FU and chloroquine induced G1 arrest, up-regulation of p27 and p53, and down-regulation of CDK2 and cyclin D1.	Chloroquine	28-39	cyclin D1	Homo sapiens	121-130
22681769-1	2012	BACKGROUND: The Lao Government changed the national policy for uncomplicated Plasmodium falciparum malaria from chloroquine to artemether-lumefantrine (AL) in 2005.	Chloroquine	112-123	interleukin 4 induced 1	Homo sapiens	16-19
22472122-8	2012	In tumor cells, chloroquine increased autophagic vacuoles and LC3-II levels inhibited oxidative phosphorylation and ATP production and promoted apoptosis, which was associated with increased Annexin-V(+)/propidium iodide (PI)(-) cells, cleaved PARP, cleaved caspase-3, and cytochrome c release from mitochondria.	Chloroquine	16-27	annexin A5	Homo sapiens	191-200
22472122-8	2012	In tumor cells, chloroquine increased autophagic vacuoles and LC3-II levels inhibited oxidative phosphorylation and ATP production and promoted apoptosis, which was associated with increased Annexin-V(+)/propidium iodide (PI)(-) cells, cleaved PARP, cleaved caspase-3, and cytochrome c release from mitochondria.	Chloroquine	16-27	collagen type XI alpha 2 chain	Homo sapiens	244-248
22472122-8	2012	In tumor cells, chloroquine increased autophagic vacuoles and LC3-II levels inhibited oxidative phosphorylation and ATP production and promoted apoptosis, which was associated with increased Annexin-V(+)/propidium iodide (PI)(-) cells, cleaved PARP, cleaved caspase-3, and cytochrome c release from mitochondria.	Chloroquine	16-27	cytochrome c, somatic	Homo sapiens	273-285
22328488-5	2012	We observed, indeed, that chloroquine suppressed the pulse-end currents of Kv1.3-channels at higher voltage steps.	Chloroquine	26-37	potassium voltage-gated channel, shaker-related subfamily, member 3	Mus musculus	75-80
22595112-8	2012	CpG ODN-induced IL-8 up-regulation was attenuated by TLR9 inhibitor (chloroquine) and MyD88 inhibitory peptide.	Chloroquine	69-80	chemokine (C-X-C motif) ligand 15	Mus musculus	16-20
22595112-8	2012	CpG ODN-induced IL-8 up-regulation was attenuated by TLR9 inhibitor (chloroquine) and MyD88 inhibitory peptide.	Chloroquine	69-80	toll-like receptor 9	Mus musculus	53-57
22544937-7	2012	Furthermore, this effect was blocked by oral administration of the TLR9 inhibitor chloroquine.	Chloroquine	82-93	toll-like receptor 9	Mus musculus	67-71
22328488-9	2012	We conclude that chloroquine facilitates both the activation and the inactivation of Kv1.3-channel currents in thymocytes, and that those effects are voltage dependent.	Chloroquine	17-28	potassium voltage-gated channel, shaker-related subfamily, member 3	Mus musculus	85-90
22378779-5	2012	The lysosomotropic agent, chloroquine, arrested the majority of endocytosed beta1AR in the TGN by 4 h. Immunoblot analysis showed that either disruption of the TGN or blockage of the lysosome prevented beta1AR degradation.	Chloroquine	26-37	adrenoceptor beta 1	Homo sapiens	76-83
22531455-2	2012	CYP2C8 enzyme is involved in the metabolism of the anti-malarials amodiaquine and chloroquine.	Chloroquine	82-93	cytochrome P450 family 2 subfamily C member 8	Homo sapiens	0-6
22531455-3	2012	The presence of the CYP2C8*2 defective allele has been recently associated to higher rate of chloroquine-resistant malaria parasites.	Chloroquine	93-104	cytochrome P450 family 2 subfamily C member 8	Homo sapiens	20-26
22378779-5	2012	The lysosomotropic agent, chloroquine, arrested the majority of endocytosed beta1AR in the TGN by 4 h. Immunoblot analysis showed that either disruption of the TGN or blockage of the lysosome prevented beta1AR degradation.	Chloroquine	26-37	adrenoceptor beta 1	Homo sapiens	202-209
22378779-7	2012	Arrestin-3-induced inhibition of beta1AR recycling was reversed by BFA treatment, whereas chloroquine induced the accumulation of arrestin-3 with beta1AR in the TGN.	Chloroquine	90-101	arrestin 3	Homo sapiens	130-140
22378779-7	2012	Arrestin-3-induced inhibition of beta1AR recycling was reversed by BFA treatment, whereas chloroquine induced the accumulation of arrestin-3 with beta1AR in the TGN.	Chloroquine	90-101	adrenoceptor beta 1	Homo sapiens	146-153
22367781-2	2012	Here, we determined the in vitro and in vivo activity of the combination of the pan-HDI panobinostat and the autophagy inhibitor chloroquine against human estrogen/progesterone receptor and HER2 (triple)-negative breast cancer (TNBC) cells.	Chloroquine	129-140	erb-b2 receptor tyrosine kinase 2	Homo sapiens	190-194
22447568-6	2012	When treated with bevacizumab alone, human glioblastoma xenografts showed increased BNIP3 expression and hypoxia-associated growth, which could be prevented by addition of the autophagy inhibitor chloroquine.	Chloroquine	196-207	BCL2 interacting protein 3	Homo sapiens	84-89
22329438-4	2012	RESULTS: We found that after stimulation with both histamine and chloroquine, fewer Fos-positive cells were present in mice treated with bombesin-saporin compared with those treated with saporin alone.	Chloroquine	65-76	FBJ osteosarcoma oncogene	Mus musculus	84-87
22329438-5	2012	The reduction in Fos expression was greater with chloroquine than with histamine, and the distribution of Fos-positive cells was also different.	Chloroquine	49-60	FBJ osteosarcoma oncogene	Mus musculus	17-20
22367781-6	2012	Inhibition of panobinostat-induced autophagic flux by chloroquine markedly induced the accumulation of polyubiquitylated proteins and p62, caused synergistic cell death of MB-231 and SUM159PT cells, and inhibited mammosphere formation in MB-231 cells, compared with treatment with each agent alone.	Chloroquine	54-65	nucleoporin 62	Homo sapiens	134-137
22142888-0	2012	Akt and p53 are potential mediators of reduced mammary tumor growth by cloroquine and the mTOR inhibitor RAD001.	Chloroquine	71-81	AKT serine/threonine kinase 1	Homo sapiens	0-3
21161534-10	2012	Incidence of ADR-related DMARD withdrawal was maximum with leflunomide 2/15 (13.33%) followed by methotrexate 9/116 (7.76%), sulphasalazine 6/185 (3.24%), chloroquine 3/131 (2.29%) and hydroxychloroquine 8/444 (1.8%).	Chloroquine	155-166	aldo-keto reductase family 1 member B	Homo sapiens	13-16
22142888-11	2012	The Chloroquine effect of overcoming the RAD001-induced activation of the oncogene Akt, as well as the promising antitumor activity in our mammary tumor animal model present Chloroquine as an interesting combination partner for the mTOR-inhibitor RAD001.	Chloroquine	174-185	mechanistic target of rapamycin kinase	Homo sapiens	232-236
22703694-0	2012	Decrease in circulating DNA, IL-10 and BAFF levels in newly-diagnosed SLE patients after corticosteroid and chloroquine treatment.	Chloroquine	108-119	TNF superfamily member 13b	Homo sapiens	39-43
22703694-4	2012	This activation could be abolished with chloroquine, a drug used in SLE treatment that also blocks TLR9 signaling.	Chloroquine	40-51	toll like receptor 9	Homo sapiens	99-103
22703694-9	2012	Also, corticosteroids decreased and chloroquine completely abolished CpG-mediated CD86 upregulation on B cells and IL-10 secretion in PBMC culture.	Chloroquine	36-47	interleukin 10	Homo sapiens	115-120
22142888-0	2012	Akt and p53 are potential mediators of reduced mammary tumor growth by cloroquine and the mTOR inhibitor RAD001.	Chloroquine	71-81	tumor protein p53	Homo sapiens	8-11
22142888-4	2012	We previously showed that the anti-malarial Chloroquine, a 4-alkylamino substituted quinoline, is a p53 activator and reduced the incidence of breast tumors in animal models.	Chloroquine	44-55	tumor protein p53	Homo sapiens	100-103
22142888-6	2012	Therefore, our aim was to test, if Chloroquine could inhibit tumor growth and prevent RAD001-induced Akt activation.	Chloroquine	35-46	AKT serine/threonine kinase 1	Homo sapiens	101-104
22142888-9	2012	Chloroquine and RAD001 inhibited phosphorylation of mTOR and its downstream target, S6K1.	Chloroquine	0-11	mechanistic target of rapamycin kinase	Homo sapiens	52-56
22142888-9	2012	Chloroquine and RAD001 inhibited phosphorylation of mTOR and its downstream target, S6K1.	Chloroquine	0-11	ribosomal protein S6 kinase B1	Homo sapiens	84-88
22142888-10	2012	Furthermore, Chloroquine was able to block the RAD001-induced phosphorylation of Akt serine 473.	Chloroquine	13-24	AKT serine/threonine kinase 1	Homo sapiens	81-84
22142888-11	2012	The Chloroquine effect of overcoming the RAD001-induced activation of the oncogene Akt, as well as the promising antitumor activity in our mammary tumor animal model present Chloroquine as an interesting combination partner for the mTOR-inhibitor RAD001.	Chloroquine	174-185	AKT serine/threonine kinase 1	Homo sapiens	83-86
22147702-0	2012	A novel role for alpha-tocopherol transfer protein (alpha-TTP) in protecting against chloroquine toxicity.	Chloroquine	85-96	alpha tocopherol transfer protein	Rattus norvegicus	17-50
22240589-5	2012	Levels of p18-CycE, which was generated by proteolytic cleavage of endogenous Cyclin E, were greatly increased by chloroquine and correlated with LC 3II conversion.	Chloroquine	114-125	H3 histone pseudogene 12	Homo sapiens	10-13
22252008-7	2012	Surprisingly, however, in these experiments CQ sensitization occurred independent of autophagy inhibition, since sensitization was not mimicked by Atg12, Beclin 1 knockdown or bafilomycin treatment, and occurred even in the absence of Atg12.	Chloroquine	44-46	autophagy related 12	Mus musculus	235-240
22147702-9	2012	In contrast to bafilomycin A1 treatment, which prevents CQ accumulation in cells by raising the pH of acidic organelles, alpha-TTP expression prevented CQ accumulation without affecting the pH of acidic organelles.	Chloroquine	152-154	alpha tocopherol transfer protein	Rattus norvegicus	121-130
22147702-10	2012	Taken together, our data suggest that alpha-TTP protects against CQ toxicity by preventing CQ accumulation in acidic organelles through a mechanism distinct from vitamin E transport.	Chloroquine	65-67	alpha tocopherol transfer protein	Rattus norvegicus	38-47
22147702-0	2012	A novel role for alpha-tocopherol transfer protein (alpha-TTP) in protecting against chloroquine toxicity.	Chloroquine	85-96	alpha tocopherol transfer protein	Rattus norvegicus	52-61
22147702-10	2012	Taken together, our data suggest that alpha-TTP protects against CQ toxicity by preventing CQ accumulation in acidic organelles through a mechanism distinct from vitamin E transport.	Chloroquine	91-93	alpha tocopherol transfer protein	Rattus norvegicus	38-47
22147702-4	2012	We reported previously that CQ treatment caused alpha-tocopherol transfer protein (alpha-TTP), a gene product of familial vitamin E deficiency, to change its location from the cytosol to the surface of acidic organelles.	Chloroquine	28-30	alpha tocopherol transfer protein	Rattus norvegicus	48-81
22147702-4	2012	We reported previously that CQ treatment caused alpha-tocopherol transfer protein (alpha-TTP), a gene product of familial vitamin E deficiency, to change its location from the cytosol to the surface of acidic organelles.	Chloroquine	28-30	alpha tocopherol transfer protein	Rattus norvegicus	83-92
22147702-5	2012	Here we show that alpha-TTP plays a novel role in protecting against CQ toxicity both in vitro and in vivo.	Chloroquine	69-71	alpha tocopherol transfer protein	Rattus norvegicus	18-27
22147702-6	2012	In the presence of CQ, rat hepatoma McARH7777 cells, which do not express alpha-TTP endogenously, showed more severe cytotoxicity, such as larger vacuolation of acidic organelles and caspase activation, than alpha-TTP transfectant cells.	Chloroquine	19-21	alpha tocopherol transfer protein	Rattus norvegicus	208-217
22147702-7	2012	Similarly, alpha-TTP knockout mice showed more severe CQ toxicity, such as hepatotoxicity and retinopathy, than wild-type mice.	Chloroquine	54-56	tocopherol (alpha) transfer protein	Mus musculus	11-20
21864242-2	2012	PURPOSE: Chloroquine has demonstrated high affinity for aldehyde dehydrogenase 1A1 (ALDH1), an enzyme expressed in the highly tumorigenic CD133+ brain tumor initiating subpopulation.	Chloroquine	9-20	aldehyde dehydrogenase family 1, subfamily A1	Mus musculus	56-82
21864242-2	2012	PURPOSE: Chloroquine has demonstrated high affinity for aldehyde dehydrogenase 1A1 (ALDH1), an enzyme expressed in the highly tumorigenic CD133+ brain tumor initiating subpopulation.	Chloroquine	9-20	aldehyde dehydrogenase family 1, subfamily A1	Mus musculus	84-89
21864242-2	2012	PURPOSE: Chloroquine has demonstrated high affinity for aldehyde dehydrogenase 1A1 (ALDH1), an enzyme expressed in the highly tumorigenic CD133+ brain tumor initiating subpopulation.	Chloroquine	9-20	prominin 1	Mus musculus	138-143
21691053-8	2012	Endosomal TLR3 inhibition by chloroquine dose-dependently inhibited dsRNA-induced TSLP generation and reduced generation of CXCL8, TNF-alpha, and IFN-beta.	Chloroquine	29-40	toll like receptor 3	Homo sapiens	10-14
22621736-8	2012	Drugs that regulate GADD45alpha and Topoisomerase IIalpha (e.g., ethyl methanesulfomate, amsacrine and chloroquine) were shown to increase ultrasound-mediated transfection efficiency by up to 2 fold.	Chloroquine	103-114	growth arrest and DNA damage inducible alpha	Homo sapiens	20-31
21691053-8	2012	Endosomal TLR3 inhibition by chloroquine dose-dependently inhibited dsRNA-induced TSLP generation and reduced generation of CXCL8, TNF-alpha, and IFN-beta.	Chloroquine	29-40	thymic stromal lymphopoietin	Homo sapiens	82-86
21691053-8	2012	Endosomal TLR3 inhibition by chloroquine dose-dependently inhibited dsRNA-induced TSLP generation and reduced generation of CXCL8, TNF-alpha, and IFN-beta.	Chloroquine	29-40	C-X-C motif chemokine ligand 8	Homo sapiens	124-129
21691053-8	2012	Endosomal TLR3 inhibition by chloroquine dose-dependently inhibited dsRNA-induced TSLP generation and reduced generation of CXCL8, TNF-alpha, and IFN-beta.	Chloroquine	29-40	tumor necrosis factor	Homo sapiens	131-140
21691053-8	2012	Endosomal TLR3 inhibition by chloroquine dose-dependently inhibited dsRNA-induced TSLP generation and reduced generation of CXCL8, TNF-alpha, and IFN-beta.	Chloroquine	29-40	interferon beta 1	Homo sapiens	146-154
23091617-0	2012	Chloroquine or chloroquine-PI3K/Akt pathway inhibitor combinations strongly promote gamma-irradiation-induced cell death in primary stem-like glioma cells.	Chloroquine	15-26	AKT serine/threonine kinase 1	Homo sapiens	32-35
22044588-9	2012	Inhibition of mitophagy using chloroquine in p53(-/-) or TIGAR(-/-) mice exacerbated accumulation of damaged mitochondria to the level of wild-type mice and attenuated cardioprotective action.	Chloroquine	30-41	transformation related protein 53, pseudogene	Mus musculus	45-48
23209439-5	2012	Using genome-wide GGSL and DS screens, we then found that a thi7Delta mutation confers severe growth defect in the thi3Delta mutant and that THI7 overexpression suppresses CQ-hypersensitivity of this mutant.	Chloroquine	172-174	thiamine transporter THI7	Saccharomyces cerevisiae S288C	141-145
23209439-6	2012	We subsequently showed that CQ inhibits the functions of Thi7 and its homologues Nrt1 and Thi72.	Chloroquine	28-30	thiamine transporter THI7	Saccharomyces cerevisiae S288C	57-61
23209439-6	2012	We subsequently showed that CQ inhibits the functions of Thi7 and its homologues Nrt1 and Thi72.	Chloroquine	28-30	nicotinamide riboside transporter	Saccharomyces cerevisiae S288C	81-85
23209439-6	2012	We subsequently showed that CQ inhibits the functions of Thi7 and its homologues Nrt1 and Thi72.	Chloroquine	28-30	thiamine transporter	Saccharomyces cerevisiae S288C	90-95
23209439-7	2012	In particular, the transporter activity of wild-type Thi7 but not a CQ-resistant mutant (Thi7(T287N)) was completely inhibited by the drug.	Chloroquine	68-70	thiamine transporter THI7	Saccharomyces cerevisiae S288C	53-57
23209439-9	2012	In addition, CQ completely inhibited a human thiamine transporter (SLC19A3) expressed in yeast and significantly inhibited thiamine uptake in cultured human cell lines.	Chloroquine	13-15	solute carrier family 19 member 3	Homo sapiens	67-74
21964832-7	2012	To verify the regulatory mechanism of p53 protein expression, we investigated             the effects of proteasomal inhibitors (ALLN and MG132) or a lysosomal inhibitor             (chloroquine) on TPA-induced down-regulation of p53.	Chloroquine	183-194	plasminogen activator, tissue type	Homo sapiens	199-202
21964832-7	2012	To verify the regulatory mechanism of p53 protein expression, we investigated             the effects of proteasomal inhibitors (ALLN and MG132) or a lysosomal inhibitor             (chloroquine) on TPA-induced down-regulation of p53.	Chloroquine	183-194	tumor protein p53	Homo sapiens	230-233
23082110-7	2012	GSK3beta inhibition was significantly increased after chloroquine treatment, both in lithium and non-lithium treated PbA-infected mice.	Chloroquine	54-65	glycogen synthase kinase 3 beta	Mus musculus	0-8
23028818-9	2012	However, GGA null flies are hypersensitive to dietary chloroquine and to starvation, implicating GGA in lysosomal function and autophagy.	Chloroquine	54-65	Golgi-localized, gamma-adaptin ear containing, ARF binding protein	Drosophila melanogaster	9-12
23056634-7	2012	Resistance to BLyS-gel could be overcome by treatment with the endosomotropic drug chloroquine, suggesting BLyS-gel may become trapped within endosomal/lysosomal compartments in resistant cells.	Chloroquine	83-94	TNF superfamily member 13b	Homo sapiens	14-18
23056634-7	2012	Resistance to BLyS-gel could be overcome by treatment with the endosomotropic drug chloroquine, suggesting BLyS-gel may become trapped within endosomal/lysosomal compartments in resistant cells.	Chloroquine	83-94	TNF superfamily member 13b	Homo sapiens	107-111
22393418-6	2012	The autophagy inhibitor chloroquine (CQ) significantly inhibited bortezomib-induced I-kappaBalpha degradation, increased complex formation with NF-kappaB and reduced NF-kappaB nuclear translocation and DNA binding activity.	Chloroquine	24-35	NFKB inhibitor alpha	Homo sapiens	84-97
22606294-8	2012	Induction of IFN-alpha in pDCs by myxoma virus or Heat-VAC is blocked by chloroquine, which inhibits endosomal acidification required for TLR7/9 signaling, and by inhibitors of cellular kinases PI3K and Akt.	Chloroquine	73-84	interferon alpha 1	Homo sapiens	13-16
22606294-8	2012	Induction of IFN-alpha in pDCs by myxoma virus or Heat-VAC is blocked by chloroquine, which inhibits endosomal acidification required for TLR7/9 signaling, and by inhibitors of cellular kinases PI3K and Akt.	Chloroquine	73-84	toll-like receptor 7	Mus musculus	138-142
22393418-6	2012	The autophagy inhibitor chloroquine (CQ) significantly inhibited bortezomib-induced I-kappaBalpha degradation, increased complex formation with NF-kappaB and reduced NF-kappaB nuclear translocation and DNA binding activity.	Chloroquine	24-35	nuclear factor kappa B subunit 1	Homo sapiens	144-153
22393418-6	2012	The autophagy inhibitor chloroquine (CQ) significantly inhibited bortezomib-induced I-kappaBalpha degradation, increased complex formation with NF-kappaB and reduced NF-kappaB nuclear translocation and DNA binding activity.	Chloroquine	24-35	nuclear factor kappa B subunit 1	Homo sapiens	166-175
22393418-6	2012	The autophagy inhibitor chloroquine (CQ) significantly inhibited bortezomib-induced I-kappaBalpha degradation, increased complex formation with NF-kappaB and reduced NF-kappaB nuclear translocation and DNA binding activity.	Chloroquine	37-39	NFKB inhibitor alpha	Homo sapiens	84-97
22393418-6	2012	The autophagy inhibitor chloroquine (CQ) significantly inhibited bortezomib-induced I-kappaBalpha degradation, increased complex formation with NF-kappaB and reduced NF-kappaB nuclear translocation and DNA binding activity.	Chloroquine	37-39	nuclear factor kappa B subunit 1	Homo sapiens	144-153
22393418-6	2012	The autophagy inhibitor chloroquine (CQ) significantly inhibited bortezomib-induced I-kappaBalpha degradation, increased complex formation with NF-kappaB and reduced NF-kappaB nuclear translocation and DNA binding activity.	Chloroquine	37-39	nuclear factor kappa B subunit 1	Homo sapiens	166-175
22127234-6	2011	shRNA-driven silencing of the ATG12 gene and disabling the final step in the autophagy pathway by the antimalarial drug chloroquine both prevented TGFb1-induced accumulation of vimentin in JIMT-1 cells.	Chloroquine	120-131	transforming growth factor beta 1	Homo sapiens	147-152
21998472-4	2011	The association analysis revealed that the human CYP2C8*2 variant, known to determine a poor drug metabolizer phenotype, was associated with P. falciparum chloroquine-resistant infections (OR, 1.66; 95% CI, 1.13-2.43; P = .008).	Chloroquine	155-166	cytochrome P450 family 2 subfamily C member 8	Homo sapiens	49-55
21937948-7	2011	These permeability changes are inhibited by chloroquine, suggesting TLR-9 dependency.	Chloroquine	44-55	toll like receptor 9	Homo sapiens	68-73
22319600-8	2012	Historically safe in humans, chloroquine and hydroxychloroquine appear to be promising agents to safely and effectively target CXCR4 in patients with pancreatic cancer.	Chloroquine	29-40	C-X-C motif chemokine receptor 4	Homo sapiens	127-132
22127234-6	2011	shRNA-driven silencing of the ATG12 gene and disabling the final step in the autophagy pathway by the antimalarial drug chloroquine both prevented TGFb1-induced accumulation of vimentin in JIMT-1 cells.	Chloroquine	120-131	vimentin	Homo sapiens	177-185
22127234-8	2011	Chloroquine treatment augmented the number of CD24(+) cells and concomitantly reduced constitutive overexpression of vimentin in MDA-MB-231 cells.	Chloroquine	0-11	CD24 molecule	Homo sapiens	46-50
22127234-8	2011	Chloroquine treatment augmented the number of CD24(+) cells and concomitantly reduced constitutive overexpression of vimentin in MDA-MB-231 cells.	Chloroquine	0-11	vimentin	Homo sapiens	117-125
22054021-0	2011	Analysis of the molecular interactions and complexation of chloroquine with bovine serum albumin.	Chloroquine	59-70	albumin	Homo sapiens	83-96
22027149-6	2011	Further, CQ (20 muM) in combination with I(2), showed apoptotic features such as increased sub-G1 fraction (~5-fold), expression of cleaved caspase-9 and -3 compared to I(2) treatment alone.	Chloroquine	9-11	latexin	Homo sapiens	16-19
22027149-6	2011	Further, CQ (20 muM) in combination with I(2), showed apoptotic features such as increased sub-G1 fraction (~5-fold), expression of cleaved caspase-9 and -3 compared to I(2) treatment alone.	Chloroquine	9-11	caspase 9	Homo sapiens	140-156
22027149-7	2011	Flowcytometry of I(2) and CQ co-treated cells revealed increase in mitochondrial membrane permeability (p&lt;0.01) and translocation of cathepsin D activity to cytosol relative to I(2) treatment.	Chloroquine	26-28	cathepsin D	Homo sapiens	136-147
22054021-2	2011	In this study, the binding properties as well as mechanisms of interaction of chloroquine with bovine serum albumin (BSA) were investigated.	Chloroquine	78-89	albumin	Homo sapiens	102-115
22054021-11	2011	The presence of stronger binding ligands, e.g., chloramphenicol, tetracyclines or diclofenac, can compete with chloroquine for its binding sites, and therefore lowers its serum albumin binding.	Chloroquine	111-122	albumin	Homo sapiens	171-184
21392514-5	2011	Following blockade of TLR9 receptors with oligonucleotide-inhibitor or chloroquine in the bystander cells these effects - except of activation of NORs - on exposure to ecDNA(R) disappeared, with no bystander response thus observed.	Chloroquine	71-82	toll like receptor 9	Homo sapiens	22-26
21883227-0	2011	Chloroquine inhibits glutamate-induced death of a neuronal cell line by reducing reactive oxygen species through sigma-1 receptor.	Chloroquine	0-11	sigma non-opioid intracellular receptor 1	Mus musculus	113-129
21883227-3	2011	However, chloroquine is reported to induce GM1 ganglioside accumulation in cultured cells at low muM concentrations and prevent damage to the blood brain barrier in mice.	Chloroquine	9-20	coenzyme Q10A	Mus musculus	43-46
21883227-7	2011	Chloroquine increased GM1 level in HT22 cells at low muM concentrations but glutamate-induced cell death occurred before GM1 accumulation, suggesting that GM1 induction is not related to the protective effect of chloroquine against glutamate-induced cell death.	Chloroquine	0-11	coenzyme Q10A	Mus musculus	22-25
21757691-5	2011	Treatment of normal fibroblasts with chloroquine to inhibit LAL activity reduced ABCA1 expression and activity, similar to that of CESD cells.	Chloroquine	37-48	lipase A, lysosomal acid type	Homo sapiens	60-63
21757691-5	2011	Treatment of normal fibroblasts with chloroquine to inhibit LAL activity reduced ABCA1 expression and activity, similar to that of CESD cells.	Chloroquine	37-48	ATP binding cassette subfamily A member 1	Homo sapiens	81-86
21660968-7	2011	Chloroquine, a lysosomal protease inhibitor, blocked the EGF-induced decrease in CLDN2 protein and caused the co-localization of CLDN2 with Lamp-1, a marker of lysosome.	Chloroquine	0-11	epidermal growth factor	Canis lupus familiaris	57-60
21660968-7	2011	Chloroquine, a lysosomal protease inhibitor, blocked the EGF-induced decrease in CLDN2 protein and caused the co-localization of CLDN2 with Lamp-1, a marker of lysosome.	Chloroquine	0-11	claudin 2	Canis lupus familiaris	81-86
21660968-7	2011	Chloroquine, a lysosomal protease inhibitor, blocked the EGF-induced decrease in CLDN2 protein and caused the co-localization of CLDN2 with Lamp-1, a marker of lysosome.	Chloroquine	0-11	claudin 2	Canis lupus familiaris	129-134
21660968-7	2011	Chloroquine, a lysosomal protease inhibitor, blocked the EGF-induced decrease in CLDN2 protein and caused the co-localization of CLDN2 with Lamp-1, a marker of lysosome.	Chloroquine	0-11	lysosomal associated membrane protein 1	Canis lupus familiaris	140-146
21730326-2	2011	We report that chloroquine promoted the transrepression of proinflammatory cytokines by the glucocorticoid receptor (GR).	Chloroquine	15-26	nuclear receptor subfamily 3, group C, member 1	Mus musculus	92-115
21730326-2	2011	We report that chloroquine promoted the transrepression of proinflammatory cytokines by the glucocorticoid receptor (GR).	Chloroquine	15-26	nuclear receptor subfamily 3, group C, member 1	Mus musculus	117-119
21730326-5	2011	Lysosomal inhibition by either bafilomycin A1 (an inhibitor of the vacuolar adenosine triphosphatase) or knockdown of transcription factor EB (TFEB, a master activator of lysosomal biogenesis) mimicked the effects of chloroquine.	Chloroquine	217-228	transcription factor EB	Mus musculus	143-147
21518836-3	2011	We hypothesized that organic cation transporter 2 (OCT2) and multidrug and toxin extrusion protein 1 (MATE1), localized in the basolateral and luminal membranes of proximal tubule cells, respectively, are involved in chloroquine transport.	Chloroquine	217-228	solute carrier family 22 member 2	Canis lupus familiaris	21-49
21518836-3	2011	We hypothesized that organic cation transporter 2 (OCT2) and multidrug and toxin extrusion protein 1 (MATE1), localized in the basolateral and luminal membranes of proximal tubule cells, respectively, are involved in chloroquine transport.	Chloroquine	217-228	solute carrier family 22 member 2	Canis lupus familiaris	51-55
21518836-3	2011	We hypothesized that organic cation transporter 2 (OCT2) and multidrug and toxin extrusion protein 1 (MATE1), localized in the basolateral and luminal membranes of proximal tubule cells, respectively, are involved in chloroquine transport.	Chloroquine	217-228	solute carrier family 47 member 1	Canis lupus familiaris	61-100
21518836-3	2011	We hypothesized that organic cation transporter 2 (OCT2) and multidrug and toxin extrusion protein 1 (MATE1), localized in the basolateral and luminal membranes of proximal tubule cells, respectively, are involved in chloroquine transport.	Chloroquine	217-228	solute carrier family 47 member 1	Canis lupus familiaris	102-107
21518836-4	2011	The interaction of chloroquine with both transporters was investigated using single-transfected human embryonic kidney 293 (HEK293)-MATE1 cells in uptake experiments and single-transfected Madin-Darby canine kidney II (MDCK)-OCT2 and MDCK-MATE1 cells as well as double-transfected MDCK-OCT2-MATE1 cells grown as polarized monolayers on transwell filters.	Chloroquine	19-30	solute carrier family 22 member 2	Canis lupus familiaris	225-229
21518836-4	2011	The interaction of chloroquine with both transporters was investigated using single-transfected human embryonic kidney 293 (HEK293)-MATE1 cells in uptake experiments and single-transfected Madin-Darby canine kidney II (MDCK)-OCT2 and MDCK-MATE1 cells as well as double-transfected MDCK-OCT2-MATE1 cells grown as polarized monolayers on transwell filters.	Chloroquine	19-30	solute carrier family 47 member 1	Canis lupus familiaris	239-244
21518836-4	2011	The interaction of chloroquine with both transporters was investigated using single-transfected human embryonic kidney 293 (HEK293)-MATE1 cells in uptake experiments and single-transfected Madin-Darby canine kidney II (MDCK)-OCT2 and MDCK-MATE1 cells as well as double-transfected MDCK-OCT2-MATE1 cells grown as polarized monolayers on transwell filters.	Chloroquine	19-30	solute carrier family 22 member 2	Canis lupus familiaris	286-290
21518836-4	2011	The interaction of chloroquine with both transporters was investigated using single-transfected human embryonic kidney 293 (HEK293)-MATE1 cells in uptake experiments and single-transfected Madin-Darby canine kidney II (MDCK)-OCT2 and MDCK-MATE1 cells as well as double-transfected MDCK-OCT2-MATE1 cells grown as polarized monolayers on transwell filters.	Chloroquine	19-30	solute carrier family 47 member 1	Canis lupus familiaris	239-244
21518836-5	2011	In HEK293-MATE1 cells, chloroquine competitively inhibited MATE1-mediated metformin uptake (K(i) = 2.8 muM).	Chloroquine	23-34	solute carrier family 47 member 1	Canis lupus familiaris	10-15
21518836-5	2011	In HEK293-MATE1 cells, chloroquine competitively inhibited MATE1-mediated metformin uptake (K(i) = 2.8 muM).	Chloroquine	23-34	solute carrier family 47 member 1	Canis lupus familiaris	59-64
21883227-8	2011	Interestingly, BD1047 and NE-100, sigma-1 receptor antagonists, abrogated the protective effect of chloroquine against glutamate-induced cell death and reactive oxygen species production.	Chloroquine	99-110	sigma non-opioid intracellular receptor 1	Mus musculus	34-50
21830746-1	2011	BACKGROUND AND OBJECTIVE: To determine the effectiveness of spectral-domain optical coherence tomography (SD-OCT) as a screening tool for the evaluation of chloroquine or hydroxychloroquine retinal toxicity.	Chloroquine	156-167	plexin A2	Homo sapiens	109-112
21959046-8	2011	CQ sensitized A549 cells to TPT and enhanced TPT-induced apoptosis in a Bcl-2 family protein-independent fashion.	Chloroquine	0-2	BCL2 apoptosis regulator	Homo sapiens	72-77
21518836-6	2011	Cellular accumulation of chloroquine was significantly lower (P &lt; 0.001) and transcellular chloroquine transport was significantly increased (P &lt; 0.001) in MDCK-MATE1 and MDCK-OCT2-MATE1 cells compared to vector control cells after basal addition of chloroquine (0.1 to 10 muM).	Chloroquine	25-36	solute carrier family 47 member 1	Canis lupus familiaris	167-172
21518836-6	2011	Cellular accumulation of chloroquine was significantly lower (P &lt; 0.001) and transcellular chloroquine transport was significantly increased (P &lt; 0.001) in MDCK-MATE1 and MDCK-OCT2-MATE1 cells compared to vector control cells after basal addition of chloroquine (0.1 to 10 muM).	Chloroquine	25-36	solute carrier family 22 member 2	Canis lupus familiaris	177-186
21518836-6	2011	Cellular accumulation of chloroquine was significantly lower (P &lt; 0.001) and transcellular chloroquine transport was significantly increased (P &lt; 0.001) in MDCK-MATE1 and MDCK-OCT2-MATE1 cells compared to vector control cells after basal addition of chloroquine (0.1 to 10 muM).	Chloroquine	94-105	solute carrier family 47 member 1	Canis lupus familiaris	167-172
21518836-6	2011	Cellular accumulation of chloroquine was significantly lower (P &lt; 0.001) and transcellular chloroquine transport was significantly increased (P &lt; 0.001) in MDCK-MATE1 and MDCK-OCT2-MATE1 cells compared to vector control cells after basal addition of chloroquine (0.1 to 10 muM).	Chloroquine	94-105	solute carrier family 22 member 2	Canis lupus familiaris	177-186
21518836-6	2011	Cellular accumulation of chloroquine was significantly lower (P &lt; 0.001) and transcellular chloroquine transport was significantly increased (P &lt; 0.001) in MDCK-MATE1 and MDCK-OCT2-MATE1 cells compared to vector control cells after basal addition of chloroquine (0.1 to 10 muM).	Chloroquine	94-105	solute carrier family 47 member 1	Canis lupus familiaris	187-192
21518836-6	2011	Cellular accumulation of chloroquine was significantly lower (P &lt; 0.001) and transcellular chloroquine transport was significantly increased (P &lt; 0.001) in MDCK-MATE1 and MDCK-OCT2-MATE1 cells compared to vector control cells after basal addition of chloroquine (0.1 to 10 muM).	Chloroquine	94-105	solute carrier family 47 member 1	Canis lupus familiaris	167-172
21518836-6	2011	Cellular accumulation of chloroquine was significantly lower (P &lt; 0.001) and transcellular chloroquine transport was significantly increased (P &lt; 0.001) in MDCK-MATE1 and MDCK-OCT2-MATE1 cells compared to vector control cells after basal addition of chloroquine (0.1 to 10 muM).	Chloroquine	94-105	solute carrier family 22 member 2	Canis lupus familiaris	177-186
21518836-6	2011	Cellular accumulation of chloroquine was significantly lower (P &lt; 0.001) and transcellular chloroquine transport was significantly increased (P &lt; 0.001) in MDCK-MATE1 and MDCK-OCT2-MATE1 cells compared to vector control cells after basal addition of chloroquine (0.1 to 10 muM).	Chloroquine	94-105	solute carrier family 47 member 1	Canis lupus familiaris	187-192
21518836-8	2011	In line with an oppositely directed proton gradient acting as a driving force for MATE1, basal-to-apical transport of chloroquine by MDCK-OCT2-MATE1 cells increased with decreasing apical pH from 7.8 to 6.0.	Chloroquine	118-129	solute carrier family 47 member 1	Canis lupus familiaris	82-87
21518836-8	2011	In line with an oppositely directed proton gradient acting as a driving force for MATE1, basal-to-apical transport of chloroquine by MDCK-OCT2-MATE1 cells increased with decreasing apical pH from 7.8 to 6.0.	Chloroquine	118-129	solute carrier family 22 member 2	Canis lupus familiaris	138-142
21518836-8	2011	In line with an oppositely directed proton gradient acting as a driving force for MATE1, basal-to-apical transport of chloroquine by MDCK-OCT2-MATE1 cells increased with decreasing apical pH from 7.8 to 6.0.	Chloroquine	118-129	solute carrier family 47 member 1	Canis lupus familiaris	143-148
21518836-9	2011	Transcellular transport of chloroquine by MDCK-OCT2-MATE1 cells was inhibited by cimetidine, trimethoprim, and amitriptyline.	Chloroquine	27-38	solute carrier family 22 member 2	Canis lupus familiaris	47-51
21518836-9	2011	Transcellular transport of chloroquine by MDCK-OCT2-MATE1 cells was inhibited by cimetidine, trimethoprim, and amitriptyline.	Chloroquine	27-38	solute carrier family 47 member 1	Canis lupus familiaris	52-57
21518836-10	2011	Our data demonstrate that chloroquine is a substrate and potent competitive inhibitor of MATE1, whereas OCT2 seems to play no role in chloroquine uptake.	Chloroquine	26-37	solute carrier family 47 member 1	Canis lupus familiaris	89-94
21518836-11	2011	Concomitantly administered MATE1 inhibitors are likely to modify the renal secretion of chloroquine.	Chloroquine	88-99	solute carrier family 47 member 1	Canis lupus familiaris	27-32
21805765-7	2011	Revision of the regime to weekly chloroquine alone following review of antimalarial policies increased compliance on OTX 2 to 67%.	Chloroquine	33-44	orthodenticle homeobox 2	Homo sapiens	117-122
21428909-4	2011	MMP-9 gene induction was sensitive toward treatment with the macrolide antibiotic bafilomycin A1, a vacuolar H(+)-ATPase inhibitor, and with the lysosomotropic agent chloroquine.	Chloroquine	166-177	matrix metallopeptidase 9	Homo sapiens	0-5
21266843-8	2011	Moreover, the clinical PtdIns3K-mTOR inhibitor NVP-BEZ235 cooperates with the clinical lysosomotropic autophagy inhibitor chloroquine to induce apoptosis in PTEN-mutant glioma xenografts in vivo, offering a therapeutic approach translatable to patients.	Chloroquine	122-133	phosphatase and tensin homolog	Homo sapiens	157-161
21460831-4	2011	MrgprA3 and MrgprC11 act as receptors for the pruritogens chloroquine and BAM8-22, respectively.	Chloroquine	58-69	MAS-related GPR, member A3	Mus musculus	0-7
21377771-3	2011	In contrast, in vitro antimalarial activity against the chloroquine-sensitive (3D7) strain of P. falciparum indicated relatively low activity when compared to controls such as chloroquine and quinine (IC50=0.0065 muM and 0.14 muM, respectively).	Chloroquine	56-67	latexin	Homo sapiens	213-216
21377771-3	2011	In contrast, in vitro antimalarial activity against the chloroquine-sensitive (3D7) strain of P. falciparum indicated relatively low activity when compared to controls such as chloroquine and quinine (IC50=0.0065 muM and 0.14 muM, respectively).	Chloroquine	56-67	latexin	Homo sapiens	226-229
21299716-4	2011	The latter effect of adiponectin in glucose deprivation was significantly inhibited by adding autophagy inhibitors, chloroquine, 3-methyl adenine or a combination of pepstatin A and E-64d, suggesting that the effect of supporting cell growth was dependent, at least in part, on the induction of autophagy.	Chloroquine	116-127	adiponectin, C1Q and collagen domain containing	Homo sapiens	21-32
21460831-4	2011	MrgprA3 and MrgprC11 act as receptors for the pruritogens chloroquine and BAM8-22, respectively.	Chloroquine	58-69	MAS-related GPR, member X1	Mus musculus	12-20
21460831-7	2011	TRPA1 is required for Mrgpr-mediated signaling, as sensory neurons from TRPA1-deficient mice exhibited markedly diminished responses to chloroquine and BAM8-22.	Chloroquine	136-147	transient receptor potential cation channel, subfamily A, member 1	Mus musculus	0-5
21460831-7	2011	TRPA1 is required for Mrgpr-mediated signaling, as sensory neurons from TRPA1-deficient mice exhibited markedly diminished responses to chloroquine and BAM8-22.	Chloroquine	136-147	transient receptor potential cation channel, subfamily A, member 1	Mus musculus	72-77
21233253-3	2011	We tested the hypothesis that chloroquine"s mode of interaction with the vestibule of the cytoplasmic domain of the inward rectifier potassium channel Kir2.1 makes it a more effective I(K1) blocker and anti-fibrillatory agent than quinidine.	Chloroquine	30-41	potassium inwardly rectifying channel subfamily J member 2	Homo sapiens	151-157
21216410-0	2011	Binding of chloroquine-conjugated gold nanoparticles with bovine serum albumin.	Chloroquine	11-22	albumin	Homo sapiens	65-78
21216410-1	2011	We have conjugated chloroquine, an anti-malarial, antiviral and anti-tumor drug, with thiol-functionalized gold nanoparticles and studied their binding interaction with bovine serum albumin (BSA) protein.	Chloroquine	19-30	albumin	Homo sapiens	176-189
21711726-6	2011	These are identified as chloroquine-dilated lysosomes and lipid bodies with LAMP-2 and LipidTOX co-localization, respectively.	Chloroquine	24-35	lysosomal associated membrane protein 2	Homo sapiens	76-82
21398612-4	2011	We discovered that chloroquine inhibits only activation of endosomal TLRs by nucleic acids, whereas it augments activation of TLR8 by a small synthetic compound, R848.	Chloroquine	19-30	toll like receptor 8	Homo sapiens	126-130
20552314-4	2011	NF and GFAP directed flow cytometry was able to identify several of the test chemicals as being specifically neurotoxic (chloroquine, nicotine) or astrocytoxic (atropine, chloramphenicol) via quantification of cell death in the NT2.N/A model at cytotoxic concentrations using the resazurin cytotoxicity assay.	Chloroquine	121-132	glial fibrillary acidic protein	Homo sapiens	7-11
21220429-9	2011	The proteasome inhibitor MG132 prevented the degradation of Ca(v) channels, whereas monodansylcadaverine and chloroquine partially antagonized the Nedd4-1-induced regulation of Ca(v) currents.	Chloroquine	109-120	NEDD4 E3 ubiquitin protein ligase	Homo sapiens	147-154
21233253-4	2011	METHODS AND RESULTS: We used comparative molecular modelling and ligand docking of the three-dimensional structures of quinidine and chloroquine in the intracellular domain of Kir2.1.	Chloroquine	133-144	potassium inwardly rectifying channel subfamily J member 2	Homo sapiens	176-182
21233253-5	2011	Simulations predicted that chloroquine effectively blocks potassium flow by binding at the centre of the ion permeation vestibule of Kir2.1.	Chloroquine	27-38	potassium inwardly rectifying channel subfamily J member 2	Homo sapiens	133-139
21233253-13	2011	Chloroquine binds at the centre of the ion permeation vestibule of Kir2.1, which makes it a more effective I(K1) blocker and anti-fibrillatory agent than quinidine.	Chloroquine	0-11	potassium inwardly rectifying channel subfamily J member 2	Homo sapiens	67-73
21300878-8	2011	Our data provide evidence supporting the hypothesis that there is a specific subset of TRPV1-expressing neurons that is equipped with diverse intracellular mechanisms that respond to histamine, chloroquine, and IQ.	Chloroquine	194-205	transient receptor potential cation channel, subfamily V, member 1	Mus musculus	87-92
21289198-5	2011	Furthermore, clinically used alkalizing drugs, including chloroquine, bepridil, and amiodarone, similarly stimulate GRN production.	Chloroquine	57-68	granulin precursor	Homo sapiens	116-119
21303546-11	2011	Treatment with the endosomolytic reagent chloroquine increased the cytotoxicity of CPE-E9-G4S-R9-rGel.	Chloroquine	41-52	cpe	Clostridium perfringens	83-86
20980833-7	2011	Autophagy inhibitors bafilomycin and chloroquine significantly increased the cytotoxicity of compound C towards U251 cells, as confirmed by increase in lactate dehydrogenase release, DNA fragmentation and caspase-3 activation.	Chloroquine	37-48	caspase 3	Homo sapiens	205-214
21051542-7	2011	In vitro, the inhibitors of lysosomal acidification (ammonium chloride, chloroquine) and of aquaporins (mercury chloride, phloretin) all significantly decreased the production of IL-1beta.	Chloroquine	72-83	interleukin 1 beta	Homo sapiens	179-187
21051542-8	2011	In vivo, only the pharmacological inhibitor of lysosome acidification chloroquine could be used which again significantly reduced the IL-1beta production.	Chloroquine	70-81	interleukin 1 beta	Homo sapiens	134-142
20959456-7	2010	Inhibition of the autophagy-lysosome pathway by 3-methyladenine or chloroquine accumulated Ser-129-phosphorylated a-Syn in parallel to total a-Syn during longer incubations.	Chloroquine	67-78	synemin	Homo sapiens	116-119
20850431-7	2011	Moreover, inhibiting lysosome function by treating cells with chloroquine exacerbated the migration defect in Cln3(-/-).	Chloroquine	62-73	ceroid lipofuscinosis, neuronal 3, juvenile (Batten, Spielmeyer-Vogt disease)	Mus musculus	110-114
21687598-3	2011	The determined IC(50) value for the chloroquine-susceptible Plasmodium falciparum NF54 strain was 68.26 mug/muL +- 3.5.	Chloroquine	36-47	tripartite motif-containing 37	Mus musculus	108-111
22140527-9	2011	In addition, we found that palmitate stimulates degradation of intracellular adiponectin by lysosomes, and the lysosomal inhibitor, chloroquine, suppressed the effect of palmitate on adiponectin release from adipocytes.	Chloroquine	132-143	adiponectin, C1Q and collagen domain containing	Mus musculus	183-194
20585026-3	2010	We hypothesize that the antimalarial quinoline chloroquine exerts potent antiarrhythmic effects by interacting with the cytoplasmic domains of Kir2.1 (I(K1)), Kir3.1 (I(KACh)), or Kir6.2 (I(KATP)) and reducing inward rectifier potassium currents.	Chloroquine	47-58	potassium inwardly rectifying channel subfamily J member 2	Homo sapiens	143-149
20585026-3	2010	We hypothesize that the antimalarial quinoline chloroquine exerts potent antiarrhythmic effects by interacting with the cytoplasmic domains of Kir2.1 (I(K1)), Kir3.1 (I(KACh)), or Kir6.2 (I(KATP)) and reducing inward rectifier potassium currents.	Chloroquine	47-58	potassium inwardly rectifying channel subfamily J member 3	Homo sapiens	159-165
20585026-3	2010	We hypothesize that the antimalarial quinoline chloroquine exerts potent antiarrhythmic effects by interacting with the cytoplasmic domains of Kir2.1 (I(K1)), Kir3.1 (I(KACh)), or Kir6.2 (I(KATP)) and reducing inward rectifier potassium currents.	Chloroquine	47-58	potassium inwardly rectifying channel subfamily J member 11	Homo sapiens	180-186
20858845-7	2010	The precise mechanism for RACK1-dependent expression of ABCG2 remains to be clarified, because the results of N-benzoyloxycarbonyl (Z)-Leu-Leu-leucinal (MG132) and chloroquine treatment and those of metabolic labeling experiments did not give us clear evidence whether the reduction of ABCG2 expression in RACK1-knocked down cells may be caused by the suppression of ABCG2 protein synthesis or by acceleration of its degradation.	Chloroquine	164-175	receptor for activated C kinase 1	Homo sapiens	26-31
20637870-4	2010	Under hypoxia, autophagy inhibition by 3-methyladenine or chloroquine significantly enhanced apoptosis and decreased cell viability in 4-HPR-exposed cells, indicating that autophagy prevents cancer cell death and presumably leads to hypoxia-induced resistance to 4-HPR.	Chloroquine	58-69	haptoglobin-related protein	Homo sapiens	137-140
20585026-6	2010	Comparative molecular modeling and ligand docking of chloroquine in the intracellular domains of Kir2.1, Kir3.1, and Kir6.2 suggested that chloroquine blocks or reduces potassium flow by interacting with negatively charged amino acids facing the ion permeation vestibule of the channel in question.	Chloroquine	53-64	potassium inwardly rectifying channel subfamily J member 2	Homo sapiens	97-103
20585026-6	2010	Comparative molecular modeling and ligand docking of chloroquine in the intracellular domains of Kir2.1, Kir3.1, and Kir6.2 suggested that chloroquine blocks or reduces potassium flow by interacting with negatively charged amino acids facing the ion permeation vestibule of the channel in question.	Chloroquine	53-64	potassium inwardly rectifying channel subfamily J member 3	Homo sapiens	105-111
20585026-6	2010	Comparative molecular modeling and ligand docking of chloroquine in the intracellular domains of Kir2.1, Kir3.1, and Kir6.2 suggested that chloroquine blocks or reduces potassium flow by interacting with negatively charged amino acids facing the ion permeation vestibule of the channel in question.	Chloroquine	53-64	potassium inwardly rectifying channel subfamily J member 11	Homo sapiens	117-123
20585026-6	2010	Comparative molecular modeling and ligand docking of chloroquine in the intracellular domains of Kir2.1, Kir3.1, and Kir6.2 suggested that chloroquine blocks or reduces potassium flow by interacting with negatively charged amino acids facing the ion permeation vestibule of the channel in question.	Chloroquine	139-150	potassium inwardly rectifying channel subfamily J member 2	Homo sapiens	97-103
20585026-6	2010	Comparative molecular modeling and ligand docking of chloroquine in the intracellular domains of Kir2.1, Kir3.1, and Kir6.2 suggested that chloroquine blocks or reduces potassium flow by interacting with negatively charged amino acids facing the ion permeation vestibule of the channel in question.	Chloroquine	139-150	potassium inwardly rectifying channel subfamily J member 3	Homo sapiens	105-111
20585026-6	2010	Comparative molecular modeling and ligand docking of chloroquine in the intracellular domains of Kir2.1, Kir3.1, and Kir6.2 suggested that chloroquine blocks or reduces potassium flow by interacting with negatively charged amino acids facing the ion permeation vestibule of the channel in question.	Chloroquine	139-150	potassium inwardly rectifying channel subfamily J member 11	Homo sapiens	117-123
20630104-12	2010	The potentiation of the inhibitory effect of 5-FU by CQ was dependent on the increase of p21Cip1 and p27Kip1 and the decrease of CDK2.	Chloroquine	53-55	cyclin dependent kinase inhibitor 1A	Homo sapiens	89-96
20713890-4	2010	Activation of TLR9 by viral DNA requires endosomal maturation because pretreatment of monocytes with chloroquine strongly reduced IL-8 secretion.	Chloroquine	101-112	toll like receptor 9	Homo sapiens	14-18
20713890-4	2010	Activation of TLR9 by viral DNA requires endosomal maturation because pretreatment of monocytes with chloroquine strongly reduced IL-8 secretion.	Chloroquine	101-112	C-X-C motif chemokine ligand 8	Homo sapiens	130-134
20713890-7	2010	Although EBV does not establish infection in pDCs, challenge with either live EBV particles or isolated EBV DNA was found to induce the release of IFN-alpha through TLR9, as supported by blockage of TLR9 activity with iODN or chloroquine.	Chloroquine	226-237	interferon alpha 1	Homo sapiens	147-156
20628022-5	2010	Oligodeoxynucleotide (ODN) 1826, a ligand of TLR9, significantly enhanced perilipin 3 expression in RAW264.7 cells, and chloroquine, a TLR9 inhibitor, almost completely inhibited ODN1826-induced perilipin 3 expression.	Chloroquine	120-131	toll-like receptor 9	Mus musculus	135-139
20628022-5	2010	Oligodeoxynucleotide (ODN) 1826, a ligand of TLR9, significantly enhanced perilipin 3 expression in RAW264.7 cells, and chloroquine, a TLR9 inhibitor, almost completely inhibited ODN1826-induced perilipin 3 expression.	Chloroquine	120-131	perilipin 3	Mus musculus	195-206
20855962-3	2010	Here, we show that hypoxia is sufficient to induce the autophagic degradation of Cav-1 in stromal fibroblasts, which is blocked by the lysosomal inhibitor chloroquine.	Chloroquine	155-166	caveolin 1	Homo sapiens	81-86
20386869-5	2010	Pharmacologically relevant doses of dexamethasone, gold sodium thiomalate and chloroquine inhibited the extracellular release of HMGB1 in a dose-dependent mode.	Chloroquine	78-89	high mobility group box 1	Homo sapiens	129-134
20386869-8	2010	TNF production in LPS/IFNgamma-activated monocytes was readily downregulated by dexamethasone and, to some extent, by chloroquine and etanercept.	Chloroquine	118-129	tumor necrosis factor	Homo sapiens	0-3
20386869-8	2010	TNF production in LPS/IFNgamma-activated monocytes was readily downregulated by dexamethasone and, to some extent, by chloroquine and etanercept.	Chloroquine	118-129	interferon gamma	Homo sapiens	22-30
20386869-9	2010	We conclude that dexamethasone, gold sodium thiomalate and chloroquine share a capacity to inhibit HMGB1 release from activated monocytes.	Chloroquine	59-70	high mobility group box 1	Homo sapiens	99-104
20706626-7	2010	In patients treated with CQ there was a trend toward a longer duration of DENV viraemia (hazard ratio (HR) = 0.80, 95% CI 0.62-1.05), but we did not find any difference for the time to resolution of NS1 antigenaemia (HR = 1.07, 95% CI 0.76-1.51).	Chloroquine	25-27	influenza virus NS1A binding protein	Homo sapiens	199-202
20544854-7	2010	Similar changes in Lamp1, LC3, and cathepsin-D were induced by the lysosomal inhibitors bafilomycin A1, chloroquine, and monensin, indicating that lysosomal dysfunction may lie upstream of changes observed in MT3-null astrocytes.	Chloroquine	104-115	lysosomal associated membrane protein 1	Homo sapiens	19-24
20544854-7	2010	Similar changes in Lamp1, LC3, and cathepsin-D were induced by the lysosomal inhibitors bafilomycin A1, chloroquine, and monensin, indicating that lysosomal dysfunction may lie upstream of changes observed in MT3-null astrocytes.	Chloroquine	104-115	microtubule associated protein 1 light chain 3 alpha	Homo sapiens	26-29
20544854-7	2010	Similar changes in Lamp1, LC3, and cathepsin-D were induced by the lysosomal inhibitors bafilomycin A1, chloroquine, and monensin, indicating that lysosomal dysfunction may lie upstream of changes observed in MT3-null astrocytes.	Chloroquine	104-115	cathepsin D	Homo sapiens	35-46
20534000-4	2010	Bafilomycin also attenuated the chloroquine-induced reduction in processing of cathepsin D, the principal lysosomal aspartic acid protease, to its mature "active" form.	Chloroquine	32-43	cathepsin D	Homo sapiens	79-90
20534000-5	2010	Chloroquine induced autophagic vacuole accumulation and inhibited autophagic flux, effects that were attenuated upon treatment with bafilomycin and were associated with a significant decrease in chloroquine-induced accumulation of detergent-insoluble alpha-synuclein oligomers.	Chloroquine	0-11	synuclein alpha	Homo sapiens	251-266
20534000-5	2010	Chloroquine induced autophagic vacuole accumulation and inhibited autophagic flux, effects that were attenuated upon treatment with bafilomycin and were associated with a significant decrease in chloroquine-induced accumulation of detergent-insoluble alpha-synuclein oligomers.	Chloroquine	195-206	synuclein alpha	Homo sapiens	251-266
20630104-12	2010	The potentiation of the inhibitory effect of 5-FU by CQ was dependent on the increase of p21Cip1 and p27Kip1 and the decrease of CDK2.	Chloroquine	53-55	cyclin dependent kinase inhibitor 1B	Homo sapiens	101-108
20630104-12	2010	The potentiation of the inhibitory effect of 5-FU by CQ was dependent on the increase of p21Cip1 and p27Kip1 and the decrease of CDK2.	Chloroquine	53-55	cyclin dependent kinase 2	Homo sapiens	129-133
20140691-7	2010	It is noticeable that serum IL-18 levels in the patients treated with glucocorticoids and cyclophosphamide was lower than those treated with glucocorticoids only or glucocorticoids and other immune inhibitors such as chloroquine/hydroxychloroquine and azathioprine.	Chloroquine	217-228	interleukin 18	Homo sapiens	28-33
20418542-6	2010	Finally, chemical disruption of the lysosomal function by feeding animals with antimalarial drugs, chloroquine or monensin, leads to malignant tumor growth of the Ras(V12) cells.	Chloroquine	99-110	Ras oncogene at 85D	Drosophila melanogaster	163-170
20570919-8	2010	Furthermore, the inhibition of intracellular acidification by treatment with bafilomycin A1 or chloroquine reproduced the phenotype observed for the (P)RR/ATP6AP2-deficient cardiomyocytes.	Chloroquine	95-106	ATPase, H+ transporting, lysosomal accessory protein 2	Mus musculus	155-162
20208057-8	2010	Chloroquine reduced plaque burden in mice wild-type for p53, but it did not decrease lesion extent in p53-null mice.	Chloroquine	0-11	transformation related protein 53, pseudogene	Mus musculus	56-59
20208057-9	2010	However, chloroquine improved glucose tolerance, enhanced insulin sensitivity, and increased hepatic Akt signaling regardless of the p53 genotype.	Chloroquine	9-20	insulin	Homo sapiens	58-65
20208057-0	2010	p53 is required for chloroquine-induced atheroprotection but not insulin sensitization.	Chloroquine	20-31	transformation related protein 53, pseudogene	Mus musculus	0-3
20208057-3	2010	The antimalarial drug chloroquine activates ATM signaling and improves metabolic phenotypes in mice.	Chloroquine	22-33	ataxia telangiectasia mutated	Mus musculus	44-47
20208057-10	2010	These results indicate that atheroprotection induced by chloroquine is p53-dependent but the insulin-sensitizing effects of this agent are not.	Chloroquine	56-67	transformation related protein 53, pseudogene	Mus musculus	71-74
20208057-5	2010	We tested the hypothesis that the cardiometabolic effects of chloroquine are p53-dependent.	Chloroquine	61-72	transformation related protein 53, pseudogene	Mus musculus	77-80
20498358-9	2010	Inhibition of the chTLR21 response by the endosomal maturation inhibitor chloroquine suggested that the receptor is functional in endolysosomes, as known for TLR9.	Chloroquine	73-84	toll like receptor 9	Homo sapiens	158-162
20406898-0	2010	Chloroquine-induced autophagic vacuole accumulation and cell death in glioma cells is p53 independent.	Chloroquine	0-11	tumor protein p53	Homo sapiens	86-89
20064914-4	2010	The aim of this study was to determine the effect of 3 months of chloroquine treatment on serum levels of MMP-9 and TIMP-1 in patients with systemic lupus erythematosus.	Chloroquine	65-76	matrix metallopeptidase 9	Homo sapiens	106-111
20064914-4	2010	The aim of this study was to determine the effect of 3 months of chloroquine treatment on serum levels of MMP-9 and TIMP-1 in patients with systemic lupus erythematosus.	Chloroquine	65-76	TIMP metallopeptidase inhibitor 1	Homo sapiens	116-122
20064914-9	2010	After chloroquine therapy the median MMP-9 serum level of systemic lupus erythematosus patients decreased significantly (43 ng/ml; p &lt; 0.001).	Chloroquine	6-17	matrix metallopeptidase 9	Homo sapiens	37-42
20208057-6	2010	ApoE-null mice with or without p53 were treated with low-dose chloroquine or saline in the setting of a Western diet.	Chloroquine	62-73	apolipoprotein E	Mus musculus	0-4
19997055-7	2010	Human PMNs were incubated in vitro with purified mtDNA or nuclear DNA, with or without pretreatment by chloroquine (an inhibitor of endosomal receptors like TLR9).	Chloroquine	103-114	toll like receptor 9	Homo sapiens	157-161
20562526-11	2010	Our findings also suggest that chloroquine, or other autophagy/lysosome inhibitors, may be useful as anti-cancer agents, to therapeutically restore the expression of stromal Cav-1 in cancer associated fibroblasts.	Chloroquine	31-42	caveolin 1	Homo sapiens	174-179
20392068-7	2010	Finally, MITF down-regulation by 1 was clearly restored by both chloroquine, a lysosomal proteolysis inhibitor, and MG132, a proteasome inhibitor.	Chloroquine	64-75	melanogenesis associated transcription factor	Mus musculus	9-13
20406898-4	2010	We and others have shown that CQ-mediated cell death may be p53-dependent and at least in part due to the intrinsic apoptotic death pathway.	Chloroquine	30-32	tumor protein p53	Homo sapiens	60-63
20406898-8	2010	Moreover, CQ caused an accumulation of autophagic vacuoles in all cell lines and was found to affect the levels and subcellular distribution of cathepsin D, suggesting that altered lysosomal function may also play a role in CQ-induced cell death.	Chloroquine	10-12	cathepsin D	Homo sapiens	144-155
20406898-9	2010	Thus, CQ can induce p53-independent death in gliomas that do not require caspase-mediated apoptosis.	Chloroquine	6-8	tumor protein p53	Homo sapiens	20-23
20159975-7	2010	Furthermore, colocalization with LAMP-2 and chloroquine-sensitive degradation of OATP2B1 suggest that the internalized protein is targeted to a lysosomal degradation pathway.	Chloroquine	44-55	solute carrier organic anion transporter family member 2B1	Homo sapiens	81-88
20331800-6	2010	Chloroquine treatment of THP-1 cells decreased cytokine production, suggesting that TLR9-mediated signaling pathways are operant in the recognition of DNA from periodontal pathogens.	Chloroquine	0-11	GLI family zinc finger 2	Homo sapiens	25-30
20332299-7	2010	Pretreatment with either the lysosomal inhibitor chloroquine or the proteosomal inhibitor MG132 blocked sulindac metabolite-induced downregulation of EGFR.	Chloroquine	49-60	epidermal growth factor receptor	Homo sapiens	150-154
20168091-5	2010	Presenilin-1 (PS1) expression was increased even in the presence of nutrients in autophagy-related 5 knockdown (Atg5KD) human embryonic kidney (HE K293) cells expressing a short hairpin RNA as well as in chloroquine-treated HE K293 cells.	Chloroquine	204-215	presenilin 1	Homo sapiens	0-12
20168091-5	2010	Presenilin-1 (PS1) expression was increased even in the presence of nutrients in autophagy-related 5 knockdown (Atg5KD) human embryonic kidney (HE K293) cells expressing a short hairpin RNA as well as in chloroquine-treated HE K293 cells.	Chloroquine	204-215	presenilin 1	Homo sapiens	14-17
19165421-1	2010	PURPOSE: To describe the efficacy of microperimetry (MP-1) in detecting early retinal toxicity as a result of chronic use of chloroquine and in monitoring the changes in macular sensitivity in an asymptomatic patient with best-corrected visual acuity of 20/20 bilaterally.	Chloroquine	125-136	pitrilysin metallopeptidase 1	Homo sapiens	53-57
19165421-6	2010	CONCLUSIONS: Chloroquine retinal toxicity can be recognized in a subclincal form by the presence of early changes in macular sensitivity, detected by MP-1.	Chloroquine	13-24	pitrilysin metallopeptidase 1	Homo sapiens	150-154
20331800-6	2010	Chloroquine treatment of THP-1 cells decreased cytokine production, suggesting that TLR9-mediated signaling pathways are operant in the recognition of DNA from periodontal pathogens.	Chloroquine	0-11	toll like receptor 9	Homo sapiens	84-88
20034811-8	2010	Moreover, IL-1RI downregulation was prevented by lysosome inhibitors, chloroquine and ammonium chloride, but not by proteasome inhibitors, MG132 and lactacystin.	Chloroquine	70-81	interleukin 1 receptor type 1	Homo sapiens	10-16
20308316-0	2010	Chloroquine activates the p53 pathway and induces apoptosis in human glioma cells.	Chloroquine	0-11	tumor protein p53	Homo sapiens	26-29
20308316-4	2010	We show that the quinoline derivative chloroquine activates the p53 pathway and suppresses growth of glioma cells in vitro and in vivo in an orthotopic (U87MG) human glioblastoma mouse model.	Chloroquine	38-49	tumor protein p53	Homo sapiens	64-67
20308316-6	2010	siRNA-mediated downregulation of p53 in wild-type but not mutant p53 glioblastoma cells substantially impaired chloroquine-induced apoptosis.	Chloroquine	111-122	tumor protein p53	Homo sapiens	33-36
20308316-7	2010	In addition to its p53-activating effects, chloroquine may also inhibit glioma cell growth via p53-independent mechanisms.	Chloroquine	43-54	tumor protein p53	Homo sapiens	95-98
20043183-3	2010	Catestatin inhibits growth of the chloroquine-sensitive strain of P. falciparum 3D7, exhibiting 88% inhibition at 20 microM.	Chloroquine	34-45	chromogranin A	Homo sapiens	0-10
20175992-1	2010	Selective binding of the wild type tumor suppressor protein p53 to negatively and positively supercoiled (sc) DNA was studied using intercalative drugs chloroquine (CQ), ethidium bromide, acridine derivatives and doxorubicin as a modulators of the level of DNA supercoiling.	Chloroquine	152-163	tumor protein p53	Homo sapiens	60-63
20175992-1	2010	Selective binding of the wild type tumor suppressor protein p53 to negatively and positively supercoiled (sc) DNA was studied using intercalative drugs chloroquine (CQ), ethidium bromide, acridine derivatives and doxorubicin as a modulators of the level of DNA supercoiling.	Chloroquine	165-167	tumor protein p53	Homo sapiens	60-63
19949061-4	2010	Blocking of IFN-alpha production using chloroquine, an endosomal inhibitor, was tested in a novel in vitro model system with the aim of characterizing the effects of chloroquine on HIV-1-mediated TLR signaling, IFN-alpha production, and T-cell activation.	Chloroquine	39-50	interferon alpha 1	Homo sapiens	12-21
20089705-4	2010	Dependence on TLR was supported by the significant inhibition of TNF-alpha release by IRS661 and chloroquine.	Chloroquine	97-108	tumor necrosis factor	Homo sapiens	65-74
19949061-7	2010	In addition to blocking pDC activation, chloroquine also blocked negative modulators of the T-cell response, such as indoleamine 2,3-dioxygenase (IDO) and programmed death ligand 1 (PDL-1).	Chloroquine	40-51	CD274 molecule	Homo sapiens	155-180
19949061-7	2010	In addition to blocking pDC activation, chloroquine also blocked negative modulators of the T-cell response, such as indoleamine 2,3-dioxygenase (IDO) and programmed death ligand 1 (PDL-1).	Chloroquine	40-51	CD274 molecule	Homo sapiens	182-187
19949061-5	2010	Our results indicate that chloroquine blocks TLR-mediated activation of pDC and MyD88 signaling, as shown by decreases in the levels of the downstream signaling molecules IRAK-4 and IRF-7 and by inhibition of IFN-alpha synthesis.	Chloroquine	26-37	MYD88 innate immune signal transduction adaptor	Homo sapiens	80-85
19949061-8	2010	Our results indicate that TLR stimulation and production of IFN-alpha by pDC contribute to immune activation and that blocking of these pathways using chloroquine may interfere with events contributing to HIV pathogenesis.	Chloroquine	151-162	interferon alpha 1	Homo sapiens	60-69
19949061-5	2010	Our results indicate that chloroquine blocks TLR-mediated activation of pDC and MyD88 signaling, as shown by decreases in the levels of the downstream signaling molecules IRAK-4 and IRF-7 and by inhibition of IFN-alpha synthesis.	Chloroquine	26-37	interleukin 1 receptor associated kinase 4	Homo sapiens	171-177
19949061-5	2010	Our results indicate that chloroquine blocks TLR-mediated activation of pDC and MyD88 signaling, as shown by decreases in the levels of the downstream signaling molecules IRAK-4 and IRF-7 and by inhibition of IFN-alpha synthesis.	Chloroquine	26-37	interferon regulatory factor 7	Homo sapiens	182-187
19949061-5	2010	Our results indicate that chloroquine blocks TLR-mediated activation of pDC and MyD88 signaling, as shown by decreases in the levels of the downstream signaling molecules IRAK-4 and IRF-7 and by inhibition of IFN-alpha synthesis.	Chloroquine	26-37	interferon alpha 1	Homo sapiens	209-218
19949061-7	2010	In addition to blocking pDC activation, chloroquine also blocked negative modulators of the T-cell response, such as indoleamine 2,3-dioxygenase (IDO) and programmed death ligand 1 (PDL-1).	Chloroquine	40-51	indoleamine 2,3-dioxygenase 1	Homo sapiens	117-144
19949061-7	2010	In addition to blocking pDC activation, chloroquine also blocked negative modulators of the T-cell response, such as indoleamine 2,3-dioxygenase (IDO) and programmed death ligand 1 (PDL-1).	Chloroquine	40-51	indoleamine 2,3-dioxygenase 1	Homo sapiens	146-149
19945197-2	2010	The result showed that the combination of certain chloroquine analogs and Akt inhibitors are highly effective.	Chloroquine	50-61	AKT serine/threonine kinase 1	Homo sapiens	74-77
19825389-14	2010	Only poly I:C-induced IFN2 transcription was significantly suppressed in the presence of chloroquine, a compound known to block endosomal acidification and inhibit endosomal maturation.	Chloroquine	89-100	type I interferon 2	Oncorhynchus mykiss	22-26
19945197-4	2010	Importantly, the enhancement of chloroquine analogs 5 on cell killing by Akt inhibitors 8 and 9 was cancer-specific.	Chloroquine	32-43	AKT serine/threonine kinase 1	Homo sapiens	73-76
19945197-6	2010	Structural analysis of effective and ineffective chloroquine analogs suggests that the 4-aminoquinoline scaffold and lateral side chain of dimethylamino functionality play an important role for the enhancement of cell killing by Akt inhibitors.	Chloroquine	49-60	AKT serine/threonine kinase 1	Homo sapiens	229-232
20017940-0	2009	Chloroquine reduces arylsulphatase B activity and increases chondroitin-4-sulphate: implications for mechanisms of action and resistance.	Chloroquine	0-11	arylsulfatase B	Homo sapiens	20-36
20502009-7	2010	Mechanistically, this degradation occurred through a lysosomal pathway and involved cathepsin B since the general lysosomal inhibitor chloroquine and the specific cathepsin B inhibitor CA-074ME were able to reverse the effect of SKI II.	Chloroquine	134-145	cathepsin B	Homo sapiens	84-95
20064368-3	2009	(2009) now report that some members of the Mrgpr class of G protein-coupled receptors mediate the itch caused by the antimalarial drug chloroquine.	Chloroquine	135-146	itchy E3 ubiquitin protein ligase	Homo sapiens	98-102
19760134-11	2010	Furthermore, combination treatment of chloroquine to IFNalpha enhanced the antiviral effect of IFNalpha and prevented re-propagation of HCV replicon.	Chloroquine	38-49	interferon alpha 1	Homo sapiens	53-61
19760134-11	2010	Furthermore, combination treatment of chloroquine to IFNalpha enhanced the antiviral effect of IFNalpha and prevented re-propagation of HCV replicon.	Chloroquine	38-49	interferon alpha 1	Homo sapiens	95-103
20004959-0	2009	Sensory neuron-specific GPCR Mrgprs are itch receptors mediating chloroquine-induced pruritus.	Chloroquine	65-76	itchy, E3 ubiquitin protein ligase	Mus musculus	40-44
20004959-2	2009	Itch induced by chloroquine (CQ) is a common side effect of this widely used antimalarial drug.	Chloroquine	16-27	itchy, E3 ubiquitin protein ligase	Mus musculus	0-4
20004959-2	2009	Itch induced by chloroquine (CQ) is a common side effect of this widely used antimalarial drug.	Chloroquine	29-31	itchy, E3 ubiquitin protein ligase	Mus musculus	0-4
20004959-4	2009	Mice lacking a cluster of Mrgpr genes display significant deficits in itch induced by CQ but not histamine.	Chloroquine	86-88	itchy, E3 ubiquitin protein ligase	Mus musculus	70-74
20004959-6	2009	CQ specifically activates mouse MrgprA3 and human MrgprX1.	Chloroquine	0-2	MAS-related GPR, member A3	Mus musculus	32-39
20004959-6	2009	CQ specifically activates mouse MrgprA3 and human MrgprX1.	Chloroquine	0-2	MAS related GPR family member X1	Homo sapiens	50-57
20004959-7	2009	Loss- and gain-of-function studies demonstrate that MrgprA3 is required for CQ responsiveness in mice.	Chloroquine	76-78	MAS-related GPR, member A3	Mus musculus	52-59
20017940-4	2009	If chloroquine reduced ASB activity, leading to increased chondroitin-4-sulphation, it was hypothesized that the anti-malarial mechanism of chloroquine might derive, at least in part, from suppression of ASB.	Chloroquine	3-14	arylsulfatase B	Homo sapiens	23-26
20017940-4	2009	If chloroquine reduced ASB activity, leading to increased chondroitin-4-sulphation, it was hypothesized that the anti-malarial mechanism of chloroquine might derive, at least in part, from suppression of ASB.	Chloroquine	3-14	arylsulfatase B	Homo sapiens	204-207
20017940-4	2009	If chloroquine reduced ASB activity, leading to increased chondroitin-4-sulphation, it was hypothesized that the anti-malarial mechanism of chloroquine might derive, at least in part, from suppression of ASB.	Chloroquine	140-151	arylsulfatase B	Homo sapiens	23-26
20017940-4	2009	If chloroquine reduced ASB activity, leading to increased chondroitin-4-sulphation, it was hypothesized that the anti-malarial mechanism of chloroquine might derive, at least in part, from suppression of ASB.	Chloroquine	140-151	arylsulfatase B	Homo sapiens	204-207
20017940-7	2009	Fluorescent immunostaining of ASB was performed to determine the effect of chloroquine on cellular ASB content and localization.	Chloroquine	75-86	arylsulfatase B	Homo sapiens	99-102
20017940-2	2009	Since the anti-malarial drug chloroquine accumulates in lysosomes and alters normal lysosomal processes, the effects of chloroquine on the lysosomal enzyme arylsulphatase B (ASB, N-acetylgalactosamine-4-sulphatase), which removes 4-sulphate groups from chondroitin-4-sulphate, were addressed.	Chloroquine	120-131	arylsulfatase B	Homo sapiens	156-172
20017940-9	2009	RESULTS: In the human placental, bronchial epithelial, and cerebrovascular cells, exposure to increasing concentrations of chloroquine was associated with reduced ASB activity and with increased concentrations of sGAG, largely attributable to increased C4S.	Chloroquine	123-134	arylsulfatase B	Homo sapiens	163-166
19783825-2	2009	In this report, we demonstrate that submicron particles (800-900 nm) composed of the polyketal PK3 and chloroquine, termed as the PKCNs, can deliver tumor necrosis factor-alpha (TNF-alpha) siRNA in vivo to Kupffer cells efficiently and inhibit gene expression in the liver at concentrations as low as 3.5 microg/kg.	Chloroquine	103-114	tumor necrosis factor	Homo sapiens	149-176
20017940-10	2009	The study data demonstrated: 1) decline in ASB activity following chloroquine exposure; 2) inverse correlation between ASB activity and C4S content; 3) increased content of chondroitin-4-sulphate disaccharides following chloroquine exposure; and 4) decline in extent of chloroquine-induced ASB reduction with lower baseline ASB activity.	Chloroquine	66-77	arylsulfatase B	Homo sapiens	43-46
20017940-12	2009	CONCLUSIONS: The study data indicate that the therapeutic mechanism of chloroquine action may be attributable, at least in part, to reduction of ASB activity, leading to increased chondroitin-4-sulphation in human placental, bronchial epithelial, and cerebrovascular cells.	Chloroquine	71-82	arylsulfatase B	Homo sapiens	145-148
20017940-14	2009	Extra-lysosomal localization of ASB and reduced impact of chloroquine when baseline ASB activity is less suggest possible mechanisms of resistance to the effects of chloroquine.	Chloroquine	58-69	arylsulfatase B	Homo sapiens	84-87
19783825-2	2009	In this report, we demonstrate that submicron particles (800-900 nm) composed of the polyketal PK3 and chloroquine, termed as the PKCNs, can deliver tumor necrosis factor-alpha (TNF-alpha) siRNA in vivo to Kupffer cells efficiently and inhibit gene expression in the liver at concentrations as low as 3.5 microg/kg.	Chloroquine	103-114	tumor necrosis factor	Homo sapiens	178-187
19583974-8	2009	Interestingly, we also found that pretreatment with chloroquine, an ATM stimulator could protect cells from carbon ion radiation only at lower doses.	Chloroquine	52-63	ATM serine/threonine kinase	Homo sapiens	68-71
19277980-3	2009	We show that only a 0.2 pH unit increase (20 microM CQ) is sufficient to markedly impair terminal alpha(2,3)-sialylation of an N-glycosylated reporter protein (CEA), and to induce selective mislocalization of the corresponding alpha(2,3)-sialyltransferase (ST3) into the endosomal compartments.	Chloroquine	52-54	pregnancy specific beta-1-glycoprotein 2	Homo sapiens	160-163
19477941-4	2009	The rapid degradation of GLUT2 was prevented by lysosomal inhibition (chloroquine) concomitant with the accumulation of GLUT2 in endomembrane structures.	Chloroquine	70-81	solute carrier family 2 (facilitated glucose transporter), member 2	Mus musculus	25-30
19666612-7	2009	Under chloroquine treatment, a drug promoting oxidative stress, the abundance of hPrx-2 in the parasite increases significantly.	Chloroquine	6-17	peroxiredoxin 2	Homo sapiens	81-87
19447616-3	2009	Here we report the testing of two established cysteine protease inhibitor scaffolds against both chloroquine sensitive and chloroquine resistant parasites.	Chloroquine	97-108	cathepsin B	Homo sapiens	46-63
19447616-3	2009	Here we report the testing of two established cysteine protease inhibitor scaffolds against both chloroquine sensitive and chloroquine resistant parasites.	Chloroquine	123-134	cathepsin B	Homo sapiens	46-63
19597352-5	2009	Furthermore, downregulation of EMMPRIN by p53 can be rescued by chloroquine, a lysosome inhibitor, but not by MG132, a proteasome inhibitor, suggesting an involvement of the lysosomal pathway in the p53-regulated degradation of EMMPRIN.	Chloroquine	64-75	basigin (Ok blood group)	Homo sapiens	31-38
19597352-5	2009	Furthermore, downregulation of EMMPRIN by p53 can be rescued by chloroquine, a lysosome inhibitor, but not by MG132, a proteasome inhibitor, suggesting an involvement of the lysosomal pathway in the p53-regulated degradation of EMMPRIN.	Chloroquine	64-75	tumor protein p53	Homo sapiens	42-45
19077101-4	2009	AIMS: To investigate the impact of chloroquine (CQ) treatment on the expression of vascular endothelial growth factor (VEGF, a major regulator of angiogenesis) and CD34 (a transmembrane glycoprotein expressed on endothelial cells and involved in tethering lymphocytes) in patients with DLE.	Chloroquine	35-46	vascular endothelial growth factor A	Homo sapiens	83-117
19077101-4	2009	AIMS: To investigate the impact of chloroquine (CQ) treatment on the expression of vascular endothelial growth factor (VEGF, a major regulator of angiogenesis) and CD34 (a transmembrane glycoprotein expressed on endothelial cells and involved in tethering lymphocytes) in patients with DLE.	Chloroquine	35-46	vascular endothelial growth factor A	Homo sapiens	119-123
19077101-4	2009	AIMS: To investigate the impact of chloroquine (CQ) treatment on the expression of vascular endothelial growth factor (VEGF, a major regulator of angiogenesis) and CD34 (a transmembrane glycoprotein expressed on endothelial cells and involved in tethering lymphocytes) in patients with DLE.	Chloroquine	35-46	CD34 molecule	Homo sapiens	164-168
19077101-4	2009	AIMS: To investigate the impact of chloroquine (CQ) treatment on the expression of vascular endothelial growth factor (VEGF, a major regulator of angiogenesis) and CD34 (a transmembrane glycoprotein expressed on endothelial cells and involved in tethering lymphocytes) in patients with DLE.	Chloroquine	48-50	vascular endothelial growth factor A	Homo sapiens	83-117
19077101-4	2009	AIMS: To investigate the impact of chloroquine (CQ) treatment on the expression of vascular endothelial growth factor (VEGF, a major regulator of angiogenesis) and CD34 (a transmembrane glycoprotein expressed on endothelial cells and involved in tethering lymphocytes) in patients with DLE.	Chloroquine	48-50	vascular endothelial growth factor A	Homo sapiens	119-123
19077101-4	2009	AIMS: To investigate the impact of chloroquine (CQ) treatment on the expression of vascular endothelial growth factor (VEGF, a major regulator of angiogenesis) and CD34 (a transmembrane glycoprotein expressed on endothelial cells and involved in tethering lymphocytes) in patients with DLE.	Chloroquine	48-50	CD34 molecule	Homo sapiens	164-168
19077101-9	2009	RESULTS: CQ treatment induced a reduction in epidermal VEGF expression.	Chloroquine	9-11	vascular endothelial growth factor A	Homo sapiens	55-59
19277980-3	2009	We show that only a 0.2 pH unit increase (20 microM CQ) is sufficient to markedly impair terminal alpha(2,3)-sialylation of an N-glycosylated reporter protein (CEA), and to induce selective mislocalization of the corresponding alpha(2,3)-sialyltransferase (ST3) into the endosomal compartments.	Chloroquine	52-54	tumor-suppressor, HELA cell type	Homo sapiens	257-260
19254755-2	2009	The stimulation of MTT formazan exocytosis is probably related to perturbation of intracellular vesicle trafficking by MSN uptake as revealed by experiments in presence of chloroquine and genistein.	Chloroquine	172-183	moesin	Homo sapiens	119-122
19560616-6	2009	In one case, a genetic polymorphism modulating the activity of a cytochrome involved in chloroquine metabolism (CYP2C8) was identified.	Chloroquine	88-99	cytochrome P450 family 2 subfamily C member 8	Homo sapiens	112-118
19509241-6	2009	In the presence of the endosomolytic reagent chloroquine 5-E-AIF(Delta100) but not the similar 5-AIF(Delta100) protein displayed potent cell killing activity, which was strictly dependent on the expression of ErbB2 on the target cell surface.	Chloroquine	45-56	apoptosis inducing factor mitochondria associated 1	Homo sapiens	61-69
19509241-6	2009	In the presence of the endosomolytic reagent chloroquine 5-E-AIF(Delta100) but not the similar 5-AIF(Delta100) protein displayed potent cell killing activity, which was strictly dependent on the expression of ErbB2 on the target cell surface.	Chloroquine	45-56	erb-b2 receptor tyrosine kinase 2	Homo sapiens	209-214
19031076-2	2009	Herein, the relation was investigated between the levels of circulating erythropoietin (EPO) and immunomodulatory cytokines in response to chloroquine treatment.	Chloroquine	139-150	erythropoietin	Homo sapiens	88-91
19031076-7	2009	Chloroquine treatment led to a decrease in EPO levels in the control subjects but an increase in malaria patients at day 30.	Chloroquine	0-11	erythropoietin	Homo sapiens	43-46
19031076-9	2009	Based on these findings, we propose that an impaired EPO production in association with a prolonged elevation of certain inflammatory cytokines can contribute to the anemia in some malaria patients which can be reversed by chloroquine therapy.	Chloroquine	223-234	erythropoietin	Homo sapiens	53-56
19299739-5	2009	The telomere-derived TLR9 inhibitory oligonucleotide 5"-TTT AGG GTT AGG GTT AGG G-3", agents that block endosomal acidification such as chloroquine and bafilomycin A, and NF-kappaB inhibitors abrogated CpG DNA-induced signaling.	Chloroquine	136-147	toll like receptor 9	Homo sapiens	21-25
19174326-4	2009	Bacteria-specific Th1 responses were inhibited by anti-HLA-DR antibodies and chloroquine exposure, were enriched in LP relative to peripheral blood, and expressed effector memory cell markers.	Chloroquine	77-88	negative elongation factor complex member C/D	Homo sapiens	18-21
19264786-7	2009	The mechanism for chloroquine"s antiviral action likely is the inhibition of cathepsin L, a cellular enzyme that is essential for the processing of the viral fusion glycoprotein and the maturation of newly budding virions.	Chloroquine	18-29	cathepsin L	Homo sapiens	77-88
19296457-5	2009	Ubiquitin and proteasome immunostaining, and ubiquitin, MuRF-1, and atrogin-1/MAFbx mRNAs were significantly increased in denervated soleus muscles from saline- and chloroquine-treated rats when compared with contralateral innervated muscles.	Chloroquine	165-176	tripartite motif containing 63	Rattus norvegicus	56-62
19318401-10	2009	High-dose of corticosteroids, chloroquine and cyclophosphamide therapy had resulted in remission of hypoglycaemia associated with resolution of circulating antibodies to insulin and insulin receptor, and improvement in clinical and laboratory features of SLE.	Chloroquine	30-41	insulin	Homo sapiens	170-177
19318401-10	2009	High-dose of corticosteroids, chloroquine and cyclophosphamide therapy had resulted in remission of hypoglycaemia associated with resolution of circulating antibodies to insulin and insulin receptor, and improvement in clinical and laboratory features of SLE.	Chloroquine	30-41	insulin receptor	Homo sapiens	182-198
19296457-5	2009	Ubiquitin and proteasome immunostaining, and ubiquitin, MuRF-1, and atrogin-1/MAFbx mRNAs were significantly increased in denervated soleus muscles from saline- and chloroquine-treated rats when compared with contralateral innervated muscles.	Chloroquine	165-176	F-box protein 32	Rattus norvegicus	68-77
19296457-5	2009	Ubiquitin and proteasome immunostaining, and ubiquitin, MuRF-1, and atrogin-1/MAFbx mRNAs were significantly increased in denervated soleus muscles from saline- and chloroquine-treated rats when compared with contralateral innervated muscles.	Chloroquine	165-176	F-box protein 32	Rattus norvegicus	78-83
18926782-5	2009	The transfection efficiency of both types of PEG-DBP-NLS particles was further increased 7-fold in the presence of chloroquine, suggesting that the transfection efficiency of PEG-DBP-NLS particles is limited by their ability to escape the endosome.	Chloroquine	115-126	D-box binding PAR bZIP transcription factor	Homo sapiens	49-52
19073155-9	2009	However, co-treatment of K562 cells with CQ or HCQ in the presence of inhibitors of sGC-PKG-pathways reduced Hb F stimulation, suggesting the possible involvement of the sGC-PKG pathway.	Chloroquine	41-43	sarcoglycan beta	Homo sapiens	84-87
19073155-9	2009	However, co-treatment of K562 cells with CQ or HCQ in the presence of inhibitors of sGC-PKG-pathways reduced Hb F stimulation, suggesting the possible involvement of the sGC-PKG pathway.	Chloroquine	41-43	protein kinase cGMP-dependent 1	Homo sapiens	88-91
19073155-9	2009	However, co-treatment of K562 cells with CQ or HCQ in the presence of inhibitors of sGC-PKG-pathways reduced Hb F stimulation, suggesting the possible involvement of the sGC-PKG pathway.	Chloroquine	41-43	sarcoglycan beta	Homo sapiens	170-173
19073155-9	2009	However, co-treatment of K562 cells with CQ or HCQ in the presence of inhibitors of sGC-PKG-pathways reduced Hb F stimulation, suggesting the possible involvement of the sGC-PKG pathway.	Chloroquine	41-43	protein kinase cGMP-dependent 1	Homo sapiens	174-177
18926782-5	2009	The transfection efficiency of both types of PEG-DBP-NLS particles was further increased 7-fold in the presence of chloroquine, suggesting that the transfection efficiency of PEG-DBP-NLS particles is limited by their ability to escape the endosome.	Chloroquine	115-126	D-box binding PAR bZIP transcription factor	Homo sapiens	179-182
18953633-7	2009	Although CpG-ODN had no significant effect on the IL-6 production, it was able to induce the increase of TNF-alpha protein expression and this effect was inhibited by CHQ pretreatment.	Chloroquine	167-170	interleukin 6	Homo sapiens	50-54
19194831-1	2009	The present study was to investigate the anticancer effect of chloroquine on proliferation of mouse colon cancer cell line CT26 in vivo and in vitro and the possible mechanism.	Chloroquine	62-73	DEAD-box helicase 53	Homo sapiens	123-127
19194831-2	2009	We found that chloroquine inhibited CT26 proliferation by concentration- and time-dependent manner.	Chloroquine	14-25	DEAD-box helicase 53	Homo sapiens	36-40
19194831-4	2009	The in vivo study showed chloroquine-reduced tumor volume and prolonged survival time in CT26-bearing mice.	Chloroquine	25-36	DEAD-box helicase 53	Homo sapiens	89-93
19194831-5	2009	These observations indicated chloroquine could inhibit CT26 proliferation by inducing apoptosis both in vitro and in vivo, providing its chemotherapeutic potential of human cancers.	Chloroquine	29-40	DEAD-box helicase 53	Homo sapiens	55-59
18953633-7	2009	Although CpG-ODN had no significant effect on the IL-6 production, it was able to induce the increase of TNF-alpha protein expression and this effect was inhibited by CHQ pretreatment.	Chloroquine	167-170	tumor necrosis factor	Homo sapiens	105-114
19040351-5	2009	To further verify the hypothesis that HSPG-dependent mechanisms are involved in HK uptake and proteolytic processing in lysosomes, we tested chloroquine, which blocks Alexa 488- HK colocalization with Lyso Tracker in acidic endosomal vesicles.	Chloroquine	141-152	LOW QUALITY PROTEIN: basement membrane-specific heparan sulfate proteoglycan core protein	Cricetulus griseus	38-42
19121286-5	2009	Furthermore, flotillin-1 dependent down-regulation of caveolin-1 was reversed after cell exposure to lysosomal inhibitor, chloroquine but not proteosomal inhibitor, MG262.	Chloroquine	122-133	flotillin 1	Homo sapiens	13-24
19121286-5	2009	Furthermore, flotillin-1 dependent down-regulation of caveolin-1 was reversed after cell exposure to lysosomal inhibitor, chloroquine but not proteosomal inhibitor, MG262.	Chloroquine	122-133	caveolin 1	Homo sapiens	54-64
19040351-5	2009	To further verify the hypothesis that HSPG-dependent mechanisms are involved in HK uptake and proteolytic processing in lysosomes, we tested chloroquine, which blocks Alexa 488- HK colocalization with Lyso Tracker in acidic endosomal vesicles.	Chloroquine	141-152	kininogen 1	Homo sapiens	80-82
19040351-5	2009	To further verify the hypothesis that HSPG-dependent mechanisms are involved in HK uptake and proteolytic processing in lysosomes, we tested chloroquine, which blocks Alexa 488- HK colocalization with Lyso Tracker in acidic endosomal vesicles.	Chloroquine	141-152	kininogen 1	Homo sapiens	178-180
19710529-0	2009	Chloroquine blocks a mutant Kir2.1 channel responsible for short QT syndrome and normalizes repolarization properties in silico.	Chloroquine	0-11	potassium inwardly rectifying channel subfamily J member 2	Homo sapiens	28-34
19710529-4	2009	We recently reported that the anti-malarial drug chloroquine blocks Kir2.1 channels by plugging the cytoplasmic pore domain.	Chloroquine	49-60	potassium inwardly rectifying channel subfamily J member 2	Homo sapiens	68-74
19710529-5	2009	In this study, we tested whether chloroquine blocks D172N Kir2.1 channels in a heterologous expression system and if chloroquine normalizes repolarization properties using a mathematical model of a human ventricular myocyte.	Chloroquine	33-44	potassium inwardly rectifying channel subfamily J member 2	Homo sapiens	58-64
19710529-6	2009	Chloroquine caused a dose- and voltage-dependent reduction in wild-type (WT), D172N and WT-D172N heteromeric Kir2.1 current.	Chloroquine	0-11	potassium inwardly rectifying channel subfamily J member 2	Homo sapiens	109-115
19710529-7	2009	The potency and kinetics of chloroquine block of D172N and WT-D172N Kir2.1 current were similar to WT.	Chloroquine	28-39	potassium inwardly rectifying channel subfamily J member 2	Homo sapiens	68-74
19710529-8	2009	In silico modeling of the heterozygous WT-D172N Kir2.1 condition predicted that 3 microM chloroquine normalized inward rectifier K+ current magnitude, action potential duration and effective refractory period.	Chloroquine	89-100	potassium inwardly rectifying channel subfamily J member 2	Homo sapiens	48-54
19710529-9	2009	Our results suggest that therapeutic concentrations of chloroquine might lengthen cardiac repolarization in SQT3.	Chloroquine	55-66	potassium inwardly rectifying channel subfamily J member 2	Homo sapiens	108-112
19033662-6	2008	However, inhibition of ARHI-induced autophagy with chloroquine dramatically reduced regrowth of xenografted tumors upon reduction of ARHI levels, suggesting that autophagy contributed to the survival of dormant cells.	Chloroquine	51-62	DIRAS family GTPase 3	Homo sapiens	23-27
19033662-6	2008	However, inhibition of ARHI-induced autophagy with chloroquine dramatically reduced regrowth of xenografted tumors upon reduction of ARHI levels, suggesting that autophagy contributed to the survival of dormant cells.	Chloroquine	51-62	DIRAS family GTPase 3	Homo sapiens	133-137
18708346-6	2008	The lysosomal inhibitors chloroquine and bafilomycin A1 prevented the loss of NRP1 expression, but proteasomal inhibitors had no effect.	Chloroquine	25-36	neuropilin 1	Homo sapiens	78-82
19001856-7	2008	ATMIN was required for ATM signalling by chloroquine and hypotonic stress, but not after induction of double-stand breaks by ionizing radiation (IR), whereas NBS1 is required for ATM signalling by IR.	Chloroquine	41-52	ATM serine/threonine kinase	Homo sapiens	0-3
19001856-7	2008	ATMIN was required for ATM signalling by chloroquine and hypotonic stress, but not after induction of double-stand breaks by ionizing radiation (IR), whereas NBS1 is required for ATM signalling by IR.	Chloroquine	41-52	ATM serine/threonine kinase	Homo sapiens	23-26
19001869-6	2008	Unexpectedly, microarray analysis of PBMC from patients treated with chloroquine reveals a reversal of disease-linked KPNA1-, NLRP1- and NLRP3-gene expression phenotypes, implying that chloroquine could serve as a readily clinically available drug for targeted correction of identified aberrations.	Chloroquine	69-80	karyopherin subunit alpha 1	Homo sapiens	118-123
19001869-6	2008	Unexpectedly, microarray analysis of PBMC from patients treated with chloroquine reveals a reversal of disease-linked KPNA1-, NLRP1- and NLRP3-gene expression phenotypes, implying that chloroquine could serve as a readily clinically available drug for targeted correction of identified aberrations.	Chloroquine	69-80	NLR family pyrin domain containing 1	Homo sapiens	126-131
19001869-6	2008	Unexpectedly, microarray analysis of PBMC from patients treated with chloroquine reveals a reversal of disease-linked KPNA1-, NLRP1- and NLRP3-gene expression phenotypes, implying that chloroquine could serve as a readily clinically available drug for targeted correction of identified aberrations.	Chloroquine	69-80	NLR family pyrin domain containing 3	Homo sapiens	137-142
19001869-6	2008	Unexpectedly, microarray analysis of PBMC from patients treated with chloroquine reveals a reversal of disease-linked KPNA1-, NLRP1- and NLRP3-gene expression phenotypes, implying that chloroquine could serve as a readily clinically available drug for targeted correction of identified aberrations.	Chloroquine	185-196	karyopherin subunit alpha 1	Homo sapiens	118-123
19001869-6	2008	Unexpectedly, microarray analysis of PBMC from patients treated with chloroquine reveals a reversal of disease-linked KPNA1-, NLRP1- and NLRP3-gene expression phenotypes, implying that chloroquine could serve as a readily clinically available drug for targeted correction of identified aberrations.	Chloroquine	185-196	NLR family pyrin domain containing 1	Homo sapiens	126-131
19001869-6	2008	Unexpectedly, microarray analysis of PBMC from patients treated with chloroquine reveals a reversal of disease-linked KPNA1-, NLRP1- and NLRP3-gene expression phenotypes, implying that chloroquine could serve as a readily clinically available drug for targeted correction of identified aberrations.	Chloroquine	185-196	NLR family pyrin domain containing 3	Homo sapiens	137-142
18764842-2	2008	OBJECTIVES: The aim of this study was to evaluate whether 3 months of monotherapy with chloroquine influences the mRNA skin expression of interleukin (IL)-1beta, IL-6 and tumour necrosis factor-alpha (TNF-alpha) in nonirradiated and locally ultraviolet B (UVB) irradiated nondiseased skin of patients with systemic lupus erythematosus (SLE).	Chloroquine	87-98	interleukin 1 beta	Homo sapiens	138-160
18764842-2	2008	OBJECTIVES: The aim of this study was to evaluate whether 3 months of monotherapy with chloroquine influences the mRNA skin expression of interleukin (IL)-1beta, IL-6 and tumour necrosis factor-alpha (TNF-alpha) in nonirradiated and locally ultraviolet B (UVB) irradiated nondiseased skin of patients with systemic lupus erythematosus (SLE).	Chloroquine	87-98	interleukin 6	Homo sapiens	162-166
18764842-2	2008	OBJECTIVES: The aim of this study was to evaluate whether 3 months of monotherapy with chloroquine influences the mRNA skin expression of interleukin (IL)-1beta, IL-6 and tumour necrosis factor-alpha (TNF-alpha) in nonirradiated and locally ultraviolet B (UVB) irradiated nondiseased skin of patients with systemic lupus erythematosus (SLE).	Chloroquine	87-98	tumor necrosis factor	Homo sapiens	201-210
18764842-7	2008	Significantly lower expression of IL-1beta, IL-6 and TNF-alpha mRNAs was noted in irradiated skin samples after 3 months of chloroquine treatment.	Chloroquine	124-135	interleukin 1 beta	Homo sapiens	34-42
18764842-7	2008	Significantly lower expression of IL-1beta, IL-6 and TNF-alpha mRNAs was noted in irradiated skin samples after 3 months of chloroquine treatment.	Chloroquine	124-135	interleukin 6	Homo sapiens	44-48
18764842-7	2008	Significantly lower expression of IL-1beta, IL-6 and TNF-alpha mRNAs was noted in irradiated skin samples after 3 months of chloroquine treatment.	Chloroquine	124-135	tumor necrosis factor	Homo sapiens	53-62
18546203-7	2008	When the cells were incubated with chloroquine, a lysosomotropic amine that raises the lysosomal pH thus inhibiting enzymatic degradation of internalized compounds, stimulation of HSPG synthesis was still observed.	Chloroquine	35-46	CD44 molecule (Indian blood group)	Homo sapiens	180-184
19017992-5	2008	This suggested a role for these TLRs in production of TNF and IL-6 from RA which was supported by data from chloroquine, an inhibitor of endosomal acidification (a prerequisite for TLRs 3, 7, 8, and 9 activation) which also inhibited production of these cytokines from RA synovial cultures.	Chloroquine	108-119	tumor necrosis factor	Homo sapiens	54-57
19017992-5	2008	This suggested a role for these TLRs in production of TNF and IL-6 from RA which was supported by data from chloroquine, an inhibitor of endosomal acidification (a prerequisite for TLRs 3, 7, 8, and 9 activation) which also inhibited production of these cytokines from RA synovial cultures.	Chloroquine	108-119	interleukin 6	Homo sapiens	62-66
19001856-7	2008	ATMIN was required for ATM signalling by chloroquine and hypotonic stress, but not after induction of double-stand breaks by ionizing radiation (IR), whereas NBS1 is required for ATM signalling by IR.	Chloroquine	41-52	ATM interactor	Homo sapiens	0-5
18687330-5	2008	In whole cell recordings from CA1 pyramidal neurons in chloroquine-treated slices we observed a significant decrease in AMPAR-mediated mEPSC frequency and amplitude indicating synaptic dysfunction.	Chloroquine	55-66	carbonic anhydrase 1	Homo sapiens	30-33
18644884-9	2008	The ability of the supernatant to induce IL-8 secretion was reduced by flagellum and cytolethal distending toxin (CDT) gene mutants, treatment of the supernatant with protease K or heat, or treatment of T84 cells with the Toll-like receptor (TLR) inhibitor MyD88 inhibitory peptide or chloroquine.	Chloroquine	285-296	C-X-C motif chemokine ligand 8	Homo sapiens	41-45
18753338-3	2008	More specifically, priming of chloroquine-treated mice with soluble ovalbumin (OVA), OVA associated with alum, or OVA pulsed on DCs was more effective in inducing OVA-specific CD8(+) T lymphocytes than was priming of untreated mice.	Chloroquine	30-41	serine (or cysteine) peptidase inhibitor, clade B, member 1, pseudogene	Mus musculus	68-77
18753338-0	2008	Primary CD8+ T-cell response to soluble ovalbumin is improved by chloroquine treatment in vivo.	Chloroquine	65-76	serine (or cysteine) peptidase inhibitor, clade B, member 1, pseudogene	Mus musculus	40-49
18633340-4	2008	To evaluate the contribution of vascular and immunological dysfunction, we treated the folate-septic mice with soluble Flt-1 to bind VEGF and chloroquine to reduce splenocyte apoptosis.	Chloroquine	142-153	FMS-like tyrosine kinase 1	Mus musculus	119-124
18602491-4	2008	Selective inhibitors of the bacterial DNA/TLR9 pathway (chloroquine, an inhibitory oligonucleotide, and DNase I) consistently inhibited GBS-induced TNF secretion by 35-50% in RAW 264.7 macrophages and murine splenic macrophages, but had no effect on inducible nitric oxide synthase (iNOS) accumulation or NO secretion.	Chloroquine	56-67	toll-like receptor 9	Mus musculus	42-46
18691894-0	2008	The efficacy and selectivity of tumor cell killing by Akt inhibitors are substantially increased by chloroquine.	Chloroquine	100-111	AKT serine/threonine kinase 1	Homo sapiens	54-57
18691894-1	2008	This study was to evaluate the enhancement value of chloroquine (CQ) in cancer cell killing when used in combination with Akt inhibitors.	Chloroquine	52-63	AKT serine/threonine kinase 1	Homo sapiens	122-125
18691894-1	2008	This study was to evaluate the enhancement value of chloroquine (CQ) in cancer cell killing when used in combination with Akt inhibitors.	Chloroquine	65-67	AKT serine/threonine kinase 1	Homo sapiens	122-125
18691894-3	2008	Importantly, the CQ-mediated chemosensitization of cell killing effects by Akt inhibitors is cancer specific.	Chloroquine	17-19	AKT serine/threonine kinase 1	Homo sapiens	75-78
18691894-4	2008	In particular, when combined with 10 microM CQ, 1,3-dihydro-1-(1-((4-(6-phenyl-1H-imidazo[4,5-g]quinoxalin-7-yl)phenyl)methyl)-4-piperidinyl)-2H-benzimidazol-2-one (an Akt1 and 2 inhibitor; compound 8) killed cancer cells 10-120 times more effectively than normal cells.	Chloroquine	44-46	AKT serine/threonine kinase 1	Homo sapiens	168-178
18691894-5	2008	Thus, CQ is a very effective and cancer-specific chemosensitizer when used in combination with Akt inhibitors.	Chloroquine	6-8	AKT serine/threonine kinase 1	Homo sapiens	95-98
18554923-6	2008	Pre-treatment of ts20 transfectants with either chloroquine or MG132 inhibited ligand-induced G-CSFR degradation, suggesting a role for both lysosomes and proteasomes in regulating G-CSFR surface expression in this cell line.	Chloroquine	48-59	colony stimulating factor 3 receptor	Homo sapiens	94-100
18554923-6	2008	Pre-treatment of ts20 transfectants with either chloroquine or MG132 inhibited ligand-induced G-CSFR degradation, suggesting a role for both lysosomes and proteasomes in regulating G-CSFR surface expression in this cell line.	Chloroquine	48-59	colony stimulating factor 3 receptor	Homo sapiens	181-187
18539596-3	2008	Here we show that chronic morphine exposure induced posttranscriptional down-regulation of the glutamate transporter EAAC1 in C6 glioma cells with a concurrent decrease in glutamate uptake and increase in proteasome activity, which were blocked by the selective proteasome inhibitor MG-132 or lactacystin but not the lysosomal inhibitor chloroquin.	Chloroquine	337-347	solute carrier family 1 member 1	Homo sapiens	117-122
18758509-6	2008	The alkalinizing lysosomotropic drugs chloroquine, hydroxychloroquine, amodiaquine, and azithromycin had a similar effect on the overall production of mature bioactive TGFbeta.	Chloroquine	38-49	transforming growth factor beta 1	Homo sapiens	168-175
18602491-4	2008	Selective inhibitors of the bacterial DNA/TLR9 pathway (chloroquine, an inhibitory oligonucleotide, and DNase I) consistently inhibited GBS-induced TNF secretion by 35-50% in RAW 264.7 macrophages and murine splenic macrophages, but had no effect on inducible nitric oxide synthase (iNOS) accumulation or NO secretion.	Chloroquine	56-67	tumor necrosis factor	Mus musculus	148-151
18602491-4	2008	Selective inhibitors of the bacterial DNA/TLR9 pathway (chloroquine, an inhibitory oligonucleotide, and DNase I) consistently inhibited GBS-induced TNF secretion by 35-50% in RAW 264.7 macrophages and murine splenic macrophages, but had no effect on inducible nitric oxide synthase (iNOS) accumulation or NO secretion.	Chloroquine	56-67	nitric oxide synthase 2, inducible	Mus musculus	250-281
18602491-4	2008	Selective inhibitors of the bacterial DNA/TLR9 pathway (chloroquine, an inhibitory oligonucleotide, and DNase I) consistently inhibited GBS-induced TNF secretion by 35-50% in RAW 264.7 macrophages and murine splenic macrophages, but had no effect on inducible nitric oxide synthase (iNOS) accumulation or NO secretion.	Chloroquine	56-67	nitric oxide synthase 2, inducible	Mus musculus	283-287
19707354-6	2008	Inhibition of autophagy is a particularly attractive strategy for the treatment of imatinib-refractory chronic myelogenous leukemia (CML) since a combination of CQ with the HDAC inhibitor suberoylanilide hydroxamic acid (SAHA) compromises the survival of even BCR-ABL-T315I+ imatinib-resistant CML.	Chloroquine	161-163	ABL proto-oncogene 1, non-receptor tyrosine kinase	Homo sapiens	260-267
18450949-5	2008	Administration of chloroquine (50 mg/kg for 7 days po), a denaturant of lysosomes, increased the AQP5 protein level reduced by CTD.	Chloroquine	18-29	aquaporin 5	Rattus norvegicus	97-101
18305095-5	2008	Here, we show that chloroquine, an inhibitor of endocytic TLRs (TLR3, 7, 8, 9), improves sepsis-induced mortality and AKI in a clinically relevant polymicrobial sepsis mouse model, even when administered 6 h after the septic insult.	Chloroquine	19-30	toll-like receptor 3	Mus musculus	64-68
18305095-6	2008	Chloroquine administration attenuated the decline in renal function, splenic apoptosis, serum markers of damage to other organs, and prototypical serum pro- and anti-inflammatory cytokines TNF-alpha and IL-10.	Chloroquine	0-11	tumor necrosis factor	Mus musculus	189-198
18305095-6	2008	Chloroquine administration attenuated the decline in renal function, splenic apoptosis, serum markers of damage to other organs, and prototypical serum pro- and anti-inflammatory cytokines TNF-alpha and IL-10.	Chloroquine	0-11	interleukin 10	Mus musculus	203-208
18305095-7	2008	An oligodeoxynucleotide inhibitor (H154) of TLR9 and TLR9-deficient mice mirror the actions of chloroquine in all functional parameters that we tested.	Chloroquine	95-106	toll-like receptor 9	Mus musculus	44-48
18305095-8	2008	In addition, chloroquine decreased TLR9 protein abundance in spleen, further suggesting that TLR9 signaling may be a major target for the protective actions of chloroquine.	Chloroquine	13-24	toll-like receptor 9	Mus musculus	35-39
18305095-8	2008	In addition, chloroquine decreased TLR9 protein abundance in spleen, further suggesting that TLR9 signaling may be a major target for the protective actions of chloroquine.	Chloroquine	13-24	toll-like receptor 9	Mus musculus	93-97
18305095-8	2008	In addition, chloroquine decreased TLR9 protein abundance in spleen, further suggesting that TLR9 signaling may be a major target for the protective actions of chloroquine.	Chloroquine	160-171	toll-like receptor 9	Mus musculus	35-39
18305095-8	2008	In addition, chloroquine decreased TLR9 protein abundance in spleen, further suggesting that TLR9 signaling may be a major target for the protective actions of chloroquine.	Chloroquine	160-171	toll-like receptor 9	Mus musculus	93-97
18430083-8	2008	Similar effects on lysosomal morphology and TLF sensitivity were also obtained by two pharmacological agents that neutralize lysosomal pH--chloroquine and bafilomycin A1.	Chloroquine	139-150	TATA-box binding protein like 1	Homo sapiens	44-47
18358497-2	2008	As expected, exposure of mu-opioid receptor (MOR)-transfected HEK-293 cells to either DAMGO (a specific mu-opioid agonist) or etorphine (a wide spectrum opioid agonist) resulted in down regulation of the receptors that was blocked by the kinase inhibitor staurosporine, by hypertonic sucrose and by the lysosomal and proteasomal inhibitors chloroquine and lactacystin.	Chloroquine	340-351	opioid receptor mu 1	Homo sapiens	25-43
18844109-13	2008	Chloroquine and inhibitory ODN dose-dependently inhibited the IFN-alpha levels in the supernatant.	Chloroquine	0-11	interferon alpha 1	Homo sapiens	62-71
18359172-12	2008	CQ also induced time-dependent increase in Bax level and caspase-3 activity with no change in Bcl-2 level.	Chloroquine	0-2	BCL2 associated X, apoptosis regulator	Homo sapiens	43-46
18359172-12	2008	CQ also induced time-dependent increase in Bax level and caspase-3 activity with no change in Bcl-2 level.	Chloroquine	0-2	caspase 3	Homo sapiens	57-66
18358497-2	2008	As expected, exposure of mu-opioid receptor (MOR)-transfected HEK-293 cells to either DAMGO (a specific mu-opioid agonist) or etorphine (a wide spectrum opioid agonist) resulted in down regulation of the receptors that was blocked by the kinase inhibitor staurosporine, by hypertonic sucrose and by the lysosomal and proteasomal inhibitors chloroquine and lactacystin.	Chloroquine	340-351	opioid receptor mu 1	Homo sapiens	45-48
18216495-5	2008	Administration of chloroquine to inhibit lysosomal activity enhanced the rapamycin-induced increase in the number of cells with numerous GFP-LC3-positive autophagosomes.	Chloroquine	18-29	microtubule-associated protein 1 light chain 3 alpha	Mus musculus	141-144
18216495-7	2008	Chloroquine also enhanced the accumulation of autophagosomes in cells stimulated with hydrogen peroxide, while it attenuated that induced by Bafilomycin A1, an inhibitor of V-ATPase that interferes with fusion of autophagosomes with lysosomes.	Chloroquine	0-11	ATPase, H+ transporting, lysosomal V0 subunit D2	Mus musculus	173-181
18216495-9	2008	Using transgenic mice expressing 3 mCherry-LC3 exposed to rapamycin for 4 hr, we observed an increase in mCherry-LC3-labeled autophagosomes in myocardium, which was further increased by concurrent administration of chloroquine, thus allowing determination of flux as a more precise measure of autophagic activity in vivo.	Chloroquine	215-226	microtubule-associated protein 1 light chain 3 alpha	Mus musculus	43-46
18216495-9	2008	Using transgenic mice expressing 3 mCherry-LC3 exposed to rapamycin for 4 hr, we observed an increase in mCherry-LC3-labeled autophagosomes in myocardium, which was further increased by concurrent administration of chloroquine, thus allowing determination of flux as a more precise measure of autophagic activity in vivo.	Chloroquine	215-226	microtubule-associated protein 1 light chain 3 alpha	Mus musculus	113-116
18350548-7	2008	Inhibition of both the endosomal (by chloroquine) and IFN (by anti-IFNAR antibody) pathways partly inhibited BAFF expression.	Chloroquine	37-48	TNF superfamily member 13b	Homo sapiens	109-113
18311193-4	2008	KEY RESULTS: 5-HT(3A) receptor responses were inhibited by mefloquine, quinine and chloroquine with IC(50) values of 0.66, 1.06 and 24.3 microM.	Chloroquine	83-94	5-hydroxytryptamine receptor 3A	Homo sapiens	13-20
18311193-6	2008	Mefloquine, quinine and chloroquine had higher IC(50) values at GABA(A) alpha1beta2 (98.7, 0.40 and 0.46 mM, respectively) and GABA(A) alpha1beta2gamma2 receptors (0.38, 1.69 and 0.67 mM, respectively).	Chloroquine	24-35	adrenoceptor alpha 1D	Homo sapiens	135-152
18311193-11	2008	CONCLUSIONS AND IMPLICATIONS: The effects of mefloquine, quinine and chloroquine are distinct at GABA(A) and GABA(C) receptors, whereas their effects on 5-HT(3AB) receptors are broadly similar to those at 5-HT(3A) receptors.	Chloroquine	69-80	5-hydroxytryptamine receptor 3A	Homo sapiens	153-160
18379071-0	2008	Chloroquine, an anti-malarial agent, acts as a novel regulator of beta 1-integrin-mediated cell-cell adhesion.	Chloroquine	0-11	potassium calcium-activated channel subfamily M regulatory beta subunit 1	Homo sapiens	66-72
18379071-2	2008	In this study, we examined the modulatory effect of chloroquine on the functional activation of beta1-integrins (CD29) using CD29- and CD98 (a functional regulator of CD29)-mediated U937 cell-cell adhesion, comparing macrophage functions and T cell proliferation.	Chloroquine	52-63	integrin subunit beta 1	Homo sapiens	96-111
18379071-2	2008	In this study, we examined the modulatory effect of chloroquine on the functional activation of beta1-integrins (CD29) using CD29- and CD98 (a functional regulator of CD29)-mediated U937 cell-cell adhesion, comparing macrophage functions and T cell proliferation.	Chloroquine	52-63	integrin subunit beta 1	Homo sapiens	113-117
18379071-2	2008	In this study, we examined the modulatory effect of chloroquine on the functional activation of beta1-integrins (CD29) using CD29- and CD98 (a functional regulator of CD29)-mediated U937 cell-cell adhesion, comparing macrophage functions and T cell proliferation.	Chloroquine	52-63	integrin subunit beta 1	Homo sapiens	125-129
18379071-2	2008	In this study, we examined the modulatory effect of chloroquine on the functional activation of beta1-integrins (CD29) using CD29- and CD98 (a functional regulator of CD29)-mediated U937 cell-cell adhesion, comparing macrophage functions and T cell proliferation.	Chloroquine	52-63	solute carrier family 3 member 2	Homo sapiens	135-139
18379071-2	2008	In this study, we examined the modulatory effect of chloroquine on the functional activation of beta1-integrins (CD29) using CD29- and CD98 (a functional regulator of CD29)-mediated U937 cell-cell adhesion, comparing macrophage functions and T cell proliferation.	Chloroquine	52-63	integrin subunit beta 1	Homo sapiens	125-129
18379071-3	2008	Chloroquine effectively suppressed U937 cell-cell adhesion mediated by CD29 and CD98, in a protein kinase (PK) C, PKA, protein tyrosine kinase (PTK), extracellular signal-regulated kinase (ERK) and actin cytoskeleton-independent manner.	Chloroquine	0-11	integrin subunit beta 1	Homo sapiens	71-75
18379071-3	2008	Chloroquine effectively suppressed U937 cell-cell adhesion mediated by CD29 and CD98, in a protein kinase (PK) C, PKA, protein tyrosine kinase (PTK), extracellular signal-regulated kinase (ERK) and actin cytoskeleton-independent manner.	Chloroquine	0-11	solute carrier family 3 member 2	Homo sapiens	80-84
18379071-3	2008	Chloroquine effectively suppressed U937 cell-cell adhesion mediated by CD29 and CD98, in a protein kinase (PK) C, PKA, protein tyrosine kinase (PTK), extracellular signal-regulated kinase (ERK) and actin cytoskeleton-independent manner.	Chloroquine	0-11	proline rich transmembrane protein 2	Homo sapiens	91-112
18379071-3	2008	Chloroquine effectively suppressed U937 cell-cell adhesion mediated by CD29 and CD98, in a protein kinase (PK) C, PKA, protein tyrosine kinase (PTK), extracellular signal-regulated kinase (ERK) and actin cytoskeleton-independent manner.	Chloroquine	0-11	EPH receptor A8	Homo sapiens	119-142
18379071-3	2008	Chloroquine effectively suppressed U937 cell-cell adhesion mediated by CD29 and CD98, in a protein kinase (PK) C, PKA, protein tyrosine kinase (PTK), extracellular signal-regulated kinase (ERK) and actin cytoskeleton-independent manner.	Chloroquine	0-11	EPH receptor A8	Homo sapiens	144-147
18379071-3	2008	Chloroquine effectively suppressed U937 cell-cell adhesion mediated by CD29 and CD98, in a protein kinase (PK) C, PKA, protein tyrosine kinase (PTK), extracellular signal-regulated kinase (ERK) and actin cytoskeleton-independent manner.	Chloroquine	0-11	mitogen-activated protein kinase 1	Homo sapiens	150-187
18379071-3	2008	Chloroquine effectively suppressed U937 cell-cell adhesion mediated by CD29 and CD98, in a protein kinase (PK) C, PKA, protein tyrosine kinase (PTK), extracellular signal-regulated kinase (ERK) and actin cytoskeleton-independent manner.	Chloroquine	0-11	mitogen-activated protein kinase 1	Homo sapiens	189-192
18379071-5	2008	Therefore, these results suggest that chloroquine may act as a novel regulator of CD29 function in a lysomotropic character-dependent novel manner.	Chloroquine	38-49	integrin subunit beta 1	Homo sapiens	82-86
18322216-4	2008	IL-12p40 production and CD40 expression were attenuated by chloroquine, bafilomycin A, and inhibitory oligodeoxynucleotides (ODN) that suppressed the responses caused by CpG-ODN.	Chloroquine	59-70	interleukin 12b	Mus musculus	0-8
18322216-4	2008	IL-12p40 production and CD40 expression were attenuated by chloroquine, bafilomycin A, and inhibitory oligodeoxynucleotides (ODN) that suppressed the responses caused by CpG-ODN.	Chloroquine	59-70	CD40 antigen	Mus musculus	24-28
18294209-5	2008	When the lysosomotropic agent, chloroquine (CQ), was added following the termination of tau induction, tau clearance was delayed.	Chloroquine	31-42	microtubule associated protein tau	Homo sapiens	88-91
18182162-4	2008	Using three different lysosomal inhibitors, NH(4)Cl, chloroquine and leupeptin, we now demonstrate involvement of the lysosomal degradation pathway in Kir2.1 breakdown.	Chloroquine	53-64	potassium inwardly rectifying channel subfamily J member 2	Homo sapiens	151-157
18294209-5	2008	When the lysosomotropic agent, chloroquine (CQ), was added following the termination of tau induction, tau clearance was delayed.	Chloroquine	31-42	microtubule associated protein tau	Homo sapiens	103-106
18294209-5	2008	When the lysosomotropic agent, chloroquine (CQ), was added following the termination of tau induction, tau clearance was delayed.	Chloroquine	44-46	microtubule associated protein tau	Homo sapiens	88-91
18294209-5	2008	When the lysosomotropic agent, chloroquine (CQ), was added following the termination of tau induction, tau clearance was delayed.	Chloroquine	44-46	microtubule associated protein tau	Homo sapiens	103-106
18294209-7	2008	When present during tau induction, CQ led to tau accumulation and promoted the formation of sarkosyl-insoluble aggregates containing both truncated and full-length tau.	Chloroquine	35-37	microtubule associated protein tau	Homo sapiens	20-23
18294209-7	2008	When present during tau induction, CQ led to tau accumulation and promoted the formation of sarkosyl-insoluble aggregates containing both truncated and full-length tau.	Chloroquine	35-37	microtubule associated protein tau	Homo sapiens	45-48
18294209-7	2008	When present during tau induction, CQ led to tau accumulation and promoted the formation of sarkosyl-insoluble aggregates containing both truncated and full-length tau.	Chloroquine	35-37	microtubule associated protein tau	Homo sapiens	45-48
18294209-8	2008	CQ treatment significantly decreased the activities of cathepsins D, B and L, and the inhibition of cathepsins B and L mimicked the effect of CQ and increased tau levels in cells.	Chloroquine	0-2	microtubule associated protein tau	Homo sapiens	159-162
18055026-3	2008	We demonstrated that CQ affects the activation of p38 mitogen-activated protein kinase (MAPK) and extracellular signal-regulated kinase (ERK).	Chloroquine	21-23	mitogen-activated protein kinase 14	Homo sapiens	50-86
18174273-10	2008	The effect of TNF-alpha was prevented by the lysosomal protease inhibitors leupeptin or chloroquine or by the proteasome inhibitors MG132 or lactacystin, suggesting a cytokine-induced AQP8 proteolysis.	Chloroquine	88-99	tumor necrosis factor	Rattus norvegicus	14-23
18055026-3	2008	We demonstrated that CQ affects the activation of p38 mitogen-activated protein kinase (MAPK) and extracellular signal-regulated kinase (ERK).	Chloroquine	21-23	mitogen-activated protein kinase 1	Homo sapiens	88-92
18055026-3	2008	We demonstrated that CQ affects the activation of p38 mitogen-activated protein kinase (MAPK) and extracellular signal-regulated kinase (ERK).	Chloroquine	21-23	mitogen-activated protein kinase 1	Homo sapiens	98-135
18055026-3	2008	We demonstrated that CQ affects the activation of p38 mitogen-activated protein kinase (MAPK) and extracellular signal-regulated kinase (ERK).	Chloroquine	21-23	mitogen-activated protein kinase 1	Homo sapiens	137-140
19088425-5	2008	The chloroquine-treated Bcap-37 cells exhibited a marked decrease in the level of mitochondrial transmembrane potential (DeltaPsim), which was accompanied by the activation of caspase-3 and cleaved poly(ADP-ribose) polymerase (PARP).	Chloroquine	4-15	poly(ADP-ribose) polymerase 1	Homo sapiens	227-231
19088425-0	2008	Cell growth inhibition, G2/M cell cycle arrest, and apoptosis induced by chloroquine in human breast cancer cell line Bcap-37.	Chloroquine	73-84	prohibitin 2	Homo sapiens	118-125
18216262-0	2008	The molecular basis of chloroquine block of the inward rectifier Kir2.1 channel.	Chloroquine	23-34	potassium inwardly rectifying channel subfamily J member 2	Homo sapiens	65-71
18216262-3	2008	In this study, we characterized the biophysical and molecular basis of chloroquine block of Kir2.1 channels that underlie cardiac I(K1).	Chloroquine	71-82	potassium inwardly rectifying channel subfamily J member 2	Homo sapiens	92-98
18216262-6	2008	Molecular modeling suggested that chloroquine blocks Kir2.1 channels by plugging the cytoplasmic conduction pathway, stabilized by negatively charged and aromatic amino acids within a central pocket.	Chloroquine	34-45	potassium inwardly rectifying channel subfamily J member 2	Homo sapiens	53-59
18178819-6	2008	IL-10 and IL-12 p70 production, but not ERK activation, are blocked by chloroquine, an inhibitor of endosomal acidification.	Chloroquine	71-82	interleukin 10	Mus musculus	0-5
19088425-2	2008	The present study was undertaken to examine the effects of chloroquine on Bcap-37 human breast cancer cells" growth, cell cycle modulation, apoptosis induction, and associated molecular alterations in vitro.	Chloroquine	59-70	prohibitin 2	Homo sapiens	74-81
19088425-6	2008	Exposure of Bcap-37 cells to chloroquine also resulted in the induction of spindle abnormalities.	Chloroquine	29-40	prohibitin 2	Homo sapiens	12-19
19088425-3	2008	The chloroquine treatment decreased the viability of Bcap-37 cells in a concentration- and time-dependent manner, which correlated with G(2)/M phase cell cycle arrest.	Chloroquine	4-15	prohibitin 2	Homo sapiens	53-60
17913823-4	2007	The ability of WNV(Vero) to induce IFN-alpha in pDCs did not require viral replication and was prevented by the treatment of cells with bafilomycin A1 and chloroquine, suggesting that it was dependent on endosomal Toll-like receptor recognition.	Chloroquine	155-166	interferon alpha 1	Homo sapiens	35-44
19088425-4	2008	The chloroquine-mediated cell cycle arrest was associated with a decrease in protein levels/activity of polo-like kinase 1 (Plk1), phosphorylated cell division cycle 25C (Cdc25C), phosphorylated extracellular signal-regulated kinase 1/2 (ERK1/2), phosphorylated Akt.	Chloroquine	4-15	polo like kinase 1	Homo sapiens	104-122
19088425-4	2008	The chloroquine-mediated cell cycle arrest was associated with a decrease in protein levels/activity of polo-like kinase 1 (Plk1), phosphorylated cell division cycle 25C (Cdc25C), phosphorylated extracellular signal-regulated kinase 1/2 (ERK1/2), phosphorylated Akt.	Chloroquine	4-15	polo like kinase 1	Homo sapiens	124-128
19088425-4	2008	The chloroquine-mediated cell cycle arrest was associated with a decrease in protein levels/activity of polo-like kinase 1 (Plk1), phosphorylated cell division cycle 25C (Cdc25C), phosphorylated extracellular signal-regulated kinase 1/2 (ERK1/2), phosphorylated Akt.	Chloroquine	4-15	cell division cycle 25C	Homo sapiens	171-177
19088425-4	2008	The chloroquine-mediated cell cycle arrest was associated with a decrease in protein levels/activity of polo-like kinase 1 (Plk1), phosphorylated cell division cycle 25C (Cdc25C), phosphorylated extracellular signal-regulated kinase 1/2 (ERK1/2), phosphorylated Akt.	Chloroquine	4-15	mitogen-activated protein kinase 1	Homo sapiens	195-236
19088425-4	2008	The chloroquine-mediated cell cycle arrest was associated with a decrease in protein levels/activity of polo-like kinase 1 (Plk1), phosphorylated cell division cycle 25C (Cdc25C), phosphorylated extracellular signal-regulated kinase 1/2 (ERK1/2), phosphorylated Akt.	Chloroquine	4-15	mitogen-activated protein kinase 3	Homo sapiens	238-244
19088425-4	2008	The chloroquine-mediated cell cycle arrest was associated with a decrease in protein levels/activity of polo-like kinase 1 (Plk1), phosphorylated cell division cycle 25C (Cdc25C), phosphorylated extracellular signal-regulated kinase 1/2 (ERK1/2), phosphorylated Akt.	Chloroquine	4-15	AKT serine/threonine kinase 1	Homo sapiens	262-265
19088425-5	2008	The chloroquine-treated Bcap-37 cells exhibited a marked decrease in the level of mitochondrial transmembrane potential (DeltaPsim), which was accompanied by the activation of caspase-3 and cleaved poly(ADP-ribose) polymerase (PARP).	Chloroquine	4-15	prohibitin 2	Homo sapiens	24-31
19088425-5	2008	The chloroquine-treated Bcap-37 cells exhibited a marked decrease in the level of mitochondrial transmembrane potential (DeltaPsim), which was accompanied by the activation of caspase-3 and cleaved poly(ADP-ribose) polymerase (PARP).	Chloroquine	4-15	caspase 3	Homo sapiens	176-185
19088425-5	2008	The chloroquine-treated Bcap-37 cells exhibited a marked decrease in the level of mitochondrial transmembrane potential (DeltaPsim), which was accompanied by the activation of caspase-3 and cleaved poly(ADP-ribose) polymerase (PARP).	Chloroquine	4-15	poly(ADP-ribose) polymerase 1	Homo sapiens	198-225
18097478-4	2008	reported in this issue of the JCI, indicate that autophagy can provide a means for cell survival when nutrients are limiting, such that inhibition of autophagy by the antimalarial drug chloroquine can inhibit tumorigenesis, specifically Myc-induced lymphoma in mice (see the related article beginning on page 79).	Chloroquine	185-196	myelocytomatosis oncogene	Mus musculus	237-240
18097482-2	2008	Here we show that chloroquine, a drug that activates the stress-responsive Atm-p53 tumor-suppressor pathway, preferentially enhances the death of Myc oncogene-overexpressing primary mouse B cells and mouse embryonic fibroblasts (MEFs) and impairs Myc-induced lymphomagenesis in a transgenic mouse model of human Burkitt lymphoma.	Chloroquine	18-29	ataxia telangiectasia mutated	Mus musculus	75-78
18097482-2	2008	Here we show that chloroquine, a drug that activates the stress-responsive Atm-p53 tumor-suppressor pathway, preferentially enhances the death of Myc oncogene-overexpressing primary mouse B cells and mouse embryonic fibroblasts (MEFs) and impairs Myc-induced lymphomagenesis in a transgenic mouse model of human Burkitt lymphoma.	Chloroquine	18-29	transformation related protein 53, pseudogene	Mus musculus	79-82
18097482-2	2008	Here we show that chloroquine, a drug that activates the stress-responsive Atm-p53 tumor-suppressor pathway, preferentially enhances the death of Myc oncogene-overexpressing primary mouse B cells and mouse embryonic fibroblasts (MEFs) and impairs Myc-induced lymphomagenesis in a transgenic mouse model of human Burkitt lymphoma.	Chloroquine	18-29	myelocytomatosis oncogene	Mus musculus	146-149
18097482-2	2008	Here we show that chloroquine, a drug that activates the stress-responsive Atm-p53 tumor-suppressor pathway, preferentially enhances the death of Myc oncogene-overexpressing primary mouse B cells and mouse embryonic fibroblasts (MEFs) and impairs Myc-induced lymphomagenesis in a transgenic mouse model of human Burkitt lymphoma.	Chloroquine	18-29	myelocytomatosis oncogene	Mus musculus	247-250
18097482-3	2008	Chloroquine-induced cell death in primary MEFs and human colorectal cancer cells was dependent upon p53, but not upon the p53 modulators Atm or Arf.	Chloroquine	0-11	tumor protein p53	Homo sapiens	100-103
18097482-4	2008	Accordingly, chloroquine impaired spontaneous lymphoma development in Atm-deficient mice, a mouse model of ataxia telangiectasia, but not in p53-deficient mice.	Chloroquine	13-24	ataxia telangiectasia mutated	Mus musculus	70-73
18097482-7	2008	However, when both apoptotic and autophagic pathways were blocked simultaneously, chloroquine-induced killing of Myc-overexpressing cells was blunted.	Chloroquine	82-93	myelocytomatosis oncogene	Mus musculus	113-116
18097482-8	2008	Thus chloroquine induces lysosomal stress and provokes a p53-dependent cell death that does not require caspase-mediated apoptosis.	Chloroquine	5-16	transformation related protein 53, pseudogene	Mus musculus	57-60
18220957-4	2007	TLR7/9 antagonists, such as the anti-malaria drugs chloroquine, hydroxychloroquine and quinacrine, have been used since the 1950s to treat immune-mediated inflammatory disorders (IMID) such as rheumatoid arthritis (RA), systemic lupus erythematosus (SLE) and Sjogren"s syndrome.	Chloroquine	51-62	toll like receptor 7	Homo sapiens	0-4
18089834-0	2007	Ataxia telangiectasia-mutated and p53 are potential mediators of chloroquine-induced resistance to mammary carcinogenesis.	Chloroquine	65-76	ataxia telangiectasia mutated	Mus musculus	0-29
18089834-0	2007	Ataxia telangiectasia-mutated and p53 are potential mediators of chloroquine-induced resistance to mammary carcinogenesis.	Chloroquine	65-76	transformation related protein 53, pseudogene	Mus musculus	34-37
18089834-5	2007	No protection was seen in our BALB/c p53-null mammary epithelium model, indicating a p53 dependency for the chloroquine effect.	Chloroquine	108-119	transformation related protein 53, pseudogene	Mus musculus	85-88
18089834-6	2007	Using a human nontumorigenic mammary gland epithelial cell line, MCF10A, we confirm that in the absence of detectable DNA damage, chloroquine activates the tumor-suppressor p53 and the p53 downstream target gene p21, resulting in G(1) cell cycle arrest.	Chloroquine	130-141	tumor protein p53	Homo sapiens	173-176
18089834-6	2007	Using a human nontumorigenic mammary gland epithelial cell line, MCF10A, we confirm that in the absence of detectable DNA damage, chloroquine activates the tumor-suppressor p53 and the p53 downstream target gene p21, resulting in G(1) cell cycle arrest.	Chloroquine	130-141	tumor protein p53	Homo sapiens	185-188
18089834-6	2007	Using a human nontumorigenic mammary gland epithelial cell line, MCF10A, we confirm that in the absence of detectable DNA damage, chloroquine activates the tumor-suppressor p53 and the p53 downstream target gene p21, resulting in G(1) cell cycle arrest.	Chloroquine	130-141	H3 histone pseudogene 16	Homo sapiens	212-215
18089834-7	2007	p53 activation occurs at a posttranslational level via chloroquine-dependent phosphorylation of the checkpoint protein kinase, ataxia telangiectasia-mutated (ATM), leading to ATM-dependent phosphorylation of p53.	Chloroquine	55-66	tumor protein p53	Homo sapiens	0-3
18089834-7	2007	p53 activation occurs at a posttranslational level via chloroquine-dependent phosphorylation of the checkpoint protein kinase, ataxia telangiectasia-mutated (ATM), leading to ATM-dependent phosphorylation of p53.	Chloroquine	55-66	ATM serine/threonine kinase	Homo sapiens	127-156
18089834-7	2007	p53 activation occurs at a posttranslational level via chloroquine-dependent phosphorylation of the checkpoint protein kinase, ataxia telangiectasia-mutated (ATM), leading to ATM-dependent phosphorylation of p53.	Chloroquine	55-66	ATM serine/threonine kinase	Homo sapiens	158-161
18089834-7	2007	p53 activation occurs at a posttranslational level via chloroquine-dependent phosphorylation of the checkpoint protein kinase, ataxia telangiectasia-mutated (ATM), leading to ATM-dependent phosphorylation of p53.	Chloroquine	55-66	ATM serine/threonine kinase	Homo sapiens	175-178
18089834-7	2007	p53 activation occurs at a posttranslational level via chloroquine-dependent phosphorylation of the checkpoint protein kinase, ataxia telangiectasia-mutated (ATM), leading to ATM-dependent phosphorylation of p53.	Chloroquine	55-66	tumor protein p53	Homo sapiens	208-211
18047806-9	2007	Our results show a possibility that chloroquine may be used in regulating GDH activity and subsequently glutamate concentration in the central nervous system.	Chloroquine	36-47	glutamate dehydrogenase 1	Homo sapiens	74-77
18047806-3	2007	Chloroquine has been known to be a potent inhibitor of house-keeping GDH1 in permeabilized liver and kidney-cortex of rabbit.	Chloroquine	0-11	glutamate dehydrogenase 1	Homo sapiens	69-73
17804388-4	2007	Inhibition of IFN-gamma secretion by chloroquine suggested that internalization of the TLR agonists was necessary.	Chloroquine	37-48	interferon gamma	Homo sapiens	14-23
18047806-4	2007	However, the effects of chloroquine on nerve-specific GDH2 have not been reported yet.	Chloroquine	24-35	glutamate dehydrogenase 2	Homo sapiens	54-58
18047806-5	2007	In the present study, we have investigated the effects of chloroquine on hGDH2 at various conditions and showed that chloroquine could inhibit the activity of hGDH2 at dose-dependent manner.	Chloroquine	58-69	glutamate dehydrogenase 2	Homo sapiens	73-78
18047806-5	2007	In the present study, we have investigated the effects of chloroquine on hGDH2 at various conditions and showed that chloroquine could inhibit the activity of hGDH2 at dose-dependent manner.	Chloroquine	58-69	glutamate dehydrogenase 2	Homo sapiens	159-164
18047806-5	2007	In the present study, we have investigated the effects of chloroquine on hGDH2 at various conditions and showed that chloroquine could inhibit the activity of hGDH2 at dose-dependent manner.	Chloroquine	117-128	glutamate dehydrogenase 2	Homo sapiens	73-78
18047806-5	2007	In the present study, we have investigated the effects of chloroquine on hGDH2 at various conditions and showed that chloroquine could inhibit the activity of hGDH2 at dose-dependent manner.	Chloroquine	117-128	glutamate dehydrogenase 2	Homo sapiens	159-164
18047806-6	2007	Studies of the chloroquine inhibition on enzyme activity revealed that hGDH2 was relatively less sensitive to chloroquine inhibition than house-keeping hGDH1.	Chloroquine	15-26	glutamate dehydrogenase 2	Homo sapiens	71-76
18047806-6	2007	Studies of the chloroquine inhibition on enzyme activity revealed that hGDH2 was relatively less sensitive to chloroquine inhibition than house-keeping hGDH1.	Chloroquine	110-121	glutamate dehydrogenase 2	Homo sapiens	71-76
18047806-8	2007	The inhibitory effect of chloroquine on hGDH2 was abolished, although in part, by the presence of ADP and L-leucine, whereas GTP did not change the sensitivity to chloroquine inhibition.	Chloroquine	25-36	glutamate dehydrogenase 2	Homo sapiens	40-45
17986857-6	2007	Furthermore, the invasion of 95D cells and TLR9 modifying 95C cells were significantly enhanced by stimulation of CpG ODN, which could be abrogated by inhibitory CpG ODN and chloroquine.	Chloroquine	174-185	toll like receptor 9	Homo sapiens	43-47
17363733-6	2007	Disrupting autophagy by chloroquine treatment enhances SAHA-induced superoxide generation, triggers relocalization and marked increases in the lysosomal protease cathepsin D, and reduces the expression of the cathepsin-D substrate thioredoxin.	Chloroquine	24-35	cathepsin D	Homo sapiens	162-173
17893430-6	2007	Chloroquine treatment was also used for its inhibitory effect on endosomal acidification process to verify specific CpG-ODN and Toll Like Receptor 9 (TLR9) interactions.	Chloroquine	0-11	toll like receptor 9	Homo sapiens	128-148
17893430-6	2007	Chloroquine treatment was also used for its inhibitory effect on endosomal acidification process to verify specific CpG-ODN and Toll Like Receptor 9 (TLR9) interactions.	Chloroquine	0-11	toll like receptor 9	Homo sapiens	150-154
17521388-4	2007	Here, for the first time we show WRN translocation following treatment with chloroquine (CHL) or trichostatin A (TSA), agents that alter chromatin structure without producing DNA breaks.	Chloroquine	76-87	WRN RecQ like helicase	Homo sapiens	33-36
17521388-4	2007	Here, for the first time we show WRN translocation following treatment with chloroquine (CHL) or trichostatin A (TSA), agents that alter chromatin structure without producing DNA breaks.	Chloroquine	89-92	WRN RecQ like helicase	Homo sapiens	33-36
17538027-5	2007	Impairment of Rab11A function led to a missorting of Langerin to lysosomal compartments, but inhibition of Langerin degradation by chloroquine did not restore the formation of BGs.	Chloroquine	131-142	CD207 molecule	Homo sapiens	107-115
17478539-9	2007	Internalization was prevented by the epidermal growth factor receptor kinase inhibitor tyrphostin-AG1478, and re-expression was prohibited by the protein synthesis inhibitor cylcoheximide; the lysosome inhibitor chloroquine promoted accumulation of NKCC1 vesicles.	Chloroquine	212-223	solute carrier family 12 member 2	Homo sapiens	249-254
18078069-0	2007	[Study of the binding of nuclear proteins from Plasmodium berghei strains with different chloroquine sensitivity to oligonucleotides corresponding to regulatory elements of multidrug resistance (mdr1) gene].	Chloroquine	89-100	ATP binding cassette subfamily B member 1	Homo sapiens	195-199
17363733-6	2007	Disrupting autophagy by chloroquine treatment enhances SAHA-induced superoxide generation, triggers relocalization and marked increases in the lysosomal protease cathepsin D, and reduces the expression of the cathepsin-D substrate thioredoxin.	Chloroquine	24-35	thioredoxin	Homo sapiens	231-242
17363733-6	2007	Disrupting autophagy by chloroquine treatment enhances SAHA-induced superoxide generation, triggers relocalization and marked increases in the lysosomal protease cathepsin D, and reduces the expression of the cathepsin-D substrate thioredoxin.	Chloroquine	24-35	cathepsin D	Homo sapiens	209-220
17525732-4	2007	ATMIN and ATM co-localised in response to ATM activation by chloroquine and hypotonic stress, but not after induction of double-strand breaks by ionising radiation (IR).	Chloroquine	60-71	ATM interactor	Mus musculus	0-5
17579020-4	2007	The rODNs promoted the survival of macrophages and were able to activate IL-8 secretion through a chloroquine-resistant pathway.	Chloroquine	98-109	C-X-C motif chemokine ligand 8	Homo sapiens	73-77
17488973-10	2007	Both lactacystin (a proteasome inhibitor) and chloroquine (a lysosome inhibitor) blocked GH-induced GHR loss.	Chloroquine	46-57	growth hormone receptor	Homo sapiens	100-103
17525732-4	2007	ATMIN and ATM co-localised in response to ATM activation by chloroquine and hypotonic stress, but not after induction of double-strand breaks by ionising radiation (IR).	Chloroquine	60-71	ataxia telangiectasia mutated	Mus musculus	0-3
17525732-4	2007	ATMIN and ATM co-localised in response to ATM activation by chloroquine and hypotonic stress, but not after induction of double-strand breaks by ionising radiation (IR).	Chloroquine	60-71	ataxia telangiectasia mutated	Mus musculus	10-13
17604450-7	2007	Chloroquine, bafilomycin-A1, and short hairpin RNAs against dynamin-2 inhibited viral production, indicating that viral entry occurs through pH-dependent endocytosis.	Chloroquine	0-11	dynamin 2	Homo sapiens	60-69
17456179-4	2007	Peritoneal macrophages from chloroquine-treated infected mice showed higher H(2)O(2) production and TfR expression, and decreased levels of NO, endogenous and stimulated-TNF-alpha, IL-6 and IL-10 during the three evaluated periods.	Chloroquine	28-39	transferrin receptor	Mus musculus	100-103
17456179-4	2007	Peritoneal macrophages from chloroquine-treated infected mice showed higher H(2)O(2) production and TfR expression, and decreased levels of NO, endogenous and stimulated-TNF-alpha, IL-6 and IL-10 during the three evaluated periods.	Chloroquine	28-39	tumor necrosis factor	Mus musculus	170-179
17456179-4	2007	Peritoneal macrophages from chloroquine-treated infected mice showed higher H(2)O(2) production and TfR expression, and decreased levels of NO, endogenous and stimulated-TNF-alpha, IL-6 and IL-10 during the three evaluated periods.	Chloroquine	28-39	interleukin 6	Mus musculus	181-185
17456179-4	2007	Peritoneal macrophages from chloroquine-treated infected mice showed higher H(2)O(2) production and TfR expression, and decreased levels of NO, endogenous and stimulated-TNF-alpha, IL-6 and IL-10 during the three evaluated periods.	Chloroquine	28-39	interleukin 10	Mus musculus	190-195
17373717-9	2007	Treatment of TLR9(+), but not TLR9(-) CaP cells with CpG-ODNs or bacterial DNA increased their invasion, which was inhibited with chloroquine.	Chloroquine	130-141	toll like receptor 9	Homo sapiens	13-17
17475845-5	2007	Chloroquine treatment markedly inhibited exogenous Ag presentation by wild-type CD1d transfectants, but did not affect NKT autoreactive responses.	Chloroquine	0-11	CD1d molecule	Homo sapiens	80-84
17263871-1	2007	BACKGROUND: Chloroquine (CQ) has been shown to inhibit HIV-1 replication in vitro as well as in vivo and has been proposed to alter the glycosylation pattern of the gp120 envelope.	Chloroquine	12-23	Envelope surface glycoprotein gp160, precursor	Human immunodeficiency virus 1	165-170
17477867-6	2007	Moreover, there was a clear correlation between the EC50 of chloroquine in vitro and the electrostatic potential of the HA subunit (HA2) mediating the virus/cell fusion process.	Chloroquine	60-71	keratin 32	Homo sapiens	132-135
17253962-5	2007	We also demonstrate that hT2R14 is a receptor for aristolochic acid and report the first characterization of the ligand specificities of hT2R7, which is a broadly tuned receptor responding to strychnine, quinacrine, chloroquine and papaverine.	Chloroquine	216-227	taste 2 receptor member 14	Homo sapiens	25-31
17253962-5	2007	We also demonstrate that hT2R14 is a receptor for aristolochic acid and report the first characterization of the ligand specificities of hT2R7, which is a broadly tuned receptor responding to strychnine, quinacrine, chloroquine and papaverine.	Chloroquine	216-227	taste 2 receptor member 7	Homo sapiens	137-142
17464186-4	2007	We found that endosomal maturation inhibitors, chloroquine and bafilomycin A, block CpG ODN-induced ERK and p38 MAPK activation and the subsequent MMP-9 expression.	Chloroquine	47-58	mitogen-activated protein kinase 1	Mus musculus	100-103
17464186-4	2007	We found that endosomal maturation inhibitors, chloroquine and bafilomycin A, block CpG ODN-induced ERK and p38 MAPK activation and the subsequent MMP-9 expression.	Chloroquine	47-58	mitogen-activated protein kinase 14	Mus musculus	108-111
17464186-4	2007	We found that endosomal maturation inhibitors, chloroquine and bafilomycin A, block CpG ODN-induced ERK and p38 MAPK activation and the subsequent MMP-9 expression.	Chloroquine	47-58	matrix metallopeptidase 9	Mus musculus	147-152
17521621-4	2007	Chloroquine, which inhibits the function of intracellular TLRs, including TLR9, completely abrogated detectable cytokine and chemokine release in spleen cells from TLR2(-/-)xTLR4(-/-) mice, similar to what is observed for mice deficient in MyD88.	Chloroquine	0-11	toll-like receptor 9	Mus musculus	74-78
17521621-4	2007	Chloroquine, which inhibits the function of intracellular TLRs, including TLR9, completely abrogated detectable cytokine and chemokine release in spleen cells from TLR2(-/-)xTLR4(-/-) mice, similar to what is observed for mice deficient in MyD88.	Chloroquine	0-11	toll-like receptor 2	Mus musculus	164-168
17521621-4	2007	Chloroquine, which inhibits the function of intracellular TLRs, including TLR9, completely abrogated detectable cytokine and chemokine release in spleen cells from TLR2(-/-)xTLR4(-/-) mice, similar to what is observed for mice deficient in MyD88.	Chloroquine	0-11	myeloid differentiation primary response gene 88	Mus musculus	240-245
17235397-7	2007	Inhibition of autophagy with either chloroquine or ATG5 short hairpin RNA (shRNA) enhanced the ability of either p53 activation or alkylating drug therapy to induce tumor cell death.	Chloroquine	36-47	tumor protein p53	Homo sapiens	113-116
17287200-12	2007	The VP-induced disappearance of V2R-GFP was abolished by chloroquine, a lysosomal degradation inhibitor, but not by MG132, a proteosome inhibitor.	Chloroquine	57-68	arginine vasopressin	Homo sapiens	4-6
17287200-12	2007	The VP-induced disappearance of V2R-GFP was abolished by chloroquine, a lysosomal degradation inhibitor, but not by MG132, a proteosome inhibitor.	Chloroquine	57-68	arginine vasopressin receptor 2	Homo sapiens	32-35
17604495-8	2007	Chloroquine was also postulated to enhance insulin sensitivity, which suggests potential benefit in treating the metabolic syndrome-related erectile dysfunction.	Chloroquine	0-11	insulin	Homo sapiens	43-50
17350006-5	2007	Fibronectin processing can be inhibited by chloroquine, an inhibitor of lysosomal degradation, and can be enhanced by the overexpression of legumain, indicating that fibronectin degradation occurs in the presence of legumain in lysosomes from renal proximal tubular cells.	Chloroquine	43-54	fibronectin 1	Mus musculus	0-11
17445145-4	2007	Although chloroquine and quinine, the then recommended Lao national policy for uncomplicated malaria treatment, were the most common antimalarials prescribed - 65% gave incorrect doses and 70% did not know the side effects.	Chloroquine	9-20	interleukin 4 induced 1	Homo sapiens	55-58
17218309-6	2007	Down-regulation was time- and concentration-dependent, was partially blocked by proteasomal inhibition and reversed by chloroquine and an antagonist to S1P(1).	Chloroquine	119-130	sphingosine-1-phosphate receptor 1	Homo sapiens	152-158
17286541-10	2007	Chloroquine and dapsone, both substrates of CYP2C8, are also discussed in the same context.	Chloroquine	0-11	cytochrome P450 family 2 subfamily C member 8	Homo sapiens	44-50
17263871-1	2007	BACKGROUND: Chloroquine (CQ) has been shown to inhibit HIV-1 replication in vitro as well as in vivo and has been proposed to alter the glycosylation pattern of the gp120 envelope.	Chloroquine	25-27	Envelope surface glycoprotein gp160, precursor	Human immunodeficiency virus 1	165-170
17263871-4	2007	By analysing the gp120 envelope protein sequences from viruses cultured long-term in the absence or presence of CQ we demonstrate variant evolution patterns.	Chloroquine	112-114	inter-alpha-trypsin inhibitor heavy chain 4	Homo sapiens	17-22
17263871-6	2007	We also demonstrate that HIV-1 produced in the presence of CQ has a reduced capacity for transfer by Raji-DC-SIGN cells to CD4+ T-lymphocytes, indicating another means whereby virus transmission or replication may be reduced in vivo.	Chloroquine	59-61	CD209 molecule	Homo sapiens	106-113
17263871-7	2007	CONCLUSION: These results indicate that CQ should be considered as an HIV-1 therapeutic agent with its influence exerted through a number of mechanisms in vivo, including modulation of the gp120 structure.	Chloroquine	40-42	Envelope surface glycoprotein gp160, precursor	Human immunodeficiency virus 1	189-194
17541283-7	2007	Preincubation with 100 microM chloroquine significantly inhibited the expression of mRNA for RANTES, IP-10, and IL-8, stimulated by poly I:C, indicating that poly I:C may react with a receptor expressed inside the cells.	Chloroquine	30-41	C-C motif chemokine ligand 5	Homo sapiens	93-99
17202329-10	2007	Administration of chloroquine to virus-infected BBDR rats decreases the incidence of diabetes and decreases blood levels of IL-12p40.	Chloroquine	18-29	interleukin 12b	Mus musculus	124-132
17541283-7	2007	Preincubation with 100 microM chloroquine significantly inhibited the expression of mRNA for RANTES, IP-10, and IL-8, stimulated by poly I:C, indicating that poly I:C may react with a receptor expressed inside the cells.	Chloroquine	30-41	C-X-C motif chemokine ligand 10	Homo sapiens	101-106
17541283-7	2007	Preincubation with 100 microM chloroquine significantly inhibited the expression of mRNA for RANTES, IP-10, and IL-8, stimulated by poly I:C, indicating that poly I:C may react with a receptor expressed inside the cells.	Chloroquine	30-41	C-X-C motif chemokine ligand 8	Homo sapiens	112-116
16919890-1	2007	: chloroquine may modulate the renal tubular response to vasopressin either directly by inhibiting cyclic AMP generation, or indirectly via nitric oxide.	Chloroquine	2-13	arginine vasopressin	Homo sapiens	57-68
17402364-0	2007	Chloroquine treatment reduces the number of cutaneous HLA-DR+ and CD1a+ cells in patients with systemic lupus erythematosus.	Chloroquine	0-11	CD1a molecule	Homo sapiens	66-70
17402364-4	2007	The aim of our study was to determine the effect of chloroquine treatment on HLA-DR+ and CD1a+ cell number in locally irradiated (three minimal erythema doses of UVB) and normal appearing skin in SLE patients and healthy subjects.	Chloroquine	52-63	CD1a molecule	Homo sapiens	89-93
17402364-6	2007	Following three months of daily chloroquine treatment (250 mg), the HLA-DR+ and CD1a+ cell counts were significantly reduced in both irradiated and unirradiated sites of SLE patients, although still higher than in controls.	Chloroquine	32-43	CD1a molecule	Homo sapiens	80-84
16919890-6	2007	The following discussion will focus on the evidence that chloroquine is a stimulator of nitric oxide (NO), which mediates many of its renal actions (diuresis, natriuresis and an increase in both glomerular filtration rate (GFR) and plasma vasopressin).	Chloroquine	57-68	arginine vasopressin	Homo sapiens	239-250
16919890-7	2007	Chloroquine appears to modulate the renal tubular response to vasopressin either by directly inhibiting cAMP generation or indirectly via NO.	Chloroquine	0-11	arginine vasopressin	Homo sapiens	62-73
17368749-6	2007	Chloroquine has a number of biochemical activities but two of the most important are blocking transcription of cellular genes and proviruses activated by NF-kappaB and blocking the glycosylation of surface proteins on viruses and cells.	Chloroquine	0-11	nuclear factor kappa B subunit 1	Homo sapiens	154-163
17368749-7	2007	Concurrent with the development of resistance of the malaria parasite to chloroquine, HIV strains were quickly selected, which have enhanced transcription rates (by inclusion of multiple kappaB binding sites in their long terminal repeats by recombination) and enhanced infectivity (fusogenicity) (most likely by mutations in multiple viral genes that regulate glycosylation of Env).	Chloroquine	73-84	endogenous retrovirus group K member 20	Homo sapiens	378-381
17643062-6	2007	Further, the mRNA levels of UDP-N-acetylglucosamine 2-epimerase/N-acetylmannosamine kinase (GNE), which are associated with distal myopathy with rimmed vacuoles showing numerous rimmed vacuoles in its skeletal muscle, were not decreased in denervatedmuscles treated with chloroquine.	Chloroquine	271-282	glucosamine (UDP-N-acetyl)-2-epimerase/N-acetylmannosamine kinase	Rattus norvegicus	92-95
17161396-0	2006	Chloroquine-induced endocytic pathway abnormalities: Cellular model of GM1 ganglioside-induced Abeta fibrillogenesis in Alzheimer"s disease.	Chloroquine	0-11	beta amyloid protein precursor-like	Drosophila melanogaster	95-100
17212767-5	2007	In infected mice, treatment with CLQ downregulated expression of the anti-inflammatory cytokines, interleukin-10 and transforming growth factor-beta (TGF-beta), while PYR treatment upregulated TGF-beta.	Chloroquine	33-36	interleukin 10	Mus musculus	98-112
17161396-2	2006	To clarify the pathological relevance of these abnormalities to assembly of amyloid beta-protein (Abeta), we treated PC12 cells with chloroquine, which potently perturbs membrane trafficking from endosomes to lysosomes.	Chloroquine	133-144	amyloid beta precursor protein	Rattus norvegicus	98-103
17161396-3	2006	Chloroquine treatment induced accumulation of GM1 ganglioside (GM1) in Rab5-positive enlarged early endosomes and on the cell surface.	Chloroquine	0-11	Rab5	Drosophila melanogaster	71-75
16832700-2	2006	IP-10 was strongly reactive in the period before chloroquine/primaquine combined chemotherapy and disappeared after chemotherapy in all patients.	Chloroquine	49-60	C-X-C motif chemokine ligand 10	Homo sapiens	0-5
17069798-5	2006	Moreover, endogenous CIMPR and G-CIMPR-full, but not GFP-CIMPR-tail, drastically altered the characteristic distribution after treatment with chloroquine.	Chloroquine	142-153	insulin like growth factor 2 receptor	Homo sapiens	21-26
17069798-5	2006	Moreover, endogenous CIMPR and G-CIMPR-full, but not GFP-CIMPR-tail, drastically altered the characteristic distribution after treatment with chloroquine.	Chloroquine	142-153	insulin like growth factor 2 receptor	Homo sapiens	31-43
17069798-5	2006	Moreover, endogenous CIMPR and G-CIMPR-full, but not GFP-CIMPR-tail, drastically altered the characteristic distribution after treatment with chloroquine.	Chloroquine	142-153	insulin like growth factor 2 receptor	Homo sapiens	33-38
16751808-7	2006	Monensin and chloroquine prevented E-cadherin degradation to different extent, but only monensin effectively blocked the loss of E-cadherin from the junctional complexes.	Chloroquine	13-24	cadherin 1	Homo sapiens	35-45
17011046-6	2006	Chloroquine, inhibitor of endosomal maturation, completely inhibited cytokine production of LPS-treated DCs as well as unstimulated control in response to subsequent CpG DNA-stimulation, while it failed to delete the IL-12p40 and IL-10 production in poly(I:C)-treated DCs.	Chloroquine	0-11	interleukin 10	Mus musculus	230-235
17084711-8	2006	These results suggest that ATM-dependent stress pathways mediate susceptibility to the metabolic syndrome and that chloroquine or related agents promoting ATM activity could modulate insulin resistance and decrease vascular disease.	Chloroquine	115-126	ataxia telangiectasia mutated	Mus musculus	155-158
16697529-6	2006	Finally, a comparison of the strain means obtained here with previously collected data using nociceptive assays revealed a suggestive negative genetic correlation between chloroquine-induced itch and thermal pain, such that strains sensitive to pain are resistant to itch and vice versa.	Chloroquine	171-182	itchy, E3 ubiquitin protein ligase	Mus musculus	191-195
16982926-11	2006	These findings suggest that, in CpG DNA-stimulated human pDC, the induction of IRF-7, CXCL10, and CCL3 is mediated by the NF-kappaB/p38 MAPK pathway, and that IRF-7 is activated upstream of the activation of NF-kappaB/p38 MAPK in chloroquine-sensitive regulatory machinery, thereby leading to the expression of IFN-alpha.	Chloroquine	230-241	interferon regulatory factor 7	Homo sapiens	79-84
16982926-11	2006	These findings suggest that, in CpG DNA-stimulated human pDC, the induction of IRF-7, CXCL10, and CCL3 is mediated by the NF-kappaB/p38 MAPK pathway, and that IRF-7 is activated upstream of the activation of NF-kappaB/p38 MAPK in chloroquine-sensitive regulatory machinery, thereby leading to the expression of IFN-alpha.	Chloroquine	230-241	interferon regulatory factor 7	Homo sapiens	159-164
17084707-3	2006	In an interesting twist, the authors show that chloroquine, an antimalarial drug, also activates ATM, which inhibits JNK, and improves insulin sensitivity and cardiovascular effects.	Chloroquine	47-58	ATM serine/threonine kinase	Homo sapiens	97-100
17084707-3	2006	In an interesting twist, the authors show that chloroquine, an antimalarial drug, also activates ATM, which inhibits JNK, and improves insulin sensitivity and cardiovascular effects.	Chloroquine	47-58	mitogen-activated protein kinase 8	Homo sapiens	117-120
17084707-3	2006	In an interesting twist, the authors show that chloroquine, an antimalarial drug, also activates ATM, which inhibits JNK, and improves insulin sensitivity and cardiovascular effects.	Chloroquine	47-58	insulin	Homo sapiens	135-142
17084711-5	2006	Treatment of ATM+/+apoE-/- mice with low-dose chloroquine, an ATM activator, decreased atherosclerosis.	Chloroquine	46-57	ataxia telangiectasia mutated	Mus musculus	13-16
17084711-5	2006	Treatment of ATM+/+apoE-/- mice with low-dose chloroquine, an ATM activator, decreased atherosclerosis.	Chloroquine	46-57	apolipoprotein E	Mus musculus	19-23
17084711-5	2006	Treatment of ATM+/+apoE-/- mice with low-dose chloroquine, an ATM activator, decreased atherosclerosis.	Chloroquine	46-57	ataxia telangiectasia mutated	Mus musculus	62-65
17084711-6	2006	In an ATM-dependent manner, chloroquine decreased macrophage JNK activity, decreased macrophage lipoprotein lipase activity (a proatherogenic consequence of JNK activation), decreased blood pressure, and improved glucose tolerance.	Chloroquine	28-39	ataxia telangiectasia mutated	Mus musculus	6-9
17084711-6	2006	In an ATM-dependent manner, chloroquine decreased macrophage JNK activity, decreased macrophage lipoprotein lipase activity (a proatherogenic consequence of JNK activation), decreased blood pressure, and improved glucose tolerance.	Chloroquine	28-39	mitogen-activated protein kinase 8	Mus musculus	61-64
17084711-6	2006	In an ATM-dependent manner, chloroquine decreased macrophage JNK activity, decreased macrophage lipoprotein lipase activity (a proatherogenic consequence of JNK activation), decreased blood pressure, and improved glucose tolerance.	Chloroquine	28-39	mitogen-activated protein kinase 8	Mus musculus	157-160
16697529-6	2006	Finally, a comparison of the strain means obtained here with previously collected data using nociceptive assays revealed a suggestive negative genetic correlation between chloroquine-induced itch and thermal pain, such that strains sensitive to pain are resistant to itch and vice versa.	Chloroquine	171-182	itchy, E3 ubiquitin protein ligase	Mus musculus	267-271
16892149-6	2006	The expression of ERCC1 in the presence and absence of CQ in the radioresistant cells was significantly higher than that of sham-irradiated control cells by Western blot method.	Chloroquine	55-57	ERCC excision repair 1, endonuclease non-catalytic subunit	Homo sapiens	18-23
16901483-2	2006	Desipramine"s effect on acid ceramidase appeared specific for amphiphilic agents (desipramine, chlorpromazine, and chloroquine) but not other lysomotropic agents such as ammonium chloride and bafilomycin A1, and was not transcriptionally regulated.	Chloroquine	115-126	N-acylsphingosine amidohydrolase 1	Homo sapiens	24-39
16870179-4	2006	The endosomal acidification inhibitors, chloroquine or bafilomycin A, inhibited CpG ODN-induced TNF-alpha, TNFR-II, and MMP-9 expression.	Chloroquine	40-51	tumor necrosis factor	Homo sapiens	96-105
16870179-4	2006	The endosomal acidification inhibitors, chloroquine or bafilomycin A, inhibited CpG ODN-induced TNF-alpha, TNFR-II, and MMP-9 expression.	Chloroquine	40-51	TNF receptor superfamily member 1B	Homo sapiens	107-114
16870179-4	2006	The endosomal acidification inhibitors, chloroquine or bafilomycin A, inhibited CpG ODN-induced TNF-alpha, TNFR-II, and MMP-9 expression.	Chloroquine	40-51	matrix metallopeptidase 9	Homo sapiens	120-125
16418198-2	2006	The anti-rheumatic drug chloroquine has been shown to inhibit TNF-alpha, IL-1 and IL-6 production from mononuclear phagocytes.	Chloroquine	24-35	tumor necrosis factor	Homo sapiens	62-71
16779853-0	2006	Chloroquine normalizes aberrant transforming growth factor beta activity in cystic fibrosis bronchial epithelial cells.	Chloroquine	0-11	transforming growth factor beta 1	Homo sapiens	32-63
16779853-6	2006	Levels of TGF-beta were normalized with chloroquine indicating that the hyperacidification of the TGN of CF cells is responsible for the altered TGF-beta levels.	Chloroquine	40-51	transforming growth factor beta 1	Homo sapiens	145-153
16418198-0	2006	Chloroquine inhibits production of TNF-alpha, IL-1beta and IL-6 from lipopolysaccharide-stimulated human monocytes/macrophages by different modes.	Chloroquine	0-11	tumor necrosis factor	Homo sapiens	35-44
16782868-12	2006	The degradation of VRK1 is sensitive to chloroquine, an inhibitor of the late endosome-lysosome transport, and to serine protease inhibitors of the lysosomal pathway.	Chloroquine	40-51	VRK serine/threonine kinase 1	Homo sapiens	19-23
16418198-2	2006	The anti-rheumatic drug chloroquine has been shown to inhibit TNF-alpha, IL-1 and IL-6 production from mononuclear phagocytes.	Chloroquine	24-35	interleukin 1 beta	Homo sapiens	73-77
16418198-0	2006	Chloroquine inhibits production of TNF-alpha, IL-1beta and IL-6 from lipopolysaccharide-stimulated human monocytes/macrophages by different modes.	Chloroquine	0-11	interleukin 1 beta	Homo sapiens	46-54
16418198-0	2006	Chloroquine inhibits production of TNF-alpha, IL-1beta and IL-6 from lipopolysaccharide-stimulated human monocytes/macrophages by different modes.	Chloroquine	0-11	interleukin 6	Homo sapiens	59-63
16418198-2	2006	The anti-rheumatic drug chloroquine has been shown to inhibit TNF-alpha, IL-1 and IL-6 production from mononuclear phagocytes.	Chloroquine	24-35	interleukin 6	Homo sapiens	82-86
16418198-8	2006	RESULTS: TNF-alpha release from the cells was inhibited by chloroquine, whereas the steady-state level of TNF-alpha mRNA and synthesis of 26-kDa TNF-alpha precursor were not changed by chloroquine.	Chloroquine	59-70	tumor necrosis factor	Homo sapiens	9-18
16418198-9	2006	In contrast, chloroquine-induced inhibition of IL-1beta and IL-6 release was accompanied by a decrease in their steady-state mRNA levels.	Chloroquine	13-24	interleukin 1 beta	Homo sapiens	47-55
16418198-9	2006	In contrast, chloroquine-induced inhibition of IL-1beta and IL-6 release was accompanied by a decrease in their steady-state mRNA levels.	Chloroquine	13-24	interleukin 6	Homo sapiens	60-64
16418198-10	2006	The transcription rates of the IL-1beta and IL-6 genes were not changed by chloroquine, whereas the stability of IL-1beta and IL-6 mRNA was decreased by chloroquine.	Chloroquine	153-164	interleukin 1 beta	Homo sapiens	113-121
16418198-10	2006	The transcription rates of the IL-1beta and IL-6 genes were not changed by chloroquine, whereas the stability of IL-1beta and IL-6 mRNA was decreased by chloroquine.	Chloroquine	153-164	interleukin 6	Homo sapiens	126-130
16418198-12	2006	CONCLUSIONS: Our results indicate that chloroquine-mediated inhibition of TNF-alpha, IL-1beta and IL-6 synthesis occurs through different modes in lipopolysaccharide-stimulated human monocytes/macrophages: it blocks the conversion of cell-associated TNF-alpha precursor to mature soluble protein, whereas it reduces the levels of IL-1beta and IL-6 mRNA, at least in part, by decreasing their stability and by a pH-dependent mechanism.	Chloroquine	39-50	tumor necrosis factor	Homo sapiens	74-83
16418198-12	2006	CONCLUSIONS: Our results indicate that chloroquine-mediated inhibition of TNF-alpha, IL-1beta and IL-6 synthesis occurs through different modes in lipopolysaccharide-stimulated human monocytes/macrophages: it blocks the conversion of cell-associated TNF-alpha precursor to mature soluble protein, whereas it reduces the levels of IL-1beta and IL-6 mRNA, at least in part, by decreasing their stability and by a pH-dependent mechanism.	Chloroquine	39-50	interleukin 1 beta	Homo sapiens	85-93
16418198-12	2006	CONCLUSIONS: Our results indicate that chloroquine-mediated inhibition of TNF-alpha, IL-1beta and IL-6 synthesis occurs through different modes in lipopolysaccharide-stimulated human monocytes/macrophages: it blocks the conversion of cell-associated TNF-alpha precursor to mature soluble protein, whereas it reduces the levels of IL-1beta and IL-6 mRNA, at least in part, by decreasing their stability and by a pH-dependent mechanism.	Chloroquine	39-50	interleukin 6	Homo sapiens	98-102
16418198-12	2006	CONCLUSIONS: Our results indicate that chloroquine-mediated inhibition of TNF-alpha, IL-1beta and IL-6 synthesis occurs through different modes in lipopolysaccharide-stimulated human monocytes/macrophages: it blocks the conversion of cell-associated TNF-alpha precursor to mature soluble protein, whereas it reduces the levels of IL-1beta and IL-6 mRNA, at least in part, by decreasing their stability and by a pH-dependent mechanism.	Chloroquine	39-50	tumor necrosis factor	Homo sapiens	250-259
16418198-12	2006	CONCLUSIONS: Our results indicate that chloroquine-mediated inhibition of TNF-alpha, IL-1beta and IL-6 synthesis occurs through different modes in lipopolysaccharide-stimulated human monocytes/macrophages: it blocks the conversion of cell-associated TNF-alpha precursor to mature soluble protein, whereas it reduces the levels of IL-1beta and IL-6 mRNA, at least in part, by decreasing their stability and by a pH-dependent mechanism.	Chloroquine	39-50	interleukin 1 beta	Homo sapiens	330-338
16772000-3	2006	After adjusting for CD4 count and plasma viral load, chloroquine was associated with a trend towards lower levels of HIV RNA in breast milk compared with sulfadoxine-pyrimethamine (P = 0.05).	Chloroquine	53-64	CD4 molecule	Homo sapiens	20-23
16418198-12	2006	CONCLUSIONS: Our results indicate that chloroquine-mediated inhibition of TNF-alpha, IL-1beta and IL-6 synthesis occurs through different modes in lipopolysaccharide-stimulated human monocytes/macrophages: it blocks the conversion of cell-associated TNF-alpha precursor to mature soluble protein, whereas it reduces the levels of IL-1beta and IL-6 mRNA, at least in part, by decreasing their stability and by a pH-dependent mechanism.	Chloroquine	39-50	interleukin 6	Homo sapiens	343-347
16670522-10	2006	The addition of chloroquine abolished the inhibitory effects of ISS-ODNs on colonic TNF-alpha and IL-1beta generation.	Chloroquine	16-27	tumor necrosis factor	Homo sapiens	84-93
16622236-7	2006	The IL-8 secretion in response to P. aeruginosa DNA was decreased by treatments that inhibit acidification of intracellular organelles, using chloroquine, a pH-neutralizing compound, or bafilomycin A1, an inhibitor of vacuolar H+-ATPase.	Chloroquine	142-153	C-X-C motif chemokine ligand 8	Homo sapiens	4-8
16670522-10	2006	The addition of chloroquine abolished the inhibitory effects of ISS-ODNs on colonic TNF-alpha and IL-1beta generation.	Chloroquine	16-27	interleukin 1 beta	Homo sapiens	98-106
16426903-4	2006	Chloroquine treatment and other manipulations that produce chromatin defects in the absence of detectable double strand breaks also trigger ATM phosphorylation and the phosphorylation of p53 in primary human fibroblasts, while other downstream substrates of ATM that are involved in the repair of DNA double strand breaks remain unphosphorylated.	Chloroquine	0-11	ATM serine/threonine kinase	Homo sapiens	140-143
16426903-4	2006	Chloroquine treatment and other manipulations that produce chromatin defects in the absence of detectable double strand breaks also trigger ATM phosphorylation and the phosphorylation of p53 in primary human fibroblasts, while other downstream substrates of ATM that are involved in the repair of DNA double strand breaks remain unphosphorylated.	Chloroquine	0-11	tumor protein p53	Homo sapiens	187-190
16426903-4	2006	Chloroquine treatment and other manipulations that produce chromatin defects in the absence of detectable double strand breaks also trigger ATM phosphorylation and the phosphorylation of p53 in primary human fibroblasts, while other downstream substrates of ATM that are involved in the repair of DNA double strand breaks remain unphosphorylated.	Chloroquine	0-11	ATM serine/threonine kinase	Homo sapiens	258-261
16361256-9	2006	Furthermore, dissipation of the acidic lysosomal pH of TRP-ML1(-/-) cells by nigericin or chloroquine reversed the lysosomal storage disease phenotype.	Chloroquine	90-101	mucolipin TRP cation channel 1	Homo sapiens	55-62
16105889-6	2006	The ability of IL-15 to regulate IEL proliferation, perforin/granzyme dependent cytotoxicity, and apoptosis was tested by adding different combinations of IL-15, IL-15 blocking antibody, or chloroquine to IEL cultured alone or with Caco-2 cells as target.	Chloroquine	190-201	interleukin 15	Homo sapiens	15-20
16256240-0	2006	Nitric oxide might be involved in the chloroquine-improved insulin sensitivity: old treatment for global danger.	Chloroquine	38-49	insulin	Homo sapiens	59-66
16391239-1	2006	Treatment of cells with the macrolide antibiotic bafilomycin A1, an inhibitor of vacuolar (V)-ATPase, or with the lysosomotropic agent chloroquine, has been shown to pharmacologically inhibit autophagy as evidenced by an accumulation of autophagosomes, which in turn causes Bax-dependent apoptosis.	Chloroquine	135-146	BCL2 associated X, apoptosis regulator	Homo sapiens	274-277
16391239-4	2006	When added separately, chloroquine or high concentrations of bafilomycin A1 (&gt; or =10 nM) induced a dose-dependent inhibition of autophagy (as measured by an increase in LC3-II, a marker specific for autophagosomes), followed by caspase-3 activation and cell death.	Chloroquine	23-34	caspase 3	Homo sapiens	232-241
16391239-5	2006	When added in combination, bafilomycin A1 potently inhibited chloroquine-induced caspase-3 activity and cell death at concentrations (&lt; or =1 nM) that neither altered vacuolar acidification nor inhibited autophagy.	Chloroquine	61-72	caspase 3	Homo sapiens	81-90
16567503-6	2006	Chloroquine, an inhibitor of CpG-triggered cytokine secretion, blocked TLR9/MyD88-dependent cytokine secretion as expected but failed to inhibit CpG-induced Src family kinase activation and its dependent cellular responses.	Chloroquine	0-11	toll like receptor 9	Homo sapiens	71-75
16567503-6	2006	Chloroquine, an inhibitor of CpG-triggered cytokine secretion, blocked TLR9/MyD88-dependent cytokine secretion as expected but failed to inhibit CpG-induced Src family kinase activation and its dependent cellular responses.	Chloroquine	0-11	MYD88 innate immune signal transduction adaptor	Homo sapiens	76-81
16377635-11	2006	Chloroquine, an inhibitor of lysosomal-mediated degradation pathways, blocked the ability of Ank3 to enhance PDGFR degradation.	Chloroquine	0-11	ankyrin 3	Homo sapiens	93-97
16377635-11	2006	Chloroquine, an inhibitor of lysosomal-mediated degradation pathways, blocked the ability of Ank3 to enhance PDGFR degradation.	Chloroquine	0-11	platelet derived growth factor receptor beta	Homo sapiens	109-114
16761500-7	2006	After three-months of chloroquine therapy the mean level of IL-6, IL-18 and TNF-alpha decreased significantly.	Chloroquine	22-33	interleukin 6	Homo sapiens	60-64
16493030-9	2006	Inhibition studies indicate that the presentation of OVA MHC class I epitopes by DCs conditioned with CTB-OVA involves a proteasome-dependent and chloroquine-sensitive mechanism.	Chloroquine	146-157	phosphate cytidylyltransferase 1B, choline	Homo sapiens	102-105
16423036-7	2006	Furthermore, incubation of HCECs with an endosomal acidification inhibitor, chloroquine, markedly inhibited poly(I:C)-mediated IFN-beta expression in HCECs.	Chloroquine	76-87	interferon beta 1	Homo sapiens	127-135
16447232-0	2006	Acquired resistance to chloroquine in human CEM T cells is mediated by multidrug resistance-associated protein 1 and provokes high levels of cross-resistance to glucocorticoids.	Chloroquine	23-34	ATP binding cassette subfamily C member 1	Homo sapiens	71-112
16447232-4	2006	CQ resistance was associated with the specific overexpression of multidrug resistance-associated protein 1 (MRP-1), an ATP-driven drug efflux pump.	Chloroquine	0-2	ATP binding cassette subfamily C member 1	Homo sapiens	65-106
16447232-4	2006	CQ resistance was associated with the specific overexpression of multidrug resistance-associated protein 1 (MRP-1), an ATP-driven drug efflux pump.	Chloroquine	0-2	ATP binding cassette subfamily C member 1	Homo sapiens	108-113
16447232-5	2006	This was illustrated by 1) overexpression of MRP-1 by Western blotting and 2) the complete reversal of CQ resistance by the MRP-1 transport inhibitors MK571 and probenecid.	Chloroquine	103-105	ATP binding cassette subfamily C member 1	Homo sapiens	45-50
16447232-5	2006	This was illustrated by 1) overexpression of MRP-1 by Western blotting and 2) the complete reversal of CQ resistance by the MRP-1 transport inhibitors MK571 and probenecid.	Chloroquine	103-105	ATP binding cassette subfamily C member 1	Homo sapiens	124-129
16447232-8	2006	Finally, CQ-resistant CEM cells displayed a markedly reduced capacity to release proinflammatory cytokines (tumor necrosis factor alpha) and chemokines (interleukin-8).	Chloroquine	9-11	tumor necrosis factor	Homo sapiens	108-135
16447232-8	2006	Finally, CQ-resistant CEM cells displayed a markedly reduced capacity to release proinflammatory cytokines (tumor necrosis factor alpha) and chemokines (interleukin-8).	Chloroquine	9-11	C-X-C motif chemokine ligand 8	Homo sapiens	153-166
16447232-9	2006	CONCLUSION: Induction of overexpression of the multidrug resistance efflux transporter MRP-1 can emerge after long-term exposure to CQ and results in CQ resistance and collateral resistance to dexamethasone.	Chloroquine	132-134	ATP binding cassette subfamily C member 1	Homo sapiens	87-92
16447232-9	2006	CONCLUSION: Induction of overexpression of the multidrug resistance efflux transporter MRP-1 can emerge after long-term exposure to CQ and results in CQ resistance and collateral resistance to dexamethasone.	Chloroquine	150-152	ATP binding cassette subfamily C member 1	Homo sapiens	87-92
16343632-2	2006	[Pd (CQ)2Cl2] (1) was synthesized by the reaction of PdCl2(CH3CN)2 with CQ, and the [Pd (CTZ)2Cl2] (2) complex by a similar reaction.	Chloroquine	5-7	phosducin like 2	Homo sapiens	53-58
16843615-2	2006	PRESENTATION OF THE HYPOTHESIS: Psychosis is caused by interactions with other drugs or by pharmacogenetic vulnerabilities that cause heightened responses to chloroquine or mefloquine alone, mediated through dopamine, acetylcholine, serotonin, P-glycoprotein, inhibited cortical activity, deranged calcium homeostasis, and impaired synaptogenesis.	Chloroquine	158-169	ATP binding cassette subfamily B member 1	Homo sapiens	244-258
16216434-0	2006	Chloroquine-induced nitric oxide improves insulin sensitivity in rheumatoid arthritis.	Chloroquine	0-11	insulin	Homo sapiens	42-49
16761500-7	2006	After three-months of chloroquine therapy the mean level of IL-6, IL-18 and TNF-alpha decreased significantly.	Chloroquine	22-33	interleukin 18	Homo sapiens	66-71
16761500-7	2006	After three-months of chloroquine therapy the mean level of IL-6, IL-18 and TNF-alpha decreased significantly.	Chloroquine	22-33	tumor necrosis factor	Homo sapiens	76-85
16144834-9	2005	The inhibitors of lysosome maturation, bafilomycin and chloroquine, inhibited the poly(I-C)-induced biological response in immune cells, showing that TLR3 interacted with its ligand in acidic subcellular compartments.	Chloroquine	55-66	toll like receptor 3	Homo sapiens	150-154
16536934-1	2006	OBJECTIVES: To assess the relationship between the genetic and phenotypic factors linked to the cytochrome P-450 enzyme system and the response to the antimalarial drugs chloroquine, amodiaquine, mefloquine, and proguanil, as well as to determine how certain biological and social factors of the host influence the behavior of this enzymatic complex.	Chloroquine	170-181	cytochrome P450 family 4 subfamily F member 3	Homo sapiens	96-112
16278001-6	2005	IFN induction by HIV-infected cells was also prevented by low-dose chloroquine, which inhibits endosomal acidification.	Chloroquine	67-78	interferon alpha 1	Homo sapiens	0-3
16253210-4	2005	Indeed, QR2 is strongly suspected to be the molecular target of anti-malarian drugs such as chloroquin or paraquine, and of red wine-derived resveratrol that might be responsible for the so-called French paradox.	Chloroquine	92-102	N-ribosyldihydronicotinamide:quinone reductase 2	Homo sapiens	8-11
16185660-4	2005	Expressed Kv1.5 had a half-life time of approximately 6.7 h, which was prolonged by the proteasome inhibitors of MG132, ALLN, proteasomal inhibitor 1, or lactacystine, but not by a lysosomal inhibitor chloroquine.	Chloroquine	201-212	potassium voltage-gated channel subfamily A member 5	Rattus norvegicus	10-15
16157687-0	2005	Chloroquine enhances human CD8+ T cell responses against soluble antigens in vivo.	Chloroquine	0-11	CD8a molecule	Homo sapiens	27-30
16033761-6	2005	Here we show that lysosomal inhibitors, chloroquine and NH(4)Cl, lead to accumulation of endogenous and ectopically expressed BACE in a variety of cell types, including primary neurons.	Chloroquine	40-51	beta-secretase 1	Homo sapiens	126-130
16157687-2	2005	We demonstrate that cross-presentation of soluble viral antigens (derived from hepatitis C virus [HCV], hepatitis B virus [HBV], or human immunodeficiency virus) to specific CD8+ T cell clones is dramatically improved when antigen-presenting dendritic cells (DCs) are pulsed with the antigen in the presence of chloroquine or ammonium chloride, which reduce acidification of the endocytic system.	Chloroquine	311-322	CD8a molecule	Homo sapiens	174-177
16157687-5	2005	Although all individuals showed a boost in antibody titers to HBV, six of nine individuals who were administered chloroquine showed a substantial CD8+ T cell response to HBV antigen, whereas zero of eight without chloroquine lacked a CD8 response.	Chloroquine	113-124	CD8a molecule	Homo sapiens	146-149
16157687-6	2005	Our results suggest that chloroquine treatment improves CD8 immunity during vaccination.	Chloroquine	25-36	CD8a molecule	Homo sapiens	56-59
15982641-0	2005	The effect of AZT and chloroquine on the activities of ricin and a saporin-transferrin chimeric toxin.	Chloroquine	22-33	transferrin	Homo sapiens	75-86
16148144-3	2005	Furthermore, the effect of HKBA can be inhibited by chloroquine, indicating that endosomal acidification is required and supporting the notion that DNA from HKBA is interacting with TLR9 at the level of the endosome, as is the case with CpG oligodeoxynucleotides.	Chloroquine	52-63	toll-like receptor 9	Mus musculus	182-186
16127065-7	2005	Here we show that combining furin inhibitors and chloroquine strongly augments the inhibition of toxin-dependent killing, suggesting that combined use of antifurin drugs and chloroquine might provide enhanced therapeutic benefits.	Chloroquine	174-185	furin (paired basic amino acid cleaving enzyme)	Mus musculus	28-33
15982641-1	2005	This study deals with the combination of chloroquine (CQ, an anti-malaric drug) and 3"-azido-3"-deoxythymidine (AZT, anti-human immuno-deficiency virus (HIV) drug) with a chimeric toxin (TS) obtained by chemical linking of saporin (a ribosome inactivating protein from the plant Saponaria officinalis) and human transferrin, in the intoxication of the human chronic myeloid leukaemia cells (K562).	Chloroquine	41-52	transferrin	Homo sapiens	312-323
15677378-8	2005	The lysosomal inhibitor chloroquine abolished this VP effect, whereas lactacystin, a proteasome inhibitor, had no effect.	Chloroquine	24-35	vasopressin	Sus scrofa	51-53
16011736-10	2005	MTX + CQ treatment decreased plasma AP and liver ALP activities in the arthritic rats to control values.	Chloroquine	6-8	PDZ and LIM domain 3	Rattus norvegicus	49-52
16034103-5	2005	TLR7/8 signaling is sensitive to chloroquine inhibition, indicating a requirement for lysosomal signaling as for other cell types.	Chloroquine	33-44	toll like receptor 7	Homo sapiens	0-4
15882977-2	2005	When expressed in COS cells, Kir6.2 was short-lived with a half-life time of 1.9 h. The half-life time of Kir6.2 was prolonged by proteasome inhibitors MG132, ALLN, proteasome inhibitor 1, and lactacystine, but not at all by a lysosomal inhibitor chloroquine.	Chloroquine	247-258	potassium inwardly-rectifying channel, subfamily J, member 11	Rattus norvegicus	29-35
15882977-2	2005	When expressed in COS cells, Kir6.2 was short-lived with a half-life time of 1.9 h. The half-life time of Kir6.2 was prolonged by proteasome inhibitors MG132, ALLN, proteasome inhibitor 1, and lactacystine, but not at all by a lysosomal inhibitor chloroquine.	Chloroquine	247-258	potassium inwardly-rectifying channel, subfamily J, member 11	Rattus norvegicus	106-112
15946605-4	2005	The levels of non-enzymic antioxidants (vitamin C, vitamin E and reduced glutathione) and enzymic antioxidants (superoxide dismutase, catalase and glutathione peroxidase) were also decreased in CQ treated rats.	Chloroquine	194-196	catalase	Rattus norvegicus	134-142
15930724-3	2005	The distribution of beta-G on a Percoll density gradient in chloroquine-treated cells was approximately similar to that of a cytosolic protein, mevalonate pyrophosphate decarboxylase, in nontreated cells.	Chloroquine	60-71	glucuronidase, beta	Rattus norvegicus	20-26
15930724-4	2005	Lamp-1 was decreased in the lysosomal fractions on a Percoll density gradient in chloroquine-treated cells, and was increased in the plasma membrane fraction, as compared with the levels in nontreated cells.	Chloroquine	81-92	lysosomal-associated membrane protein 1	Rattus norvegicus	0-6
15930724-5	2005	Furthermore, after cells were cultured in the presence and absence of chloroquine, the proportions of beta-G activity in the cytosolic fraction obtained from the digitonin-permeabilized cells were 19% and 4%, while those in the cytosolic fraction obtained by conventional cell fractionation were 54% and 26%, respectively.	Chloroquine	70-81	glucuronidase, beta	Rattus norvegicus	102-108
15854645-5	2005	The induction of TNF-alpha, IL-6 and interferon alpha (IFN-alpha) was chloroquine-sensitive and dependent more likely on endosomal Toll-like receptor signaling in particular TLR8.	Chloroquine	70-81	tumor necrosis factor	Homo sapiens	17-26
15854645-5	2005	The induction of TNF-alpha, IL-6 and interferon alpha (IFN-alpha) was chloroquine-sensitive and dependent more likely on endosomal Toll-like receptor signaling in particular TLR8.	Chloroquine	70-81	interleukin 6	Homo sapiens	28-32
15854645-5	2005	The induction of TNF-alpha, IL-6 and interferon alpha (IFN-alpha) was chloroquine-sensitive and dependent more likely on endosomal Toll-like receptor signaling in particular TLR8.	Chloroquine	70-81	interferon alpha 1	Homo sapiens	55-64
15854645-5	2005	The induction of TNF-alpha, IL-6 and interferon alpha (IFN-alpha) was chloroquine-sensitive and dependent more likely on endosomal Toll-like receptor signaling in particular TLR8.	Chloroquine	70-81	toll like receptor 8	Homo sapiens	174-178
15753096-7	2005	The rapid degradation of PDGFRbeta in the LRP1-deficient fibroblasts was prevented by MG132 and chloroquine.	Chloroquine	96-107	platelet derived growth factor receptor, beta polypeptide	Mus musculus	25-34
15753096-7	2005	The rapid degradation of PDGFRbeta in the LRP1-deficient fibroblasts was prevented by MG132 and chloroquine.	Chloroquine	96-107	low density lipoprotein receptor-related protein 1	Mus musculus	42-46
15804288-9	2005	Stimulation of chicken TLR7 with R848 was chloroquine sensitive, suggesting signalling within an endosomal compartment, as for mammalian TLR7.	Chloroquine	42-53	toll like receptor 7	Gallus gallus	23-27
15712280-0	2005	Skeletal muscle expression of clathrin and mannose 6-phosphate receptor in experimental chloroquine-induced myopathy.	Chloroquine	88-99	mannose-6-phosphate receptor, cation dependent	Rattus norvegicus	43-71
15880991-0	2005	Anti-malarial chloroquine stimulate p53-apoptotic pathway in rat hepatocytes.	Chloroquine	14-25	Wistar clone pR53P1 p53 pseudogene	Rattus norvegicus	36-39
15880991-1	2005	The study investigated rat liver injury produced by anti-malarial dose of chloroquine (CQ) and to elucidate if CQ could induce DNA damage and subsequently p53-dependent apoptosis in rat hepatocytes or not.	Chloroquine	111-113	Wistar clone pR53P1 p53 pseudogene	Rattus norvegicus	155-158
15880991-2	2005	The effect of anti-malarial CQ on p53-apoptotic pathway of rat liver cells after different time intervals (1, 2 &amp; 3 days) was studied.	Chloroquine	28-30	Wistar clone pR53P1 p53 pseudogene	Rattus norvegicus	34-37
15880991-6	2005	Secondly, p53 expression was associated with CQ administration in time dependent manner.	Chloroquine	45-47	Wistar clone pR53P1 p53 pseudogene	Rattus norvegicus	10-13
15880991-7	2005	Thus, anti-malarial dose of CQ induces DNA damage and apoptosis of rat liver cells and the expression of p53 could be considered as a normal response of hepatocytes suffering from CQ genotoxic stress.	Chloroquine	180-182	Wistar clone pR53P1 p53 pseudogene	Rattus norvegicus	105-108
15712280-5	2005	Further, clathrin immunostaining and M6PR messenger ribonucleic acid (mRNA) were significantly increased in denervated soleus muscle from saline- and chloroquine-treated rats compared to contralateral, innervated muscles.	Chloroquine	150-161	mannose-6-phosphate receptor, cation dependent	Rattus norvegicus	37-41
15683746-0	2005	Chloroquine induces the expression of inducible nitric oxide synthase in C6 glioma cells.	Chloroquine	0-11	nitric oxide synthase 2	Homo sapiens	38-69
15683746-3	2005	In the present study, we investigated whether chloroquine stimulates inducible nitric oxide synthase (iNOS) expression and nitric oxide (NO) synthesis in C6 glioma cells.	Chloroquine	46-57	nitric oxide synthase 2	Homo sapiens	69-100
15683746-3	2005	In the present study, we investigated whether chloroquine stimulates inducible nitric oxide synthase (iNOS) expression and nitric oxide (NO) synthesis in C6 glioma cells.	Chloroquine	46-57	nitric oxide synthase 2	Homo sapiens	102-106
15683746-4	2005	Chloroquine caused dose-dependent increase in iNOS protein expression and NO production in C6 glioma cells.	Chloroquine	0-11	nitric oxide synthase 2	Homo sapiens	46-50
15683746-5	2005	A tyrosine kinase inhibitor (genistein), a protein kinase C (PKC) inhibitor (Ro 31-8220), and a p38 mitogen-activated protein kinase (MAPK) inhibitor (SB 203580) all respectively suppressed chloroquine-induced iNOS expression and NO release from C6 glioma cells.	Chloroquine	190-201	mitogen-activated protein kinase 14	Homo sapiens	96-132
15683746-6	2005	Chloroquine activates p38 MAPK and stimulates PKC-alpha and -delta translocation from the cytosol to the membrane in C6 glioma cells.	Chloroquine	0-11	mitogen-activated protein kinase 14	Homo sapiens	22-25
15683746-6	2005	Chloroquine activates p38 MAPK and stimulates PKC-alpha and -delta translocation from the cytosol to the membrane in C6 glioma cells.	Chloroquine	0-11	protein kinase C alpha	Homo sapiens	46-55
15683746-7	2005	Chloroquine-stimulated p38 MAPK activation was blocked by genistein (20 microM), Ro 31-8220 (3 microM), and SB 203580 (10 microM).	Chloroquine	0-11	mitogen-activated protein kinase 14	Homo sapiens	23-26
15683746-8	2005	Incubation of lipopolysaccharide (LPS)-stimulated cells with chloroquine at non-toxic concentrations (10-100 microM) for 48 h increased iNOS expression, and led to a significant loss of adherent cells.	Chloroquine	61-72	nitric oxide synthase 2	Homo sapiens	136-140
15683746-10	2005	Taken together, our data suggest that chloroquine may activate tyrosine kinase and/or PKC to induce p38 MAPK activation, which in turn induces iNOS expression and NO production.	Chloroquine	38-49	proline rich transmembrane protein 2	Homo sapiens	86-89
15683746-10	2005	Taken together, our data suggest that chloroquine may activate tyrosine kinase and/or PKC to induce p38 MAPK activation, which in turn induces iNOS expression and NO production.	Chloroquine	38-49	mitogen-activated protein kinase 14	Homo sapiens	100-103
15683746-10	2005	Taken together, our data suggest that chloroquine may activate tyrosine kinase and/or PKC to induce p38 MAPK activation, which in turn induces iNOS expression and NO production.	Chloroquine	38-49	nitric oxide synthase 2	Homo sapiens	143-147
15707965-2	2005	We found that ionophore monensin (Mon) and the quaternary amine chloroquine (CQ) discriminate between the traffic routes of TRP-2 and TRP-1.	Chloroquine	77-79	tRNA proline 2	Mus musculus	124-129
15590764-2	2005	METHODS: The Ellman method was used to determine the levels of salivary cholinesterase activity and the K(i) of both chloroquine and hydroxychloroquine for serum cholinesterase.	Chloroquine	117-128	butyrylcholinesterase	Homo sapiens	162-176
15707965-2	2005	We found that ionophore monensin (Mon) and the quaternary amine chloroquine (CQ) discriminate between the traffic routes of TRP-2 and TRP-1.	Chloroquine	77-79	tyrosinase-related protein 1	Mus musculus	134-139
15707965-4	2005	Mature TRP-2 is diverted by CQ treatment to a degradation pathway which depends on functional vacuolar ATPases.	Chloroquine	28-30	tRNA proline 2	Mus musculus	7-12
15905940-7	2005	RESULTS: In 28 eyes (63.6%) of chronic chloroquine users, alterations in more than two parameters by GDx were found.	Chloroquine	39-50	ubiquitin like 4A	Homo sapiens	101-104
15563605-9	2005	Fibronectin degradation occurs intracellularly after endocytosis and can be inhibited by chloroquine, an inhibitor of lysosomal degradation, and by caveolae-disrupting agents.	Chloroquine	89-100	fibronectin 1	Homo sapiens	0-11
15702993-5	2005	Clearance of LM from these phagosomes was controlled by the hydrolytic action of cathepsin-D as suggested by the lysosomal protease inhibitor chloroquine, or the cathepsin-D inhibitor, pepstatin A, which caused a reversion of listericidal activity.	Chloroquine	142-153	cathepsin D	Cricetulus griseus	81-92
16298876-1	2005	The current study examined the ability of antimalarials chloroquine (CQ), primaquine (PQ), and quinine (Q) to inhibit human erythrocyte membrane acetylcholinesterase (AChE) and the mechanisms underlying their inhibitory action.	Chloroquine	56-67	acetylcholinesterase (Cartwright blood group)	Homo sapiens	145-165
15667557-5	2005	When chloroquine was added the supernatant IFN-gamma concentration increased in the liposome group and decreased in the bacilliform/chromatoid conformation group .	Chloroquine	5-16	interferon gamma	Homo sapiens	43-52
16298876-1	2005	The current study examined the ability of antimalarials chloroquine (CQ), primaquine (PQ), and quinine (Q) to inhibit human erythrocyte membrane acetylcholinesterase (AChE) and the mechanisms underlying their inhibitory action.	Chloroquine	56-67	acetylcholinesterase (Cartwright blood group)	Homo sapiens	167-171
16298876-1	2005	The current study examined the ability of antimalarials chloroquine (CQ), primaquine (PQ), and quinine (Q) to inhibit human erythrocyte membrane acetylcholinesterase (AChE) and the mechanisms underlying their inhibitory action.	Chloroquine	69-71	acetylcholinesterase (Cartwright blood group)	Homo sapiens	145-165
16696308-10	2005	The content of Cyclin D1 in hippocampus and cerebral cortex was significantly higher in the PTZ group than in control and chloroquine intervening groups (P &lt; 0.05).	Chloroquine	122-133	cyclin D1	Rattus norvegicus	15-24
23105485-3	2005	CQ treatment resulted in increase in both the "free" and "total" activities of all the enzymes i.e. acid phosphatase, RNase II, DNase II and cathepsin D.	Chloroquine	0-2	cathepsin D	Rattus norvegicus	141-152
15265789-3	2004	In PPAR-gamma-null NK cells, 15-deoxy-Delta(12,14) prostaglandin J(2) (15d-PGJ(2)), a natural PPAR-gamma ligand, reduces IFN-gamma production that can be reversed by MG132 and/or chloroquine, and it inhibits cytolytic activity of NK cells through reduction of both conjugate formation and CD69 expression.	Chloroquine	179-190	interferon gamma	Homo sapiens	121-130
16313222-8	2005	Additional chloroquine effects included activation of cathepsin D and other lysosomal hydrolases.	Chloroquine	11-22	cathepsin D	Homo sapiens	54-65
15382077-7	2004	We show that the lysosomotropic amine chloroquine (CQ) augments receptor internalization in HER2-overexpressing cells either pretreated or continuously treated with HCT and leads to an increased and sustained inhibitory effect.	Chloroquine	38-49	erb-b2 receptor tyrosine kinase 2	Homo sapiens	92-96
15476661-4	2004	This study aimed to investigate the ability of DHEAS to enhance the antimalarial activity of CQ, via an inhibition of G6PD activity and GSH synthesis.	Chloroquine	93-95	glucose-6-phosphate dehydrogenase 2	Mus musculus	118-122
15476661-8	2004	Results demonstrate that acquisition of CQ resistance in P. berghei is associated with a significant increase in parasite G6PD activity and GSH level.	Chloroquine	40-42	glucose-6-phosphate dehydrogenase 2	Mus musculus	122-126
15528327-8	2004	HRSV-induced IFN-alpha production was independent of endosomal acidification and of protein kinase R (PKR) kinase activity, as demonstrated with chloroquine and the PKR inhibitor 2-aminopurine, respectively.	Chloroquine	145-156	interferon alpha	Mus musculus	13-22
15382077-8	2004	The enhanced CQ-dependent loss of functional HER2 from the cell surface resulted in sustained inactivation of the serine/threonine kinase Akt, upregulation of p27Kip1 protein and inhibition of cyclin E/Cdk2 activity.	Chloroquine	13-15	cyclin dependent kinase inhibitor 1B	Homo sapiens	159-166
15382077-7	2004	We show that the lysosomotropic amine chloroquine (CQ) augments receptor internalization in HER2-overexpressing cells either pretreated or continuously treated with HCT and leads to an increased and sustained inhibitory effect.	Chloroquine	51-53	erb-b2 receptor tyrosine kinase 2	Homo sapiens	92-96
15382077-8	2004	The enhanced CQ-dependent loss of functional HER2 from the cell surface resulted in sustained inactivation of the serine/threonine kinase Akt, upregulation of p27Kip1 protein and inhibition of cyclin E/Cdk2 activity.	Chloroquine	13-15	cyclin dependent kinase 2	Homo sapiens	202-206
15382077-9	2004	Potentiation of the inhibitory effect of HCT by CQ was directly related to loss of HER2 from the plasma membrane since prevention of Ab-mediated receptor endocytosis by engagement of the receptor with immobilized HCT abrogated the effect of CQ.	Chloroquine	48-50	erb-b2 receptor tyrosine kinase 2	Homo sapiens	83-87
15382077-8	2004	The enhanced CQ-dependent loss of functional HER2 from the cell surface resulted in sustained inactivation of the serine/threonine kinase Akt, upregulation of p27Kip1 protein and inhibition of cyclin E/Cdk2 activity.	Chloroquine	13-15	erb-b2 receptor tyrosine kinase 2	Homo sapiens	45-49
15382077-8	2004	The enhanced CQ-dependent loss of functional HER2 from the cell surface resulted in sustained inactivation of the serine/threonine kinase Akt, upregulation of p27Kip1 protein and inhibition of cyclin E/Cdk2 activity.	Chloroquine	13-15	AKT serine/threonine kinase 1	Homo sapiens	138-141
15248023-7	2004	Lyso-somotropic compounds, such as chloroquine, drastically increased the ATF-lys10 mediated gene delivery efficiency.	Chloroquine	35-46	glial cell derived neurotrophic factor	Homo sapiens	74-77
15466883-8	2004	GLT-1 downregulation was greatly induced by inhibition of protein synthesis, and prevented by treatment with chloroquine aimed at inhibiting the activity of acidic degradative compartments.	Chloroquine	109-120	solute carrier family 1 member 2	Canis lupus familiaris	0-5
15307186-6	2004	Furthermore, chloroquine and quinacrine, therapeutic agents for autoimmune diseases like rheumatoid arthritis and systemic lupus erythematosus, directly blocked TLR9-CpG-DNA interaction but not TLR2-Pam3Cys binding.	Chloroquine	13-24	toll like receptor 9	Homo sapiens	161-165
15307186-7	2004	Our results demonstrate direct binding of TLR9 to CpG-DNA and suggest that the therapeutic activity of chloroquine and quinacrine in autoimmune diseases may be due to its activity as a TLR9 antagonist and inhibitor of endosomal acidification.	Chloroquine	103-114	toll like receptor 9	Homo sapiens	42-46
15307186-7	2004	Our results demonstrate direct binding of TLR9 to CpG-DNA and suggest that the therapeutic activity of chloroquine and quinacrine in autoimmune diseases may be due to its activity as a TLR9 antagonist and inhibitor of endosomal acidification.	Chloroquine	103-114	toll like receptor 9	Homo sapiens	185-189
15526909-4	2004	In addition, renal tissue from CQ-treated rats showed a significant increase in lipid peroxides measured as thiobarbituric acid reactive substances and hydroperoxides, along with significant decrease in nonenzymic antioxidants (vitamin C, vitamin E, and reduced glutathione) and enzymic antioxidants (superoxide dismutase, catalase, glutathione peroxidase, and glutathione-S-transferase) levels.	Chloroquine	31-33	catalase	Rattus norvegicus	323-331
15486837-1	2004	BACKGROUND: Recent clinical trials in the Lao People"s Democratic Republic have demonstrated that chloroquine and sulfadoxine-pyrimethamine, which are national malaria treatment policy, are no longer effective in the treatment of uncomplicated Plasmodium falciparum malaria.	Chloroquine	98-109	interleukin 4 induced 1	Homo sapiens	42-45
15132820-1	2004	AIM: To study the effect of chloroquine on the expression of human clotting factor IX (hFIX) in mice.	Chloroquine	28-39	coagulation factor IX	Homo sapiens	87-91
15132820-3	2004	RESULTS: The maximum expression of hFIX level was 4.4+/-1.8 mg/L at 8 h after injection, 9.7+/-1.6 mg/L at 24 h only existed in 200 micromol/L chloroquine-treated animals, which is 3-4 fold higher than that of control (P&lt;0.01).	Chloroquine	143-154	coagulation factor IX	Homo sapiens	35-39
14996414-5	2004	We found that 30 mg/kg of CQ could protect mice from lethal challenge by CpG ODN and LPS, and 25 mg/kg of CQ could decrease serum TNF-alpha and IL-6 in rats injected with sublethal doses of CpG ODN and LPS.	Chloroquine	106-108	tumor necrosis factor	Mus musculus	130-139
15076236-13	2004	The CQ/PI combination exerts combined inhibitory effects on P-gp and MRP1 function.	Chloroquine	4-6	ATP binding cassette subfamily B member 1	Homo sapiens	60-64
15076236-13	2004	The CQ/PI combination exerts combined inhibitory effects on P-gp and MRP1 function.	Chloroquine	4-6	ATP binding cassette subfamily C member 1	Homo sapiens	69-73
14975753-6	2004	Inhibition of acidification by chloroquine blocked VWF processing but allowed unprocessed pro-VWF targeting to dense organelles.	Chloroquine	31-42	Von Willebrand factor	Mus musculus	51-54
14975753-6	2004	Inhibition of acidification by chloroquine blocked VWF processing but allowed unprocessed pro-VWF targeting to dense organelles.	Chloroquine	31-42	Von Willebrand factor	Mus musculus	94-97
14676190-6	2004	Specific enlargement of Rab7-positive compartments induced by VacA could be mimicked by the weak base chloroquine alone, and the vacuolating activities of either chloroquine alone or VacA were blocked with the same potency by the anion channel blocker 5-nitro-2-(3-phenylpropylamino)-benzoic acid shown to inhibit VacA channel activity.	Chloroquine	102-113	RAB7B, member RAS oncogene family	Homo sapiens	24-28
14676190-6	2004	Specific enlargement of Rab7-positive compartments induced by VacA could be mimicked by the weak base chloroquine alone, and the vacuolating activities of either chloroquine alone or VacA were blocked with the same potency by the anion channel blocker 5-nitro-2-(3-phenylpropylamino)-benzoic acid shown to inhibit VacA channel activity.	Chloroquine	162-173	RAB7B, member RAS oncogene family	Homo sapiens	24-28
14996414-5	2004	We found that 30 mg/kg of CQ could protect mice from lethal challenge by CpG ODN and LPS, and 25 mg/kg of CQ could decrease serum TNF-alpha and IL-6 in rats injected with sublethal doses of CpG ODN and LPS.	Chloroquine	106-108	interleukin 6	Mus musculus	144-148
14996414-6	2004	In addition, treatment of murine macrophage ANA-1 cells with 2 mM CQ potently inhibited the release of TNF-alpha, IL-6 and IL-12 induced by CpG ODN and LPS.	Chloroquine	66-68	tumor necrosis factor	Mus musculus	103-112
14996414-6	2004	In addition, treatment of murine macrophage ANA-1 cells with 2 mM CQ potently inhibited the release of TNF-alpha, IL-6 and IL-12 induced by CpG ODN and LPS.	Chloroquine	66-68	interleukin 6	Mus musculus	114-118
14996414-7	2004	In human peripheral blood mononuclear cells (hPBMC), 100-200 microM CQ almost completely abrogated release of both TNF-alpha and IL-6 induced by CpG ODN and LPS, whereas IL-6 release induced by EC DNA was not significantly affected by 50 microM CQ.	Chloroquine	68-70	tumor necrosis factor	Homo sapiens	115-124
14996414-7	2004	In human peripheral blood mononuclear cells (hPBMC), 100-200 microM CQ almost completely abrogated release of both TNF-alpha and IL-6 induced by CpG ODN and LPS, whereas IL-6 release induced by EC DNA was not significantly affected by 50 microM CQ.	Chloroquine	68-70	interleukin 6	Homo sapiens	129-133
14996414-8	2004	Furthermore, CQ reduced the expression of TLR9 and TLR4 mRNA and the activation of NFkappaB and AP-1 stimulated by CpG ODN and LPS in ANA-1 cells.	Chloroquine	13-15	toll-like receptor 9	Mus musculus	42-46
14996414-8	2004	Furthermore, CQ reduced the expression of TLR9 and TLR4 mRNA and the activation of NFkappaB and AP-1 stimulated by CpG ODN and LPS in ANA-1 cells.	Chloroquine	13-15	toll-like receptor 4	Mus musculus	51-55
14996414-8	2004	Furthermore, CQ reduced the expression of TLR9 and TLR4 mRNA and the activation of NFkappaB and AP-1 stimulated by CpG ODN and LPS in ANA-1 cells.	Chloroquine	13-15	nuclear factor of kappa light polypeptide gene enhancer in B cells 1, p105	Mus musculus	83-91
12878488-9	2003	Chloroquine and nocodazole increased the duration of antioxidant protection by decreasing the extent of anti-ICAM/catalase degradation.	Chloroquine	0-11	catalase	Homo sapiens	114-122
14729380-7	2004	In conclusion, lumefantrine and desbutyl-lumefantrine inhibited significantly the hERG tail current with a higher IC50-value than mefloquine, chloroquine and halofantrine.	Chloroquine	142-153	ETS transcription factor ERG	Homo sapiens	82-86
14975502-1	2004	Chloroquine and related anti-malarial drugs appear to promote apoptosis in T-cells by suppressing NF-kappa-B, which enhances the expression of anti-apoptotic proteins (e.g., Bcl-2).	Chloroquine	0-11	nuclear factor kappa B subunit 1	Homo sapiens	98-108
14975502-1	2004	Chloroquine and related anti-malarial drugs appear to promote apoptosis in T-cells by suppressing NF-kappa-B, which enhances the expression of anti-apoptotic proteins (e.g., Bcl-2).	Chloroquine	0-11	BCL2 apoptosis regulator	Homo sapiens	174-179
12890648-6	2003	PT cells accumulated 109Cd7MT-1 in membrane vesicles associated with the late endo/lysosomal marker LAMP1 but less with the early endosomal marker Rab5a, which was abolished by chloroquine or LY-294002.	Chloroquine	177-188	RAB5A, member RAS oncogene family	Rattus norvegicus	147-152
14738594-7	2003	Secondly, we studied the inhibition of CYP2A6 with clinically used drugs of quinoline compounds, such as norfloxacin as an antibacterial agent, quinidine as an antiarrhythmic agent, quinine and chloroquine as antimalaria agents and rebamipide as an anti-ulcer agent.	Chloroquine	194-205	cytochrome P450 2A13	Bos taurus	39-45
14592603-5	2003	Moreover, chloroquine has immunomodulatory effects, suppressing the production/release of tumour necrosis factor alpha and interleukin 6, which mediate the inflammatory complications of several viral diseases.	Chloroquine	10-21	interleukin 6	Homo sapiens	123-136
15031635-3	2003	GST and CQ were equally effective in reducing lipopolysaccharide (LPS)-induced IL-1 beta release while CQ was a more effective inhibitor of TNF-alpha production than GST.	Chloroquine	8-10	interleukin 1 beta	Homo sapiens	79-88
15031635-3	2003	GST and CQ were equally effective in reducing lipopolysaccharide (LPS)-induced IL-1 beta release while CQ was a more effective inhibitor of TNF-alpha production than GST.	Chloroquine	103-105	tumor necrosis factor	Homo sapiens	140-149
15031635-8	2003	These data demonstrate that CQ inhibits IL-1 beta release from monocytes by interfering with pretranscriptional signaling and TNF-alpha release by posttranslational events whereas GST downregulates IL-1 beta secretion by interfering with posttranslational IL-1 beta processing.	Chloroquine	28-30	interleukin 1 beta	Homo sapiens	40-49
15031635-8	2003	These data demonstrate that CQ inhibits IL-1 beta release from monocytes by interfering with pretranscriptional signaling and TNF-alpha release by posttranslational events whereas GST downregulates IL-1 beta secretion by interfering with posttranslational IL-1 beta processing.	Chloroquine	28-30	tumor necrosis factor	Homo sapiens	126-135
14531858-5	2003	Under chloroquine treatment, the diffuse cytosolic distribution of alpha-TTP changes to a punctate pattern.	Chloroquine	6-17	alpha tocopherol transfer protein	Homo sapiens	67-76
14523765-0	2003	Chloroquine versus sulfadoxine-pyrimethamine for treatment of Plasmodium falciparum malaria in Savannakhet Province, Lao People"s Democratic Republic: an assessment of national antimalarial drug recommendations.	Chloroquine	0-11	interleukin 4 induced 1	Homo sapiens	117-120
14523765-1	2003	The in vivo efficacies of the Lao People"s Democratic Republic (Laos) nationally recommended antimalarial agents--chloroquine and sulfadoxine-pyrimethamine-were assessed in a randomized, comparative trial that involved 100 patients with uncomplicated Plasmodium falciparum malaria who were followed for 42 days after starting treatment.	Chloroquine	114-125	interleukin 4 induced 1	Homo sapiens	30-33
12902324-4	2003	CpG DNA-induced COX2-3"-UTR-luciferase activity was completely inhibited by an endosomal acidification inhibitor chloroquine, a Toll-like receptor 9 antagonist inhibitory CpG DNA, or overexpression of a dominant negative (DN) form of MyD88.	Chloroquine	113-124	cytochrome c oxidase II, mitochondrial	Mus musculus	16-20
12867541-5	2003	Furthermore, treatment of normal and NPC fibroblasts with chloroquine, which inhibits membrane traffic from early endosomes to the TGN, resulted in a redistribution of MPR300 to EEA1 and internalized transferrin-positive, but LAMP-2-negative, early-recycling endosomes.	Chloroquine	58-69	NPC intracellular cholesterol transporter 1	Homo sapiens	37-40
12867541-5	2003	Furthermore, treatment of normal and NPC fibroblasts with chloroquine, which inhibits membrane traffic from early endosomes to the TGN, resulted in a redistribution of MPR300 to EEA1 and internalized transferrin-positive, but LAMP-2-negative, early-recycling endosomes.	Chloroquine	58-69	insulin like growth factor 2 receptor	Homo sapiens	168-174
12867541-5	2003	Furthermore, treatment of normal and NPC fibroblasts with chloroquine, which inhibits membrane traffic from early endosomes to the TGN, resulted in a redistribution of MPR300 to EEA1 and internalized transferrin-positive, but LAMP-2-negative, early-recycling endosomes.	Chloroquine	58-69	early endosome antigen 1	Homo sapiens	178-182
12867541-5	2003	Furthermore, treatment of normal and NPC fibroblasts with chloroquine, which inhibits membrane traffic from early endosomes to the TGN, resulted in a redistribution of MPR300 to EEA1 and internalized transferrin-positive, but LAMP-2-negative, early-recycling endosomes.	Chloroquine	58-69	transferrin	Homo sapiens	200-211
12867541-5	2003	Furthermore, treatment of normal and NPC fibroblasts with chloroquine, which inhibits membrane traffic from early endosomes to the TGN, resulted in a redistribution of MPR300 to EEA1 and internalized transferrin-positive, but LAMP-2-negative, early-recycling endosomes.	Chloroquine	58-69	lysosomal associated membrane protein 2	Homo sapiens	226-232
12816877-4	2003	Pretreatment of VSMCs with chloroquine, an inhibitor of lysosomal function, inhibited the PDGF-induced loss of caveolin-1.	Chloroquine	27-38	caveolin 1	Homo sapiens	111-121
12972292-3	2003	We report that iodinated endothelin-1 ligand (ET-1) is taken up by cells transfected with ETB and remains undegraded for at least 17 h. Analysis of the intracellular traffic of endocytosed ET-1 on isotonic Ficoll gradients shows that it is rapidly internalised to lysosomes by a chloroquine sensitive and cholesterol dependent pathway.	Chloroquine	279-290	endothelin 1	Homo sapiens	25-44
12972292-3	2003	We report that iodinated endothelin-1 ligand (ET-1) is taken up by cells transfected with ETB and remains undegraded for at least 17 h. Analysis of the intracellular traffic of endocytosed ET-1 on isotonic Ficoll gradients shows that it is rapidly internalised to lysosomes by a chloroquine sensitive and cholesterol dependent pathway.	Chloroquine	279-290	endothelin 1	Homo sapiens	46-50
12972292-3	2003	We report that iodinated endothelin-1 ligand (ET-1) is taken up by cells transfected with ETB and remains undegraded for at least 17 h. Analysis of the intracellular traffic of endocytosed ET-1 on isotonic Ficoll gradients shows that it is rapidly internalised to lysosomes by a chloroquine sensitive and cholesterol dependent pathway.	Chloroquine	279-290	endothelin 1	Homo sapiens	189-193
12900525-8	2003	The recognition of HSV-2 by TLR9 was mediated through an endocytic pathway that was inhibited by chloroquine or bafilomycin A1.	Chloroquine	97-108	toll like receptor 9	Homo sapiens	28-32
12920490-9	2003	We identified hepatic CYP enzymes responsible for metabolism of some compounds (praziquantel-1A2, 2C19, 3A4; primaquine-1A2, 3A4; chloroquine-2C8, 2D6, 3A4; artesunate-2A6; pyrantel-2D6).	Chloroquine	130-141	cytochrome P450 family 4 subfamily F member 3	Homo sapiens	22-25
12967198-9	2003	In conclusion, the results of the present study demonstrated that CYP2C8 and CYP3A4/5 are the major enzymes responsible for the chloroquine N-deethylation to DCQ in human liver microsomes.	Chloroquine	128-139	cytochrome P450 family 2 subfamily C member 8	Homo sapiens	66-72
12967198-9	2003	In conclusion, the results of the present study demonstrated that CYP2C8 and CYP3A4/5 are the major enzymes responsible for the chloroquine N-deethylation to DCQ in human liver microsomes.	Chloroquine	128-139	cytochrome P450 family 3 subfamily A member 4	Homo sapiens	77-83
12967198-0	2003	Cytochrome P450 2C8 and CYP3A4/5 are involved in chloroquine metabolism in human liver microsomes.	Chloroquine	49-60	cytochrome P450 family 2 subfamily C member 8	Homo sapiens	0-19
12864851-7	2003	Northern analysis revealed a 2.1- to 2.7-fold increase in pfmdr1 expression in 3D7 parasites treated with 50 nM chloroquine for 6 h, confirming results from Serial Analysis of Gene Expression.	Chloroquine	112-123	multidrug resistance protein 1	Plasmodium falciparum 3D7	58-64
12967198-0	2003	Cytochrome P450 2C8 and CYP3A4/5 are involved in chloroquine metabolism in human liver microsomes.	Chloroquine	49-60	cytochrome P450 family 3 subfamily A member 4	Homo sapiens	24-30
14964651-7	2003	The present study was the first document in Yemen to compare simultaneously the in vivo and in vitro response to chloroquine among 209 of P. falciparum field isolate patients that were satisfied all criteria of WHO for the implementation of the in vivo and in vitro tests and were obtained by PCD and ACD methods.	Chloroquine	113-124	ACD shelterin complex subunit and telomerase recruitment factor	Homo sapiens	301-304
12672796-10	2003	We demonstrated a lysosomal hDOR targeting upon peptides by using chloroquine in binding, Western blot, and immunocytochemical experiments and by colocalization of this receptor with a late endosome marker.	Chloroquine	66-77	tumor protein p53 inducible nuclear protein 2	Homo sapiens	28-32
12756207-0	2003	In vitro metabolism of chloroquine: identification of CYP2C8, CYP3A4, and CYP2D6 as the main isoforms catalyzing N-desethylchloroquine formation.	Chloroquine	23-34	cytochrome P450 family 2 subfamily C member 8	Homo sapiens	54-60
12756207-0	2003	In vitro metabolism of chloroquine: identification of CYP2C8, CYP3A4, and CYP2D6 as the main isoforms catalyzing N-desethylchloroquine formation.	Chloroquine	23-34	cytochrome P450 family 3 subfamily A member 4	Homo sapiens	62-68
12756207-0	2003	In vitro metabolism of chloroquine: identification of CYP2C8, CYP3A4, and CYP2D6 as the main isoforms catalyzing N-desethylchloroquine formation.	Chloroquine	23-34	cytochrome P450 family 2 subfamily D member 6	Homo sapiens	74-80
12756207-10	2003	This property may explain the ability of CQ to inhibit CYP2D6-mediated metabolism in vitro and in vivo.	Chloroquine	41-43	cytochrome P450 family 2 subfamily D member 6	Homo sapiens	55-61
12756207-11	2003	At therapeutically relevant concentrations ( approximately 100 microM CQ in the liver), CYP2C8, CYP3A4, and, to a much lesser extent, CYP2D6 are expected to account for most of the CQ N-desethylation.	Chloroquine	70-72	cytochrome P450 family 2 subfamily C member 8	Homo sapiens	88-94
12756207-11	2003	At therapeutically relevant concentrations ( approximately 100 microM CQ in the liver), CYP2C8, CYP3A4, and, to a much lesser extent, CYP2D6 are expected to account for most of the CQ N-desethylation.	Chloroquine	70-72	cytochrome P450 family 3 subfamily A member 4	Homo sapiens	96-102
12756207-11	2003	At therapeutically relevant concentrations ( approximately 100 microM CQ in the liver), CYP2C8, CYP3A4, and, to a much lesser extent, CYP2D6 are expected to account for most of the CQ N-desethylation.	Chloroquine	70-72	cytochrome P450 family 2 subfamily D member 6	Homo sapiens	134-140
12626512-4	2003	The internalized VE-cadherin co-localized with early endosomes, and the lysosomal inhibitor chloroquine dramatically inhibited the down-regulation of VE-cadherin in cells expressing the IL-2R-VE-cadcyto mutant.	Chloroquine	92-103	cadherin 5	Homo sapiens	150-161
12626512-4	2003	The internalized VE-cadherin co-localized with early endosomes, and the lysosomal inhibitor chloroquine dramatically inhibited the down-regulation of VE-cadherin in cells expressing the IL-2R-VE-cadcyto mutant.	Chloroquine	92-103	interleukin 2 receptor subunit alpha	Homo sapiens	186-191
12626512-5	2003	Chloroquine treatment also resulted in the accumulation of a VE-cadherin fragment lacking the beta-catenin binding domain of the VE-cadherin cytoplasmic tail.	Chloroquine	0-11	cadherin 5	Homo sapiens	61-72
12626512-5	2003	Chloroquine treatment also resulted in the accumulation of a VE-cadherin fragment lacking the beta-catenin binding domain of the VE-cadherin cytoplasmic tail.	Chloroquine	0-11	cadherin 5	Homo sapiens	129-140
12739037-0	2003	Polymorphism of the beta3-adrenergic receptor and lipid profile in patients with rheumatoid arthritis and systemic lupus erythematosus treated with chloroquine.	Chloroquine	148-159	adrenoceptor beta 3	Homo sapiens	20-45
12769185-3	2003	In the hippocampal slice model, tau deposits and amyloidogenic fragments induced by the lysosomal inhibitor chloroquine were accompanied by disrupted microtubule integrity and by corresponding declines in postsynaptic glutamate receptors and the presynaptic marker synaptophysin.	Chloroquine	108-119	microtubule associated protein tau	Homo sapiens	32-35
12769185-3	2003	In the hippocampal slice model, tau deposits and amyloidogenic fragments induced by the lysosomal inhibitor chloroquine were accompanied by disrupted microtubule integrity and by corresponding declines in postsynaptic glutamate receptors and the presynaptic marker synaptophysin.	Chloroquine	108-119	synaptophysin	Homo sapiens	265-278
12769185-7	2003	When PADK and chloroquine were co-infused, chloroquine no longer increased cellular tau levels.	Chloroquine	43-54	microtubule associated protein tau	Homo sapiens	84-87
12697834-12	2003	The IGF-IR is stabilized following treatment with both MG132 and chloroquine, indicating that both the proteasome and lysosomal pathways mediate degradation of the receptor.	Chloroquine	65-76	insulin-like growth factor I receptor	Mus musculus	4-10
12739037-8	2003	An association between the arg64/arg64 beta(3)-AR genotype and high levels of triglycerides (TG) and very low-density lipoprotein cholesterol (VLDL-c) was found in three RA patients ( P=0.01), two of them taking chloroquine.	Chloroquine	212-223	adrenoceptor beta 3	Homo sapiens	39-49
15155083-4	2003	COS-7 cells were transfected with this eukaryotic expression vector CD5lnegl-KIR2DL1 constructed in our Laboratory through DEAE-dextran/chloroquine method.	Chloroquine	136-147	killer cell immunoglobulin like receptor, two Ig domains and long cytoplasmic tail 1	Homo sapiens	77-84
12767714-3	2003	Now chloroquine-binding proteins in malaria-infected erythrocytes, surprisingly, have been identified as human aldehyde dehydrogenase 1 and quinone reductase 2, raising the interesting possibility that the target of the anti-malarial activity of chloroquine might be a host enzyme.	Chloroquine	4-15	N-ribosyldihydronicotinamide:quinone reductase 2	Homo sapiens	140-159
12767714-3	2003	Now chloroquine-binding proteins in malaria-infected erythrocytes, surprisingly, have been identified as human aldehyde dehydrogenase 1 and quinone reductase 2, raising the interesting possibility that the target of the anti-malarial activity of chloroquine might be a host enzyme.	Chloroquine	246-257	N-ribosyldihydronicotinamide:quinone reductase 2	Homo sapiens	140-159
12649360-2	2003	Chloroquine has marked effects on the normal kidney and stimulates an increase in plasma vasopressin via nitric oxide.	Chloroquine	0-11	arginine vasopressin	Rattus norvegicus	89-100
12659609-2	2003	CASE SUMMARY: A febrile 36-year-old seaman from Mumbai (Bombay) was prescribed &gt;5 times the usual dose of chloroquine for malaria diagnosed empirically onboard ship.	Chloroquine	109-120	inositol polyphosphate-5-phosphatase D	Homo sapiens	163-167
12705901-3	2003	Treatment with an inhibitor of lysosomal proteinases chloroquine suppressed degradation of internalized MT1-MMP and induced accumulation of MT1-MMP in CD63-positive lysosomes.	Chloroquine	53-64	matrix metallopeptidase 14	Homo sapiens	104-111
12705901-3	2003	Treatment with an inhibitor of lysosomal proteinases chloroquine suppressed degradation of internalized MT1-MMP and induced accumulation of MT1-MMP in CD63-positive lysosomes.	Chloroquine	53-64	matrix metallopeptidase 14	Homo sapiens	140-147
12705901-3	2003	Treatment with an inhibitor of lysosomal proteinases chloroquine suppressed degradation of internalized MT1-MMP and induced accumulation of MT1-MMP in CD63-positive lysosomes.	Chloroquine	53-64	CD63 molecule	Homo sapiens	151-155
12705901-4	2003	Ectopic expression of CD63 accelerated degradation of MT1-MMP, which was blocked by chloroquine.	Chloroquine	84-95	CD63 molecule	Homo sapiens	22-26
12705901-4	2003	Ectopic expression of CD63 accelerated degradation of MT1-MMP, which was blocked by chloroquine.	Chloroquine	84-95	matrix metallopeptidase 14	Homo sapiens	54-61
12649360-8	2003	Chloroquine administration in paracetamol treated rats induced a significant reduction (p &lt; 0.05) in urine flow rate and a significant increase in plasma vasopressin (p &lt; 0.001).	Chloroquine	0-11	arginine vasopressin	Rattus norvegicus	157-168
12934303-1	2003	Ineffectiveness of malaria treatment is in many cases explained by chloroquine resistance (CR) of plasmodia (CRP) which dominates in some regions of Africa and South-East Asia.	Chloroquine	67-78	C-reactive protein	Homo sapiens	109-112
12622622-1	2003	OBJECTIVE: To examine the role of hemochromatosis (HFE) gene mutations, which are associated with porphyria cutanea tarda (PCT), in the therapeutic response to chloroquine.	Chloroquine	160-171	homeostatic iron regulator	Homo sapiens	51-54
12622622-7	2003	Chloroquine therapy was accompanied by clinical remission and reduced urinary porphyrin excretion (P&lt;.001) in the 24 patients (39%) with HFE wild type as well as in 35 HFE heterozygous patients with PCT (56%).	Chloroquine	0-11	homeostatic iron regulator	Homo sapiens	140-143
12622622-7	2003	Chloroquine therapy was accompanied by clinical remission and reduced urinary porphyrin excretion (P&lt;.001) in the 24 patients (39%) with HFE wild type as well as in 35 HFE heterozygous patients with PCT (56%).	Chloroquine	0-11	homeostatic iron regulator	Homo sapiens	171-174
12622622-8	2003	Decreases of serum iron markers following chloroquine therapy were limited to patients with PCT and HFE wild type.	Chloroquine	42-53	homeostatic iron regulator	Homo sapiens	100-103
12809172-10	2003	The effects of CQ or AC and those of a megalin competitor (the monoclonal antibody 1H2, which reduced transcytosis) were not additive, suggesting that CQ and AC act on the megalin-mediated pathway.	Chloroquine	151-153	LDL receptor related protein 2	Rattus norvegicus	172-179
12533279-2	2003	We analyzed consecutive falciparum malaria isolates from Canadian travelers from 1994 to 2000, for polymorphisms in pfcrt, dhfr, and dhps linked to chloroquine and pyrimethamine/sulfadoxine resistance.	Chloroquine	148-159	dihydrofolate reductase	Homo sapiens	123-127
12490586-1	2003	We have previously reported that chloroquine administration increases plasma vasopressin concentration and urinary sodium excretion in Sprague-Dawley rats.	Chloroquine	33-44	arginine vasopressin	Rattus norvegicus	77-88
12490586-2	2003	Because chloroquine has also been shown to stimulate nitric oxide production, the aim of this study was to determine whether nitric oxide mediates chloroquine-induced changes in renal function and secretion of vasopressin.	Chloroquine	147-158	arginine vasopressin	Rattus norvegicus	210-221
12490586-10	2003	Chloroquine administration was accompanied by a significant increase (p &lt; 0.05) in plasma vasopressin, which was also reversed by L-NAME.	Chloroquine	0-11	arginine vasopressin	Rattus norvegicus	93-104
12490586-11	2003	The effects of chloroquine on renal function and vasopressin secretion seem to be mediated by pathways involving nitric oxide.	Chloroquine	15-26	arginine vasopressin	Rattus norvegicus	49-60
12490586-12	2003	These data suggest that chloroquine may stimulate nitric-oxide synthase both centrally, stimulating vasopressin secretion, and within the kidney, where it modulates glomerular hemodynamics and tubular function.	Chloroquine	24-35	arginine vasopressin	Rattus norvegicus	100-111
14989426-5	2002	Antimalarials (hydroxychloroquine and chloroquine) have been found to increase the monocyte production of IL-1Ra and these changes might explain at least some of their mechanisms of action.	Chloroquine	22-33	interleukin 1 receptor antagonist	Homo sapiens	106-112
12535245-10	2003	The findings of this study suggest that use of CQ as first-line treatment of uncomplicated malaria in the Lao PDR has to be reconsidered.	Chloroquine	47-49	interleukin 4 induced 1	Homo sapiens	106-109
15027776-1	2002	The hypothesis that chloroquine-induced pruritus (CIP) may be determined by certain genetic factors was tested by investigating the epidemiology of CIP with respect to certain genetic red cell markers namely, haemoglobin genotype, glucose-6-phosphate dehydrogenase (G6PD) deficiency and the ABO blood groups.	Chloroquine	20-31	ABO, alpha 1-3-N-acetylgalactosaminyltransferase and alpha 1-3-galactosyltransferase	Homo sapiens	291-294
11964399-8	2002	Use of chloroquine to inhibit lysosomal proteinase activity showed that N-Shh endocytosed via megalin was not efficiently targeted to the lysosomes for degradation.	Chloroquine	7-18	sonic hedgehog signaling molecule	Homo sapiens	72-77
12082016-9	2002	Further exploration of antimalarial compounds identified the common medicinals chloroquine, quinacrine, and amodiaquine as Tp53-inducers.	Chloroquine	79-90	tumor protein p53	Homo sapiens	123-127
11960982-2	2002	Here we investigate the voltage-dependent block of wild-type and mutant human ether-a-go-go related gene (HERG) K(+) channels by the antimalarial compound chloroquine.	Chloroquine	155-166	potassium voltage-gated channel subfamily H member 2	Homo sapiens	106-110
11960982-5	2002	Chloroquine also slowed the apparent rate of HERG deactivation, reflecting the inability of drug-bound channels to close.	Chloroquine	0-11	potassium voltage-gated channel subfamily H member 2	Homo sapiens	45-49
11960982-6	2002	Mutation to alanine of aromatic residues (Tyr-652 or Phe-656) located in the S6 domain of HERG greatly reduced the potency of channel block by chloroquine (IC(50) &gt; 1 mm at 0 mV).	Chloroquine	143-154	potassium voltage-gated channel subfamily H member 2	Homo sapiens	90-94
11960982-12	2002	Our experimental findings and modeling suggest that chloroquine preferentially blocks open HERG channels by cation-pi and pi-stacking interactions with Tyr-652 and Phe-656 of multiple subunits.	Chloroquine	52-63	potassium voltage-gated channel subfamily H member 2	Homo sapiens	91-95
12125743-3	2002	Tau species of 55 to 69 kDa increased over several days of treatment with chloroquine, while the protein and message levels of synaptic markers were selectively reduced.	Chloroquine	74-85	microtubule associated protein tau	Homo sapiens	0-3
11960982-11	2002	Molecular modeling was used to define energy-minimized dockings of chloroquine to the central cavity of HERG.	Chloroquine	67-78	potassium voltage-gated channel subfamily H member 2	Homo sapiens	104-108
12020924-3	2002	Our results indicate that the traditional healers in STP use several medicinal plants against fever and/or "malaria" which reveal strong antiparasitic activity in vitro: four of the plant extracts have evident antiplasmodial activity against chloroquine resistant Plasmodium falciparum, with IC(50) values &lt;10 microg/ml, and also revealed hepatic schizontocidal activity (&lt;5-35 microg/ml).	Chloroquine	242-253	sulfotransferase family 1A, phenol-preferring, member 1	Mus musculus	53-56
12067301-6	2002	Moreover, the fact that chloroquine abolished NO and iNOS production from the cells treated with CpG ODN 1826 but not from those treated with LPS suggested that the induction of NO and iNOS production from the cells stimulated with CpG ODN (1826) also required endosomal maturation/acidification.	Chloroquine	24-35	nitric oxide synthase 2, inducible	Mus musculus	53-57
12067301-6	2002	Moreover, the fact that chloroquine abolished NO and iNOS production from the cells treated with CpG ODN 1826 but not from those treated with LPS suggested that the induction of NO and iNOS production from the cells stimulated with CpG ODN (1826) also required endosomal maturation/acidification.	Chloroquine	24-35	nitric oxide synthase 2, inducible	Mus musculus	185-189
11834730-4	2002	Chloroquine, an acidotropic weak base that impairs endosomal recycling of membrane proteins, induced a complete inhibition in the insulin-mediated stimulation of System A, which was associated with a loss in SAT2 recruitment to the plasma membrane.	Chloroquine	0-11	insulin	Homo sapiens	130-137
11967279-5	2002	The secretion of the amyloid-beta precursor protein was slightly reduced by interferon-gamma or chloroquine.	Chloroquine	96-107	amyloid beta precursor protein	Homo sapiens	21-51
12023333-5	2002	Increasing the pH of acidic compartments by incubating cells with chloroquine or bafilomycin A1 blocked CD1d1 recognition by Valpha14(+) (but not Valpha14(-)) NKT cells without reducing levels of cell surface CD1d1.	Chloroquine	66-77	CD1d1 antigen	Mus musculus	104-109
12023333-5	2002	Increasing the pH of acidic compartments by incubating cells with chloroquine or bafilomycin A1 blocked CD1d1 recognition by Valpha14(+) (but not Valpha14(-)) NKT cells without reducing levels of cell surface CD1d1.	Chloroquine	66-77	T cell receptor alpha, variable 14	Mus musculus	125-133
12023333-5	2002	Increasing the pH of acidic compartments by incubating cells with chloroquine or bafilomycin A1 blocked CD1d1 recognition by Valpha14(+) (but not Valpha14(-)) NKT cells without reducing levels of cell surface CD1d1.	Chloroquine	66-77	CD1d1 antigen	Mus musculus	209-214
11994488-1	2002	Previously, we demonstrated that the anti-inflammatory drug chloroquine (CQ) inhibited LPS-induced TNF-alpha transcription.	Chloroquine	60-71	tumor necrosis factor	Homo sapiens	99-108
11994488-1	2002	Previously, we demonstrated that the anti-inflammatory drug chloroquine (CQ) inhibited LPS-induced TNF-alpha transcription.	Chloroquine	73-75	tumor necrosis factor	Homo sapiens	99-108
11994488-3	2002	CQ interfered with phosphorylation of extracellular signal-regulated kinases (ERK)1/2 and the ERK-activating kinases mitogen-activating protein/ERK kinase (MEK)1/2.	Chloroquine	0-2	mitogen-activated protein kinase 3	Homo sapiens	38-85
11994488-3	2002	CQ interfered with phosphorylation of extracellular signal-regulated kinases (ERK)1/2 and the ERK-activating kinases mitogen-activating protein/ERK kinase (MEK)1/2.	Chloroquine	0-2	mitogen-activated protein kinase kinase 1	Homo sapiens	94-163
11994488-4	2002	Both CQ and PD98059, a MEK1 inhibitor, reduced luciferase reporter activity driven by human TNF promoter sequences.	Chloroquine	5-7	mitogen-activated protein kinase kinase 1	Homo sapiens	23-27
11994488-4	2002	Both CQ and PD98059, a MEK1 inhibitor, reduced luciferase reporter activity driven by human TNF promoter sequences.	Chloroquine	5-7	tumor necrosis factor	Homo sapiens	92-95
11994488-5	2002	However, CQ appeared to mediate these effects by deactivating Raf, the upstream activator of MEK.	Chloroquine	9-11	zinc fingers and homeoboxes 2	Homo sapiens	62-65
11994488-5	2002	However, CQ appeared to mediate these effects by deactivating Raf, the upstream activator of MEK.	Chloroquine	9-11	mitogen-activated protein kinase kinase 7	Homo sapiens	93-96
11994488-6	2002	These findings were supported by functional data demonstrating that CQ and PD98059 interfered with TNF expression in several human and murine cell types while neither inhibitor blocked TNF production in murine RAW264.7 macrophages, a cell line that does not require MEK-ERK signaling for TNF production.	Chloroquine	68-70	tumor necrosis factor	Homo sapiens	99-102
11994488-9	2002	Taken together, these data argue that therapeutic concentrations of CQ interfere with ERK activation by a novel mechanism, an effect that could be responsible, at least in part, for the potent anti-inflammatory effects of this drug.	Chloroquine	68-70	mitogen-activated protein kinase 1	Homo sapiens	86-89
11983070-2	2002	By Western blot analysis, we investigated posttranslational modification of LC3 in cultured cells with a high concentration of chloroquine, and found that the autophagosome membrane-bound form of LC3 increased dose-dependently.	Chloroquine	127-138	annexin A3	Rattus norvegicus	76-79
11983070-2	2002	By Western blot analysis, we investigated posttranslational modification of LC3 in cultured cells with a high concentration of chloroquine, and found that the autophagosome membrane-bound form of LC3 increased dose-dependently.	Chloroquine	127-138	annexin A3	Rattus norvegicus	196-199
11834730-4	2002	Chloroquine, an acidotropic weak base that impairs endosomal recycling of membrane proteins, induced a complete inhibition in the insulin-mediated stimulation of System A, which was associated with a loss in SAT2 recruitment to the plasma membrane.	Chloroquine	0-11	spermidine/spermine N1-acetyltransferase family member 2	Homo sapiens	208-212
11834730-6	2002	Our data indicate strongly that insulin increases System A transport in L6 cells by stimulating the exocytosis of SAT2 carriers from a chloroquine-sensitive endosomal compartment.	Chloroquine	135-146	spermidine/spermine N1-acetyltransferase family member 2	Homo sapiens	114-118
11888922-3	2002	Furthermore, we showed that sensitization with pRL1a MAP was inhibited by the addition of chloroquine, cycloheximide, and brefeldin A to the culture, but not by the addition of inhibitors for lysosomal proteases or proteasome.	Chloroquine	90-101	protein tyrosine phosphatase 4a1	Mus musculus	47-51
11967122-0	2002	Chloroquine enhances the number of IL-10 producing cells and the expression of B7-2 and ICAM-1 in in vitro-cultured PBMC.	Chloroquine	0-11	interleukin 10	Homo sapiens	35-40
11967122-0	2002	Chloroquine enhances the number of IL-10 producing cells and the expression of B7-2 and ICAM-1 in in vitro-cultured PBMC.	Chloroquine	0-11	CD86 molecule	Homo sapiens	79-83
11967122-0	2002	Chloroquine enhances the number of IL-10 producing cells and the expression of B7-2 and ICAM-1 in in vitro-cultured PBMC.	Chloroquine	0-11	intercellular adhesion molecule 1	Homo sapiens	88-94
11777909-4	2002	Immunoprecipitation analysis revealed ubiquitin-dependent accumulation of transmembrane Notch1 protein after treatment with the lysosomal inhibitor chloroquine but not after treatment with various proteasome inhibitors.	Chloroquine	148-159	notch receptor 1	Homo sapiens	88-94
11967122-5	2002	Chloroquine elevated the expression of the costimulatory and adhesion molecules B7-2 (CD86) and ICAM-1 (CD54) in peripheral mononuclear cells (PBMC).	Chloroquine	0-11	CD86 molecule	Homo sapiens	80-84
11967122-5	2002	Chloroquine elevated the expression of the costimulatory and adhesion molecules B7-2 (CD86) and ICAM-1 (CD54) in peripheral mononuclear cells (PBMC).	Chloroquine	0-11	CD86 molecule	Homo sapiens	86-90
11967122-5	2002	Chloroquine elevated the expression of the costimulatory and adhesion molecules B7-2 (CD86) and ICAM-1 (CD54) in peripheral mononuclear cells (PBMC).	Chloroquine	0-11	intercellular adhesion molecule 1	Homo sapiens	96-102
11967122-5	2002	Chloroquine elevated the expression of the costimulatory and adhesion molecules B7-2 (CD86) and ICAM-1 (CD54) in peripheral mononuclear cells (PBMC).	Chloroquine	0-11	intercellular adhesion molecule 1	Homo sapiens	104-108
11967122-7	2002	Assessment of the frequencies of interleukin (IL)-10 and interferon (IFN)-gamma-producing cells in in vitro-cultivated PBMCs showed that the ratio between pro- and anti-inflammatory cytokines changed after exposure to chloroquine, favouring anti-inflammatory immune responses.	Chloroquine	218-229	interleukin 10	Homo sapiens	33-52
11967122-7	2002	Assessment of the frequencies of interleukin (IL)-10 and interferon (IFN)-gamma-producing cells in in vitro-cultivated PBMCs showed that the ratio between pro- and anti-inflammatory cytokines changed after exposure to chloroquine, favouring anti-inflammatory immune responses.	Chloroquine	218-229	interferon gamma	Homo sapiens	57-79
11850263-5	2002	Among the genes that were differentially expressed with chloroquine treatment were a number of metal transporters involved in iron acquisition (SIT1, ARN2, ARN4, and SMF2).	Chloroquine	56-67	siderophore transporter	Saccharomyces cerevisiae S288C	144-148
11850263-5	2002	Among the genes that were differentially expressed with chloroquine treatment were a number of metal transporters involved in iron acquisition (SIT1, ARN2, ARN4, and SMF2).	Chloroquine	56-67	siderophore transporter	Saccharomyces cerevisiae S288C	150-154
11850263-5	2002	Among the genes that were differentially expressed with chloroquine treatment were a number of metal transporters involved in iron acquisition (SIT1, ARN2, ARN4, and SMF2).	Chloroquine	56-67	Enb1p	Saccharomyces cerevisiae S288C	156-160
11850263-5	2002	Among the genes that were differentially expressed with chloroquine treatment were a number of metal transporters involved in iron acquisition (SIT1, ARN2, ARN4, and SMF2).	Chloroquine	56-67	divalent metal ion transporter SMF2	Saccharomyces cerevisiae S288C	166-170
11888922-4	2002	Inhibition of sensitization by the addition of chloroquine to the culture suggested the requirement of acidification of the endosomal compartment for pRL1a MAP processing.	Chloroquine	47-58	protein tyrosine phosphatase 4a1	Mus musculus	150-154
12523576-7	2002	Chloroquine significantly suppressed CpG ODN-induced splenic proliferation and interleukin 6 (IL-6) production associated with GVHD.	Chloroquine	0-11	interleukin 6	Mus musculus	79-92
11930237-7	2002	There were different changes in IL-1 beta level and gene expression after treatment with PLA(2) inhibitor chloroquine, cyclo-oxidase inhibitor indomethacin, or PAF receptor antagonist SR27417 respectively after injury.	Chloroquine	106-117	interleukin 1 beta	Rattus norvegicus	32-41
11704663-5	2002	The recycling of NPRA was blocked by the lysosomotropic agent chloroquine, the energy depleter dinitrophenol, and also by low temperature, suggesting that recycling of the receptor is an energy- and temperature-dependent process.	Chloroquine	62-73	natriuretic peptide receptor 1	Homo sapiens	17-21
12202157-0	2002	Assembly and cell surface expression of TAP-independent, chloroquine-sensitive and interferon-gamma-inducible class I MHC complexes in transformed fibroblast cell lines are regulated by tapasin.	Chloroquine	57-68	TAP binding protein	Homo sapiens	186-193
12087927-7	2002	Lactate dehydrogenase and glucose-6-phosphate dehydrogenase activities were increased, too, indicating an increase which provides the needed energy for overcoming the injurious effect of chloroquine.	Chloroquine	187-198	glucose-6-phosphate dehydrogenase	Rattus norvegicus	26-59
12390813-7	2002	CONCLUSIONS: Increased IDE activity may be one of the mechanisms of IR genesis in rat primary hepatocytes cultured with high concentration of IDE, chloroquine, on the other hand, may ameliorate insulin sensitivity by inhibiting accelerated insulin degradation.	Chloroquine	147-158	insulin degrading enzyme	Rattus norvegicus	23-26
12390813-7	2002	CONCLUSIONS: Increased IDE activity may be one of the mechanisms of IR genesis in rat primary hepatocytes cultured with high concentration of IDE, chloroquine, on the other hand, may ameliorate insulin sensitivity by inhibiting accelerated insulin degradation.	Chloroquine	147-158	insulin degrading enzyme	Rattus norvegicus	142-145
12390813-7	2002	CONCLUSIONS: Increased IDE activity may be one of the mechanisms of IR genesis in rat primary hepatocytes cultured with high concentration of IDE, chloroquine, on the other hand, may ameliorate insulin sensitivity by inhibiting accelerated insulin degradation.	Chloroquine	147-158	insulin	Homo sapiens	194-201
12390813-7	2002	CONCLUSIONS: Increased IDE activity may be one of the mechanisms of IR genesis in rat primary hepatocytes cultured with high concentration of IDE, chloroquine, on the other hand, may ameliorate insulin sensitivity by inhibiting accelerated insulin degradation.	Chloroquine	147-158	insulin	Homo sapiens	240-247
12523576-7	2002	Chloroquine significantly suppressed CpG ODN-induced splenic proliferation and interleukin 6 (IL-6) production associated with GVHD.	Chloroquine	0-11	interleukin 6	Mus musculus	94-98
12523576-8	2002	Chloroquine suppressed CD8+ T-cell production of IL-2 and IL-4 associated with GVHD in this model and maintained an early expansion (day 7) of splenic NKT cells.	Chloroquine	0-11	CD8a molecule	Homo sapiens	23-26
12523576-8	2002	Chloroquine suppressed CD8+ T-cell production of IL-2 and IL-4 associated with GVHD in this model and maintained an early expansion (day 7) of splenic NKT cells.	Chloroquine	0-11	interleukin 2	Mus musculus	49-53
12523576-8	2002	Chloroquine suppressed CD8+ T-cell production of IL-2 and IL-4 associated with GVHD in this model and maintained an early expansion (day 7) of splenic NKT cells.	Chloroquine	0-11	interleukin 4	Mus musculus	58-62
11839208-6	2002	Interaction of [3H] pBR 322 DNA with chlorpromazine, perphenazine, and chloroquine was studied using these compounds as their free bases dissolved in chloroform, followed by their impregnation onto Whatman No.	Chloroquine	71-82	translocator protein	Homo sapiens	20-23
11849318-0	2002	Chloroquine decreases cell-surface expression of tumour necrosis factor receptors in human histiocytic U-937 cells.	Chloroquine	0-11	tumor necrosis factor	Homo sapiens	49-71
11849318-3	2002	We have examined the effects of anti-rheumatic drug chloroquine on the expression of cell surface and soluble TNF receptors in human histiocytic U-937 cells.	Chloroquine	52-63	tumor necrosis factor	Homo sapiens	110-113
11849318-4	2002	Chloroquine partially reduced production of soluble p55 and p75 TNF receptors in cells stimulated with phorbol 12-myristate 13-acetate (PMA).	Chloroquine	0-11	TNF receptor superfamily member 1A	Homo sapiens	52-55
11849318-4	2002	Chloroquine partially reduced production of soluble p55 and p75 TNF receptors in cells stimulated with phorbol 12-myristate 13-acetate (PMA).	Chloroquine	0-11	tumor necrosis factor	Homo sapiens	64-67
11980364-3	2002	Chloroquine is a traditionally used antimalarial and has been postulated to inhibit TNF secretion during malaria infection.	Chloroquine	0-11	tumor necrosis factor	Mus musculus	84-87
11849318-5	2002	In these cells, induction of both TNF receptor mRNA was not changed and the levels of cell-associated TNF receptors were rather increased by chloroquine.	Chloroquine	141-152	tumor necrosis factor	Homo sapiens	102-105
11980364-10	2002	CONCLUSION: Exogenous TNF acts synergistically with P. y. nigeriensis infection to generate oxidative stress in the host and also causes an impairment of the antioxidant defense enzyme SOD, while chloroquine treatment reduces the severity of malaria infection by decreasing the blood parasitemia and also perhaps by inhibiting the TNF release.	Chloroquine	196-207	tumor necrosis factor	Mus musculus	22-25
11849318-7	2002	Treatment of U-937 cells with chloroquine significantly reduced the level of cell surface TNF receptors and a similar effect was observed with human peripheral blood monocytes.	Chloroquine	30-41	tumor necrosis factor	Homo sapiens	90-93
11849318-9	2002	Our results suggest that chloroquine down-regulates cell surface TNF receptors by retarding their transport to the cell surface, while cleavage of cell surface receptors is not inhibited by chloroquine.	Chloroquine	25-36	tumor necrosis factor	Homo sapiens	65-68
11922198-0	2002	Evaluation of lipid profile, macular toxicity and clinical manifestations according to APO E genotype in systemic lupus erythematosus and rheumatoid arthritis patients treated with chloroquine.	Chloroquine	181-192	apolipoprotein E	Homo sapiens	87-92
11922198-1	2002	OBJECTIVE: To investigate the effect of APO E gene polymorphism over lipid profile, macular toxicity and clinical manifestations in RA and SLE patients treated with chloroquine.	Chloroquine	165-176	apolipoprotein E	Homo sapiens	40-45
11922198-5	2002	RESULTS: Reduced apo B levels in RA and SLE according to the cumulative dose of chloroquine 2/3 APO E genotype in a subset of SLE patients were observed.	Chloroquine	80-91	apolipoprotein E	Homo sapiens	96-101
11922021-0	2001	Direct toxic effects of clinical doses of chloroquine on transferrin secretion in immature rat sertoli cells in vitro.	Chloroquine	42-53	transferrin	Rattus norvegicus	57-68
11377382-4	2001	The same effect was found, whether CQ was added to HU plus AZT or to HU plus ddI, in recently infected H-9 and U-937 cells or primary T cells and monocytes, as well as in immunologically or oxidatively stimulated ACH-2 and U-1 cells.	Chloroquine	35-37	acyl-CoA thioesterase 1	Homo sapiens	213-218
11589424-0	2001	Chloroquine-induced neuronal cell death is p53 and Bcl-2 family-dependent but caspase-independent.	Chloroquine	0-11	transformation related protein 53, pseudogene	Mus musculus	43-46
11589424-0	2001	Chloroquine-induced neuronal cell death is p53 and Bcl-2 family-dependent but caspase-independent.	Chloroquine	0-11	B cell leukemia/lymphoma 2	Mus musculus	51-56
11589424-5	2001	In wild-type neurons, chloroquine produced concentration- and time-dependent accumulation of autophagosomes, caspase-3 activation, and cell death.	Chloroquine	22-33	caspase 3	Mus musculus	109-118
11589424-7	2001	Targeted gene disruptions of p53 and bax inhibited and bcl-x potentiated chloroquine-induced neuron death.	Chloroquine	73-84	transformation related protein 53, pseudogene	Mus musculus	29-32
11589424-7	2001	Targeted gene disruptions of p53 and bax inhibited and bcl-x potentiated chloroquine-induced neuron death.	Chloroquine	73-84	BCL2-like 1	Mus musculus	55-60
11590193-10	2001	The CD1c exocytosis pathway was sensitive to Brefeldin A, cytochalasin B, and chloroquine.	Chloroquine	78-89	CD1c molecule	Homo sapiens	4-8
11531950-4	2001	Processing of rNP for HLA-B27-associated presentation seemed to follow the conventional MHC class I pathway predominantly, as presentation was diminished in the presence of lactacystin and brefeldin A, but was less sensitive to chloroquine and NH4Cl.	Chloroquine	228-239	major histocompatibility complex, class I, B	Homo sapiens	22-29
11922021-5	2001	On the seventh day of culture, CQ was introduced into the basal chamber During the 4 days of the experiment, the secretion of transferrin decreased with time.	Chloroquine	31-33	transferrin	Rattus norvegicus	126-137
11922021-7	2001	During the subsequent collection period, CQ (1 microM) decreased significantly transferrin secretion by SC, while 0.04 microM CQ did not affect transferrin secretion.	Chloroquine	41-43	transferrin	Rattus norvegicus	79-90
11922021-8	2001	The polarized secretion of transferrin in response to CQ was also studied.	Chloroquine	54-56	transferrin	Rattus norvegicus	27-38
11922021-10	2001	In the 1 microM culture medium, CQ diminished significantly the ratio of apical to basal transferrin secretion.	Chloroquine	32-34	transferrin	Rattus norvegicus	89-100
11759038-0	2001	Immunostimulatory CpG oligodeoxynucleotides stimulate expression of IL-1beta and interferon-like cytokines in rainbow trout macrophages via a chloroquine-sensitive mechanism.	Chloroquine	142-153	interleukin-1 beta	Oncorhynchus mykiss	68-76
11682183-2	2001	Sh4 was trapped in the phagocytic vacuoles of the murine J774 cells as evidenced by its colony forming units plus and minus chloroquine exposure in a gentamicin protection assay, and by light and transmission electron microscopy (TEM).	Chloroquine	124-135	sperm hammerhead 4	Mus musculus	0-3
11390452-6	2001	SOCS mRNA expression could be blocked by chloroquine and was independent of protein synthesis.	Chloroquine	41-52	cytokine inducible SH2 containing protein	Homo sapiens	0-4
11248658-7	2001	Pretreatment of osteoclasts with either chloroquine or monensin resulted in complete inhibition of the processing of newly synthesized cat K.	Chloroquine	40-51	cathepsin K	Homo sapiens	135-140
11516648-4	2001	Specifically, we show that a Caenorhabditis elegans member of this NR class, nhr-8, is required for wild-type levels of resistance to the toxins colchicine and chloroquine.	Chloroquine	160-171	Nuclear hormone receptor family member nhr-8	Caenorhabditis elegans	77-82
11445552-9	2001	Finally, we report that inhibition of sulfatide synthesis with chloroquine and fumonisine B1 leads to inhibition of insulin granule formation in vivo.	Chloroquine	63-74	insulin	Homo sapiens	116-123
11437332-7	2001	Gene delivery by PAT2/DNA complexes is chloroquine-dependent, can be blocked completely by free ligand (CSIPPEVKFNKPFVFLI), and is highly efficient (e.g. approximately five-fold more effective than lipofectamine).	Chloroquine	39-50	solute carrier family 36 member 2	Homo sapiens	17-21
11499408-0	2001	Point mutations in the Plasmodium falciparum cg2 gene, polymorphism of the kappa repeat region, and their relationship with chloroquine resistance.	Chloroquine	124-135	transmembrane protein 245	Homo sapiens	45-48
11499408-1	2001	Based on the available DNA sequence data of the Plasmodium falciparum cg2 gene, we have hypothesized that 3 amino-acid substitutions, His275Gln, Gly281Ala, and His299Gln, may represent the key mutations that confer resistance to chloroquine.	Chloroquine	229-240	transmembrane protein 245	Homo sapiens	70-73
11298750-10	2001	We also show that 69 and 72% of LDL-CE hydrolysis in control and apoE KO hepatic cells, respectively, is sensitive to chloroquine revealing the importance of a pathway linked to lysosomes.	Chloroquine	118-129	apolipoprotein E	Mus musculus	65-69
11241348-4	2001	In addition, starvation-induced degradation of aldolase B was inhibited by chloroquine, an inhibitor of lysosomal proteinases and by 3-methyladenine, an inhibitor of autophagy.	Chloroquine	75-86	aldolase, fructose-bisphosphate B	Rattus norvegicus	47-57
11345690-4	2001	The inhibitory activity of Rb1 and Rb2 was significantly increased by pharmacological agents against protein kinase C, protein tyrosine kinase, and protein kinase A, and anti-rheumatoid arthritis drugs, such as chloroquine and steroid drugs.	Chloroquine	211-222	RB transcriptional corepressor 1	Homo sapiens	27-30
11345690-4	2001	The inhibitory activity of Rb1 and Rb2 was significantly increased by pharmacological agents against protein kinase C, protein tyrosine kinase, and protein kinase A, and anti-rheumatoid arthritis drugs, such as chloroquine and steroid drugs.	Chloroquine	211-222	RB transcriptional corepressor like 2	Homo sapiens	35-38
11384574-0	2001	Analysis of the ABCR (ABCA4) gene in 4-aminoquinoline retinopathy: is retinal toxicity by chloroquine and hydroxychloroquine related to Stargardt disease?	Chloroquine	90-101	ATP binding cassette subfamily A member 4	Homo sapiens	16-20
11384574-0	2001	Analysis of the ABCR (ABCA4) gene in 4-aminoquinoline retinopathy: is retinal toxicity by chloroquine and hydroxychloroquine related to Stargardt disease?	Chloroquine	90-101	ATP binding cassette subfamily A member 4	Homo sapiens	22-27
11384574-1	2001	PURPOSE: To determine if mutations in ABCR (ABCA4) are associated with chloroquine/hydroxychloroquine retinopathy.	Chloroquine	71-82	ATP binding cassette subfamily A member 4	Homo sapiens	38-42
11384574-1	2001	PURPOSE: To determine if mutations in ABCR (ABCA4) are associated with chloroquine/hydroxychloroquine retinopathy.	Chloroquine	71-82	ATP binding cassette subfamily A member 4	Homo sapiens	44-49
11384574-10	2001	CONCLUSIONS: Some individuals who have ABCR mutations may be predisposed to develop retinal toxicity when exposed to chloroquine/hydroxychloroquine.	Chloroquine	117-128	ATP binding cassette subfamily A member 4	Homo sapiens	39-43
11370743-7	2001	Treatment with the weak base chloroquine or inhibitors of lysosomal enzymes after EGF stimulation induced an accumulation of tyrosine-phosphorylated EGFR and Shc in EEA1-negative and CD63-positive vesicles after a 120-min chase period.	Chloroquine	29-40	epidermal growth factor receptor	Homo sapiens	149-153
11370743-7	2001	Treatment with the weak base chloroquine or inhibitors of lysosomal enzymes after EGF stimulation induced an accumulation of tyrosine-phosphorylated EGFR and Shc in EEA1-negative and CD63-positive vesicles after a 120-min chase period.	Chloroquine	29-40	SHC adaptor protein 1	Homo sapiens	158-161
11370743-7	2001	Treatment with the weak base chloroquine or inhibitors of lysosomal enzymes after EGF stimulation induced an accumulation of tyrosine-phosphorylated EGFR and Shc in EEA1-negative and CD63-positive vesicles after a 120-min chase period.	Chloroquine	29-40	early endosome antigen 1	Homo sapiens	165-169
11370743-7	2001	Treatment with the weak base chloroquine or inhibitors of lysosomal enzymes after EGF stimulation induced an accumulation of tyrosine-phosphorylated EGFR and Shc in EEA1-negative and CD63-positive vesicles after a 120-min chase period.	Chloroquine	29-40	CD63 molecule	Homo sapiens	183-187
11181156-1	2001	A 28-day treatment trial was undertaken, to determine the efficacy of chloroquine in Laos and to assess the predictive value of molecular markers (cg2, pfmdr1, and pfcrt) that were previously linked to chloroquine resistance.	Chloroquine	202-213	transmembrane protein 245	Homo sapiens	147-150
11230422-5	2001	The high rates of persistent HRP2 and PMA antigenemia following CQ and SP treatment were strongly associated with the presence of gametocytemia, with the proportion with gametocytes on day 7 posttreatment being significantly greater in those with FP results than in those with true-negative PMA and HRP2 results.	Chloroquine	64-66	HDGF like 2	Homo sapiens	29-33
11166661-7	2001	The principal mechanism of HIV-1 inhibition by CQ seems to be an effect on gp120 on a post-transcriptional level.	Chloroquine	47-49	Envelope surface glycoprotein gp160, precursor	Human immunodeficiency virus 1	75-80
11182218-8	2001	The results showed that: (a) FcRn is expressed by human placental endothelial cells, in a functionally active form; (b) transcytosis of IgG in HPEC is a time-dependent process that takes place preferentially from the basolateral to the apical compartment; and (c) both IgG and FcRn colocalize in an intracellular endocytic compartment, chloroquine sensitive.	Chloroquine	336-347	Fc gamma receptor and transporter	Homo sapiens	29-33
11173534-8	2001	However, chloroquine completely inhibited the appearance of p32, indicating that the processing from p44 to p32 is lysosomal.	Chloroquine	9-20	mitogen activated protein kinase 3	Rattus norvegicus	101-104
11166661-8	2001	Because CQ and HCQ appear to have a novel site of action (i.e. post-transcriptional inhibition of gp120), these drugs may be particularly useful in combination with other anti-retroviral agents (e.g. ZDV, ddI and HU).	Chloroquine	8-10	inter-alpha-trypsin inhibitor heavy chain 4	Homo sapiens	98-103
11046034-11	2000	In addition, we found that CHQ prevents perforin processing by LAK cells in vitro.	Chloroquine	27-30	alpha-kinase 1	Mus musculus	63-66
11123936-8	2000	We also show that, although in normal and low apoE expressor cells, 92% of LDL- and 80% HDL(3)-CE hydrolysis is sensitive to chloroquine suggesting a pathway linked to lysosomes for both lipoproteins, cells overexpressing apoE lost 60% of chloroquine-sensitive HDL(3)-CE hydrolysis without affecting that of LDL-CE.	Chloroquine	125-136	apolipoprotein E	Homo sapiens	46-50
11123936-8	2000	We also show that, although in normal and low apoE expressor cells, 92% of LDL- and 80% HDL(3)-CE hydrolysis is sensitive to chloroquine suggesting a pathway linked to lysosomes for both lipoproteins, cells overexpressing apoE lost 60% of chloroquine-sensitive HDL(3)-CE hydrolysis without affecting that of LDL-CE.	Chloroquine	125-136	HDL3	Homo sapiens	88-94
11123936-8	2000	We also show that, although in normal and low apoE expressor cells, 92% of LDL- and 80% HDL(3)-CE hydrolysis is sensitive to chloroquine suggesting a pathway linked to lysosomes for both lipoproteins, cells overexpressing apoE lost 60% of chloroquine-sensitive HDL(3)-CE hydrolysis without affecting that of LDL-CE.	Chloroquine	125-136	apolipoprotein E	Homo sapiens	222-226
11123936-8	2000	We also show that, although in normal and low apoE expressor cells, 92% of LDL- and 80% HDL(3)-CE hydrolysis is sensitive to chloroquine suggesting a pathway linked to lysosomes for both lipoproteins, cells overexpressing apoE lost 60% of chloroquine-sensitive HDL(3)-CE hydrolysis without affecting that of LDL-CE.	Chloroquine	125-136	HDL3	Homo sapiens	261-267
11112520-6	2000	Furthermore, the photoaffinity labeling of MRP1 with IAARh123 was greatly reduced in the presence of excess Leukotreine C(4) or MK571, but to a lesser extent with excess doxorubicin, colchicine or chloroquine.	Chloroquine	197-208	ATP binding cassette subfamily C member 1	Homo sapiens	43-47
11104166-1	2000	Current evidence in literature suggests that acute effects of either chloroquine or ethanol on kidney function partly depend on influencing plasma concentrations of arginine vasopressin (AVP).	Chloroquine	69-80	arginine vasopressin	Rattus norvegicus	187-190
11104166-2	2000	Therefore, the goal of the current study was to explore the effects of chloroquine and/or various doses of ethanol on plasma AVP levels and associated effects on renal hydro-electrolyte handling.	Chloroquine	71-82	arginine vasopressin	Rattus norvegicus	125-128
11104166-1	2000	Current evidence in literature suggests that acute effects of either chloroquine or ethanol on kidney function partly depend on influencing plasma concentrations of arginine vasopressin (AVP).	Chloroquine	69-80	arginine vasopressin	Rattus norvegicus	174-185
10723096-9	2000	In vivo chloroquine treatment fully suppressed the changes in IGF-II binding activity in liver GE and PM fractions observed in insulin-treated rats.	Chloroquine	8-19	insulin-like growth factor 2	Rattus norvegicus	62-68
10960669-6	2000	In parallel, physiologic stimuli such as grass pollen or cat antigen were used to evaluate the impact of IP-10 on CD4 T cell dependant, chloroquine-sensitive cytokine synthesis.	Chloroquine	136-147	C-X-C motif chemokine ligand 10	Homo sapiens	105-110
10848718-2	2000	Since there is great interindividual variability in the pharmacokinetics of HCQ and chloroquine is a potent inhibitor of CYP2D6-catalysed pathways in vitro, we wished to study the interaction of HCQ with CYP2D6-mediated metabolism of other drugs in vivo.	Chloroquine	84-95	cytochrome P450 family 2 subfamily D member 6	Homo sapiens	121-127
10848718-2	2000	Since there is great interindividual variability in the pharmacokinetics of HCQ and chloroquine is a potent inhibitor of CYP2D6-catalysed pathways in vitro, we wished to study the interaction of HCQ with CYP2D6-mediated metabolism of other drugs in vivo.	Chloroquine	84-95	cytochrome P450 family 2 subfamily D member 6	Homo sapiens	204-210
10828481-3	2000	In thrombin-activated platelets, chloroquine decreased in a dose-dependent manner phospholipase A(2)-induced arachidonic acid liberation from membrane phospholipids, malondialdehyde formation (a marker of membrane phospholipid peroxidation), and thromboxane generation, considered the most potent autoaggregatory agent.	Chloroquine	33-44	coagulation factor II, thrombin	Homo sapiens	3-11
10828481-6	2000	On the other hand, thrombin-stimulated serotonin secretion was significantly decreased with chloroquine in the concentration of 10 micromol/L.	Chloroquine	92-103	coagulation factor II, thrombin	Homo sapiens	19-27
10831384-1	2000	A multidrug-resistant strain of Plasmodium yoelii nigeriensis (MDR) showing a wide spectrum of resistance to chloroquine, amodiaquine, mepacrine, mefloquine, halofantrine, quinine, and quinidine was used in this study for in vivo evaluation of the blood schizontocidal activity of pyronaridine, a topoisomerase II inhibitor, in Swiss mice.	Chloroquine	109-120	malic enzyme complex, mitochondrial	Mus musculus	63-66
10719307-8	2000	Preincubation with dapsone, chloroquine, and lidocaine dose dependently resulted in a significant reduction of all histamine release, CD63 expression, and sulfidoleukotriene production.	Chloroquine	28-39	CD63 molecule	Homo sapiens	134-138
10903761-0	2000	Chloroquine interferes with lipopolysaccharide-induced TNF-alpha gene expression by a nonlysosomotropic mechanism.	Chloroquine	0-11	tumor necrosis factor	Homo sapiens	55-64
10903761-2	2000	Consistent with its anti-inflammatory properties, CQ has been shown to interfere with TNF-alpha release from mononuclear phagocytes.	Chloroquine	50-52	tumor necrosis factor	Homo sapiens	86-95
10903761-4	2000	CQ exhibited dose-dependent inhibition of LPS-induced TNF-alpha release from human PBMC at therapeutically attainable concentrations.	Chloroquine	0-2	tumor necrosis factor	Homo sapiens	54-63
10903761-5	2000	Additional studies to determine the specificity of this effect showed that although CQ reduced IL-1beta and IL-6 release, secretion of RANTES was unaffected.	Chloroquine	84-86	interleukin 1 beta	Homo sapiens	95-103
10903761-5	2000	Additional studies to determine the specificity of this effect showed that although CQ reduced IL-1beta and IL-6 release, secretion of RANTES was unaffected.	Chloroquine	84-86	interleukin 6	Homo sapiens	108-112
10903761-6	2000	CQ acted by reducing TNF-alpha mRNA accumulation without destabilizing its mRNA or interfering with NF-kappaB nuclear translocation or p50/p65 isoform composition of DNA-binding complexes.	Chloroquine	0-2	tumor necrosis factor	Homo sapiens	21-30
10903761-6	2000	CQ acted by reducing TNF-alpha mRNA accumulation without destabilizing its mRNA or interfering with NF-kappaB nuclear translocation or p50/p65 isoform composition of DNA-binding complexes.	Chloroquine	0-2	nuclear factor kappa B subunit 1	Homo sapiens	135-138
10903761-6	2000	CQ acted by reducing TNF-alpha mRNA accumulation without destabilizing its mRNA or interfering with NF-kappaB nuclear translocation or p50/p65 isoform composition of DNA-binding complexes.	Chloroquine	0-2	RELA proto-oncogene, NF-kB subunit	Homo sapiens	139-142
10903761-7	2000	Intracellular cytokine staining indicated that CQ reduced TNF-alpha production pretranslationally without interfering with TNF-alpha processing or release.	Chloroquine	47-49	tumor necrosis factor	Homo sapiens	58-67
10903761-9	2000	Although bafilomycin A1 alone did not interfere with TNF-alpha expression, preincubation augmented the ability of CQ to reduce TNF-alpha mRNA levels, suggesting that CQ did not act by a lysosomotropic mechanism.	Chloroquine	114-116	tumor necrosis factor	Homo sapiens	127-136
10903761-11	2000	These data indicate that CQ inhibits TNF-alpha gene expression without altering translocation of NF-kappaB p50/p65 heterodimers.	Chloroquine	25-27	tumor necrosis factor	Homo sapiens	37-46
10884369-7	2000	Chloroquine and monensin, compounds that disrupt plasma membrane recycling, reduced hH1 current, suggesting rapid turnover of channels at the cell surface.	Chloroquine	0-11	H1.5 linker histone, cluster member	Homo sapiens	84-87
10736425-7	2000	Moreover, using IAAQ, we showed that molar excesses of chloroquine, quinine, quinidine, and MK-571 inhibit the photoaffinity labeling of MRP.	Chloroquine	55-66	ATP binding cassette subfamily C member 3	Homo sapiens	137-140
10779594-0	2000	Deletion of the parasite-specific insertions and mutation of the catalytic triad in glutathione reductase from chloroquine-sensitive Plasmodium falciparum 3D7.	Chloroquine	111-122	glutathione reductase	Plasmodium falciparum 3D7	84-105
10779594-3	2000	In comparison to the known GR of the chloroquine-resistant K1 strain there are three base exchanges all of them leading to amino acid substitutions (residues 281, 285 and 335).	Chloroquine	37-48	glutathione reductase	Plasmodium falciparum 3D7	27-29
10688832-7	2000	In contrast, pulsing in the presence of chloroquine, the proteasome inhibitory peptide MG115, or Brefeldin A enhanced APC immunity (70-100% of recipients antibody positive by the second transfusion [P &lt;.05]); these agents allowed the pulsed APC to stimulate IgG2a but inhibited IgG1 production and this correlated with a reduction in serum interleukin (IL)-4 levels.	Chloroquine	40-51	interleukin 4	Homo sapiens	343-361
10672987-3	2000	Morphine, a mu-opiate receptor agonist (1.0 mg/kg IP), potentiated the chloroquine-induced rat body scratching to 40+/-6.6, while the mu-opiate receptor antagonist, naltrexone (0.25 mg/kg, IP, given 15 min prior) blocked the chloroquine induced body scratching to 4.5+/-2 (p &lt; 0.05 ANOVA).	Chloroquine	71-82	opioid related nociceptin receptor 1	Rattus norvegicus	12-30
10793267-1	2000	We postulated that chloroquine and/or ethanol affect plasma arginine vasopressin (AVP) concentrations to alter renal function.	Chloroquine	19-30	arginine vasopressin	Rattus norvegicus	69-80
10664060-0	2000	Multifocal ERG in chloroquine retinopathy: regional variance of retinal dysfunction.	Chloroquine	18-29	ETS transcription factor ERG	Homo sapiens	11-14
10878444-5	2000	Chloroquine inhibited the transcytosis rate of both TCII and IF-bound Cbl in a dose-dependent manner.	Chloroquine	0-11	transcobalamin 2	Homo sapiens	52-56
10878444-5	2000	Chloroquine inhibited the transcytosis rate of both TCII and IF-bound Cbl in a dose-dependent manner.	Chloroquine	0-11	cobalamin binding intrinsic factor	Homo sapiens	61-63
10793267-1	2000	We postulated that chloroquine and/or ethanol affect plasma arginine vasopressin (AVP) concentrations to alter renal function.	Chloroquine	19-30	arginine vasopressin	Rattus norvegicus	82-85
10793267-9	2000	Chloroquine infusion alone (0.06 microg.min(-1)) and/or ethanol (2.4 or 24 microg.min(-1)) elevated plasma AVP concentrations from 9.73 +/- 1.64 fmol.l(-1) in control rats to 15.65 +/- 2.49 fmol.l(-1), 17.	Chloroquine	0-11	arginine vasopressin	Rattus norvegicus	107-110
10718278-0	2000	Chloroquine inhibits arginine vasopressin production in isolated rat inner medullary segments induced cAMP collecting duct.	Chloroquine	0-11	arginine vasopressin	Rattus norvegicus	30-41
10718278-1	2000	Previous studies showed that acute chloroquine administration increases plasma arginine vasopressin (AVP) concentration in the rat without influencing urine flow rate.	Chloroquine	35-46	arginine vasopressin	Rattus norvegicus	88-99
10718278-2	2000	The present study was designed to investigate whether chloroquine inhibits the AVP-induced cAMP production that mediates the antidiuretic effects of vasopressin.	Chloroquine	54-65	arginine vasopressin	Rattus norvegicus	149-160
10556149-2	1999	In blood-free perfused and ventilated rat lungs, PAF increased lung weight by 0.59 +/- 0.18 g. The cyclooxygenase inhibitor aspirin (500 microM) blocked this response by one-third, and the quinolines quinine (330 microM), quinidine (100 microM), and chloroquine (100 microM) by two-thirds.	Chloroquine	250-261	PCNA clamp associated factor	Rattus norvegicus	49-52
10590267-4	1999	Low concentrations of chloroquine (&lt;5 microM) selectively abolished CpG DNA-mediated protection against spontaneous apoptosis of splenic B cells and against anti-IgM-induced apoptosis of WEHI-231 cells without affecting anti-apoptotic activities of anti-CD40 or lipopolsaccharide.	Chloroquine	22-33	CD40 antigen	Mus musculus	257-261
10438529-10	1999	The weak base chloroquine strongly inhibited (125)I-gp120 proteolysis and caused its intracellular accumulation, suggesting involvement of a low pH organelle.	Chloroquine	14-25	inter-alpha-trypsin inhibitor heavy chain 4	Homo sapiens	52-57
10543444-5	1999	When the lysosomal degradation was inhibited by chloroquine, an increase of neurofibromin by a factor of 2 to 3, correlating with an increased half-life, was measured.	Chloroquine	48-59	neurofibromin 1	Homo sapiens	76-89
10556209-8	1999	Extracellular holoferritin uptake elevated the cellular labile iron pool (LIP) and reduced iron regulatory protein (IRP) activity; this was inhibited by leupeptin or chloroquine.	Chloroquine	166-177	Wnt family member 2	Homo sapiens	91-114
10556209-8	1999	Extracellular holoferritin uptake elevated the cellular labile iron pool (LIP) and reduced iron regulatory protein (IRP) activity; this was inhibited by leupeptin or chloroquine.	Chloroquine	166-177	Wnt family member 2	Homo sapiens	116-119
10703730-3	1999	Chloroquine, on the other hand, was more effective in the inhibition of thrombin-induced arachidonic acid liberation.	Chloroquine	0-11	coagulation factor II, thrombin	Homo sapiens	72-80
10577734-4	1999	Noninfected control mice treated with CQ showed an increase production of IFN-gamma.	Chloroquine	38-40	interferon gamma	Mus musculus	74-83
10577734-6	1999	CQ treatment of infected mice resulted in parasite clearance that was associated with an earlier production of IL-4, IL-6, and IL-10 when compared with nontreated infected mice.	Chloroquine	0-2	interleukin 4	Mus musculus	111-115
10577734-6	1999	CQ treatment of infected mice resulted in parasite clearance that was associated with an earlier production of IL-4, IL-6, and IL-10 when compared with nontreated infected mice.	Chloroquine	0-2	interleukin 6	Mus musculus	117-121
10577734-6	1999	CQ treatment of infected mice resulted in parasite clearance that was associated with an earlier production of IL-4, IL-6, and IL-10 when compared with nontreated infected mice.	Chloroquine	0-2	interleukin 10	Mus musculus	127-132
10563518-0	1999	Chloroquine inhibits inducible nitric oxide synthase expression in murine peritoneal macrophages.	Chloroquine	0-11	nitric oxide synthase 2, inducible	Mus musculus	21-52
10563518-3	1999	Chloroquine is being used as an antiinflammatory drug, and its inhibitory effect on the synthesis of pro-inflammatory cytokines, such as tumour necrosis factor-alpha and interferon-gamma, has been reported.	Chloroquine	0-11	interferon gamma	Mus musculus	170-186
10563518-4	1999	In this study, we examined whether chloroquine could inhibit nitric oxide synthesis in murine peritoneal macrophages stimulated with interferon-gamma and lipopolysaccharide.	Chloroquine	35-46	interferon gamma	Mus musculus	133-149
10563518-5	1999	Although prolonged incubation of cells with high concentrations of chloroquine showed some cytotoxicity, the drug itself was not cytotoxic when macrophages were preincubated with chloroquine for 2 hr, washed and stimulated with interferon-gamma and lipopolysaccharide in the absence of chloroquine for another 48 hr.	Chloroquine	67-78	interferon gamma	Mus musculus	228-244
10563518-6	1999	The nitric oxide production from stimulated macrophages was markedly reduced by chloroquine in a dose-dependent manner and induction of inducible nitric oxide synthase mRNA was also suppressed by chloroquine pretreatment.	Chloroquine	196-207	nitric oxide synthase 2, inducible	Mus musculus	136-167
10563518-7	1999	These results show that chloroquine inhibits the induction of inducible nitric oxide synthase from interferon-gamma and lipopolysaccharide-stimulated macrophages, thereby reducing nitric oxide synthesis.	Chloroquine	24-35	nitric oxide synthase 2, inducible	Mus musculus	62-93
10563518-7	1999	These results show that chloroquine inhibits the induction of inducible nitric oxide synthase from interferon-gamma and lipopolysaccharide-stimulated macrophages, thereby reducing nitric oxide synthesis.	Chloroquine	24-35	interferon gamma	Mus musculus	99-115
10500178-0	1999	Phenotypic reversal of the btn1 defects in yeast by chloroquine: a yeast model for Batten disease.	Chloroquine	52-63	amino acid transporter YHC3	Saccharomyces cerevisiae S288C	27-31
10500178-4	1999	We have determined that growing btn1-Delta strains in the presence of chloroquine reverses the resistance to ANP, decreases the rate of medium acidification, decreases the activity of plasma membrane H(+)-ATPase, and elevates vacuolar pH.	Chloroquine	70-81	CLN3 lysosomal/endosomal transmembrane protein, battenin	Homo sapiens	32-36
10411915-6	1999	In addition, we found high sensitivity to chloroquine in cultured fibroblasts from MLIV patients.	Chloroquine	42-53	mucolipin TRP cation channel 1	Homo sapiens	83-87
10463664-4	1999	Furthermore, chloroquine enhances IL-1Ra production in RAW cells in vitro.	Chloroquine	13-24	interleukin 1 receptor antagonist	Homo sapiens	34-40
10497894-1	1999	The inhibition of ion transporting ATPases (Na+,K+-ATPase, Ca2+,Mg2+- and Ca2+-ATPase) by two amphiphilic drugs e.g. chlorpromazine (antipsychotic) and chloroquine (antimalarial) are found to be competitive in nature in vitro with respect to the substrate.	Chloroquine	152-163	dynein axonemal heavy chain 8	Homo sapiens	35-41
10411915-8	1999	Fusion products of normal and MLIV fibroblasts, but not MLIV fibroblasts themselves, were relatively protected against chloroquine selection.	Chloroquine	119-130	mucolipin TRP cation channel 1	Homo sapiens	30-34
10442457-4	1999	Chloroquine treatment resulted in a significant increase of the length of the apical shafts, apical dendrites and basal dendrites of the CA3 neurons (p &lt; 0.05) under doses comparable to serum levels reached during long-term therapy.	Chloroquine	0-11	carbonic anhydrase 3	Rattus norvegicus	137-140
10049718-6	1999	Phage displaying bivalent diabodies or multiple copies of scFv were more efficiently endocytosed than phage displaying monomeric scFv and recovery of infectious phage was increased by preincubation of cells with chloroquine.	Chloroquine	212-223	immunglobulin heavy chain variable region	Homo sapiens	58-62
10366739-5	1999	DOR intracellular staining was enhanced in the presence of agonist and chloroquine, a lysosomotropic agent, suggesting that internalized receptors were targeted to lysosomes and degraded upon prolonged treatment.	Chloroquine	71-82	opioid receptor, delta 1	Mus musculus	0-3
10492767-1	1999	Chlorpheniramine (CP), a histamine H1-receptor antagonist, enhances the efficacy of chloroquine (CQ) in acute uncomplicated falciparum malaria.	Chloroquine	84-95	histamine receptor H1	Homo sapiens	25-46
11783271-2	1999	METHODS: Change of nitrite (NO2-), the terminal product of nitric oxide (NO) metabolism, and the effect of TFA and chloroquine (a phospholipase A2 inhibitor) on it were observed with hemorrhagic shock/reperfusion injury (S/R) rabbit model.	Chloroquine	115-126	phospholipase A2	Oryctolagus cuniculus	130-146
10406948-10	1999	Inhibition of lysosomal hydrolysis with chloroquine abolished the effect measured on ACAT activity in the presence of LDL, suggesting that CE of LDL, but not free cholesterol, maintains cell cholesterol homeostasis.	Chloroquine	40-51	carboxylesterase 1	Homo sapiens	85-89
10092635-4	1999	Although expression of MTP in cells allowed apoB to completely enter the endoplasmic reticulum, it was degraded by a proteolytic process that was inhibited by dithiothreitol (1 mM) and chloroquine (100 microM), but resistant to N-acetyl-leucyl-leucyl-norleucinal.	Chloroquine	185-196	LOW QUALITY PROTEIN: microsomal triglyceride transfer protein large subunit	Cricetulus griseus	23-26
10049718-6	1999	Phage displaying bivalent diabodies or multiple copies of scFv were more efficiently endocytosed than phage displaying monomeric scFv and recovery of infectious phage was increased by preincubation of cells with chloroquine.	Chloroquine	212-223	immunglobulin heavy chain variable region	Homo sapiens	129-133
9886486-18	1999	This degradation was suppressed by chloroquine and 3-methyladenine, suggesting that aldolase B was being degraded within autolysosomes.	Chloroquine	35-46	aldolase, fructose-bisphosphate B	Rattus norvegicus	84-94
10524550-7	1999	It was concluded that a clinical response to chloroquine therapy in early RA patients can be predicted by a low CRP level at baseline.	Chloroquine	45-56	C-reactive protein	Homo sapiens	112-115
10025898-19	1999	In contrast, chloroquine partially restored the activity of CD22-rec ricin A in the presence of human serum.	Chloroquine	13-24	CD22 molecule	Homo sapiens	60-64
10025898-20	1999	We conclude that monensin, nigericin and the combination of NH4Cl and chloroquine can be used instead of NH4Cl to potentiate CD22-rec ricin A activity in purging autologous bone marrow transplants contaminated with malignant B cells.	Chloroquine	70-81	CD22 molecule	Homo sapiens	125-129
10025898-21	1999	Chloroquine might be a promising enhancer of CD22-rec ricin A for treating patients in vivo.	Chloroquine	0-11	CD22 molecule	Homo sapiens	45-49
10438151-11	1999	However, when the cells were treated with 100 microM of chloroquine, a lysosomotropic agent, 85 and 40% of 3H-CE hydrolysis was lost for LDL and HDL3, respectively.	Chloroquine	56-67	HDL3	Homo sapiens	145-149
10396448-9	1999	Chloroquine and chlorpromazine, serving as PLA2 inhibitors, could abate cellular dysfunction and increase survival rate.	Chloroquine	0-11	phospholipase A2	Oryctolagus cuniculus	43-47
10474090-6	1999	CD11b and HLA class I antigens were removed when the extracted granulocyte antigens were treated with chloroquine.	Chloroquine	102-113	integrin subunit alpha M	Homo sapiens	0-5
9893120-5	1999	RESULTS: At 37 degreesC, HMCs rapidly internalized and degraded 125I-t-PA and 125I-u-PA, which could be inhibited by an excess of unlabeled t-PA and u-PA, respectively, and by the lysosomotropic agent chloroquine.	Chloroquine	201-212	MKKS centrosomal shuttling protein	Homo sapiens	25-29
9893120-5	1999	RESULTS: At 37 degreesC, HMCs rapidly internalized and degraded 125I-t-PA and 125I-u-PA, which could be inhibited by an excess of unlabeled t-PA and u-PA, respectively, and by the lysosomotropic agent chloroquine.	Chloroquine	201-212	plasminogen activator, tissue type	Homo sapiens	69-73
9893120-5	1999	RESULTS: At 37 degreesC, HMCs rapidly internalized and degraded 125I-t-PA and 125I-u-PA, which could be inhibited by an excess of unlabeled t-PA and u-PA, respectively, and by the lysosomotropic agent chloroquine.	Chloroquine	201-212	plasminogen activator, urokinase	Homo sapiens	83-87
9893120-12	1999	The fall in t-PA levels could be counteracted by inhibiting t-PA degradation by either RAP or chloroquine.	Chloroquine	94-105	plasminogen activator, tissue type	Homo sapiens	12-16
9893120-12	1999	The fall in t-PA levels could be counteracted by inhibiting t-PA degradation by either RAP or chloroquine.	Chloroquine	94-105	plasminogen activator, tissue type	Homo sapiens	60-64
9893120-13	1999	Interestingly, chloroquine also quenched the TNFalpha-induced changes in t-PA and PAI-1 mRNA levels.	Chloroquine	15-26	tumor necrosis factor	Homo sapiens	45-53
9893120-13	1999	Interestingly, chloroquine also quenched the TNFalpha-induced changes in t-PA and PAI-1 mRNA levels.	Chloroquine	15-26	plasminogen activator, tissue type	Homo sapiens	73-77
9893120-13	1999	Interestingly, chloroquine also quenched the TNFalpha-induced changes in t-PA and PAI-1 mRNA levels.	Chloroquine	15-26	serpin family E member 1	Homo sapiens	82-87
9893120-14	1999	Using TNFalpha mutants and agonistic or blocking monoclonal antibodies specific for the TNF receptors p55 and p75, we found evidence that chloroquine interfered with the activation of the TNF receptor p55 and/or its intracellular signaling route.	Chloroquine	138-149	tumor necrosis factor	Homo sapiens	6-14
9893120-14	1999	Using TNFalpha mutants and agonistic or blocking monoclonal antibodies specific for the TNF receptors p55 and p75, we found evidence that chloroquine interfered with the activation of the TNF receptor p55 and/or its intracellular signaling route.	Chloroquine	138-149	TNF receptor superfamily member 1A	Homo sapiens	102-105
9893120-14	1999	Using TNFalpha mutants and agonistic or blocking monoclonal antibodies specific for the TNF receptors p55 and p75, we found evidence that chloroquine interfered with the activation of the TNF receptor p55 and/or its intracellular signaling route.	Chloroquine	138-149	TNF receptor superfamily member 1B	Homo sapiens	110-113
9893120-14	1999	Using TNFalpha mutants and agonistic or blocking monoclonal antibodies specific for the TNF receptors p55 and p75, we found evidence that chloroquine interfered with the activation of the TNF receptor p55 and/or its intracellular signaling route.	Chloroquine	138-149	TNF receptor superfamily member 1A	Homo sapiens	201-204
9868742-3	1998	In the present study the effects of tamoxifen, toremifene and chloroquine on the activity of two lysosomal enzymes (cathepsin D and N-acetyl-beta-D-glucosaminidase) in the retinal pigment epithelial cells were studied.	Chloroquine	62-73	cathepsin D	Sus scrofa	116-127
9843988-4	1998	IL-6 does not induce conventional maturation of dendritic cells but alters the pH of peripheral, early endosomal compartments and renders the cells more susceptible to killing by chloroquine.	Chloroquine	179-190	interleukin 6	Homo sapiens	0-4
9868742-8	1998	Cathepsin D and N-acetyl-beta-D-glucosaminidase showed different sensitivities to tamoxifen, toremifene and chloroquine.	Chloroquine	108-119	cathepsin D	Sus scrofa	0-11
9868742-11	1998	Chloroquine had only a minor effect on the lysosomal protease cathepsin D, but a clearer effect could be seen on N-acetyl-beta-glucosaminidase.	Chloroquine	0-11	cathepsin D	Sus scrofa	62-73
9751078-0	1998	Direct binding of chloroquine to the multidrug resistance protein (MRP): possible role for MRP in chloroquine drug transport and resistance in tumor cells.	Chloroquine	18-29	ATP binding cassette subfamily C member 1	Homo sapiens	37-65
9812997-5	1998	The lipoprotein-stimulated, SR-BI-dependent increase in cholesterol esterification was inhibited by chloroquine.	Chloroquine	100-111	scavenger receptor class B member 1	Cricetulus griseus	28-33
9972459-2	1998	In Plasmodium there is a correlation between chloroquine resistance and cytochrome P450 mono-oxygenase activity, but there is no evidence that the malarial parasite metabolises chloroquine by an oxidative mechanism.	Chloroquine	45-56	cytochrome P450 family 20 subfamily A member 1	Homo sapiens	72-102
9794373-6	1998	Our results indicate that CpG DNA activates the p38 and c-Jun NH2-terminal kinase MAPK and leads to the activation of AP-1 via a pathway which is sensitive to chloroquine.	Chloroquine	159-170	mitogen-activated protein kinase 14	Mus musculus	48-51
9794373-6	1998	Our results indicate that CpG DNA activates the p38 and c-Jun NH2-terminal kinase MAPK and leads to the activation of AP-1 via a pathway which is sensitive to chloroquine.	Chloroquine	159-170	jun proto-oncogene	Mus musculus	56-61
9794373-6	1998	Our results indicate that CpG DNA activates the p38 and c-Jun NH2-terminal kinase MAPK and leads to the activation of AP-1 via a pathway which is sensitive to chloroquine.	Chloroquine	159-170	jun proto-oncogene	Mus musculus	118-122
9781573-0	1998	Chloroquine myopathy and neuropathy with elevated CSF protein.	Chloroquine	0-11	colony stimulating factor 2	Homo sapiens	50-53
9739164-20	1998	Chloroquine and wortmannin were also able to inhibit degradation of both forms of vitronectin, indicating that both multimeric forms were following the same endocytic and degradative pathway.	Chloroquine	0-11	vitronectin	Homo sapiens	82-93
9878217-11	1998	However, in the presence of chloroquine only, undegraded ANP was detected in the medium, and phorbol esters stimulated its rate of appearance by approximately 2 fold.	Chloroquine	28-39	natriuretic peptide A	Homo sapiens	57-60
9801165-1	1998	Murine N9 microglia accumulated A beta from media containing 0.67 microM A beta within 6 h. In N9 and in primary rat microglia, chloroquine, which disrupts lysosomal pH, increased A beta-induced accumulation of A beta, particularly A beta1-42.	Chloroquine	128-139	histocompatibility 2, class II antigen A, beta 1	Mus musculus	32-38
9801165-1	1998	Murine N9 microglia accumulated A beta from media containing 0.67 microM A beta within 6 h. In N9 and in primary rat microglia, chloroquine, which disrupts lysosomal pH, increased A beta-induced accumulation of A beta, particularly A beta1-42.	Chloroquine	128-139	histocompatibility 2, class II antigen A, beta 1	Mus musculus	73-79
9801165-1	1998	Murine N9 microglia accumulated A beta from media containing 0.67 microM A beta within 6 h. In N9 and in primary rat microglia, chloroquine, which disrupts lysosomal pH, increased A beta-induced accumulation of A beta, particularly A beta1-42.	Chloroquine	128-139	amyloid beta precursor protein	Rattus norvegicus	73-79
9801165-1	1998	Murine N9 microglia accumulated A beta from media containing 0.67 microM A beta within 6 h. In N9 and in primary rat microglia, chloroquine, which disrupts lysosomal pH, increased A beta-induced accumulation of A beta, particularly A beta1-42.	Chloroquine	128-139	amyloid beta precursor protein	Rattus norvegicus	73-79
9801165-4	1998	After prolonged incubations, chloroquine enhanced A beta multimer (8-12 kDa) accumulation, an effect inhibited by fucoidan.	Chloroquine	29-40	histocompatibility 2, class II antigen A, beta 1	Mus musculus	50-56
9751078-0	1998	Direct binding of chloroquine to the multidrug resistance protein (MRP): possible role for MRP in chloroquine drug transport and resistance in tumor cells.	Chloroquine	18-29	ATP binding cassette subfamily C member 1	Homo sapiens	67-70
9751078-0	1998	Direct binding of chloroquine to the multidrug resistance protein (MRP): possible role for MRP in chloroquine drug transport and resistance in tumor cells.	Chloroquine	18-29	ATP binding cassette subfamily C member 1	Homo sapiens	91-94
9751078-0	1998	Direct binding of chloroquine to the multidrug resistance protein (MRP): possible role for MRP in chloroquine drug transport and resistance in tumor cells.	Chloroquine	98-109	ATP binding cassette subfamily C member 1	Homo sapiens	37-65
9751078-0	1998	Direct binding of chloroquine to the multidrug resistance protein (MRP): possible role for MRP in chloroquine drug transport and resistance in tumor cells.	Chloroquine	98-109	ATP binding cassette subfamily C member 1	Homo sapiens	67-70
9751078-0	1998	Direct binding of chloroquine to the multidrug resistance protein (MRP): possible role for MRP in chloroquine drug transport and resistance in tumor cells.	Chloroquine	98-109	ATP binding cassette subfamily C member 1	Homo sapiens	91-94
9751078-4	1998	In the present report, we demonstrated that the lysosomotropic or antimalarial drug chloroquine is a substrate for MRP.	Chloroquine	84-95	ATP binding cassette subfamily C member 1	Homo sapiens	115-118
9751078-5	1998	Specifically, our results showed that chloroquine, similar to leukotriene C4 (LTC4) and 3-(3-(2-(7-chloro-2-quinolinyl)ethenyl-phenyl)((3-(dimethyl amino-3-oxo propyl)thio)methyl)thio) propanoic acid (MK 571), inhibits the photoaffinity labeling of MRP by IAAQ.	Chloroquine	38-49	ATP binding cassette subfamily C member 1	Homo sapiens	249-252
9751078-6	1998	Furthermore, cell growth assays showed MRP-expressing multidrug-resistant cells (H69/AR and HL60/AR) to be more resistant to chloroquine than their parental cells (i.e., IC50 of 121 microM versus 28 microM chloroquine for H69/AR and H69, respectively).	Chloroquine	125-136	ATP binding cassette subfamily C member 1	Homo sapiens	39-42
9751078-6	1998	Furthermore, cell growth assays showed MRP-expressing multidrug-resistant cells (H69/AR and HL60/AR) to be more resistant to chloroquine than their parental cells (i.e., IC50 of 121 microM versus 28 microM chloroquine for H69/AR and H69, respectively).	Chloroquine	206-217	ATP binding cassette subfamily C member 1	Homo sapiens	39-42
9751078-7	1998	Moreover, MK 571, an LTD4 receptor antagonist, reversed the resistance of H69/AR cells to chloroquine.	Chloroquine	90-101	cysteinyl leukotriene receptor 1	Homo sapiens	21-34
9751078-10	1998	Taken together, the results of this study show that MRP modulates the transport of chloroquine by direct binding.	Chloroquine	83-94	ATP binding cassette subfamily C member 1	Homo sapiens	52-55
9726634-2	1998	NO synthesis by interferon-gamma-induced mouse and casein-elicited rat macrophages was significantly and irreversibly inhibited by chloroquine.	Chloroquine	131-142	interferon gamma	Mus musculus	16-32
9764961-5	1998	RESULTS: Chloroquine caused a progressive and significant decrease in CYP2D6 activity as measured by debrisoquine metabolism from first to seventh dose and the activity returned to baseline gradually over 14 days after stopping administration.	Chloroquine	9-20	cytochrome P450 family 2 subfamily D member 6	Homo sapiens	70-76
9764961-7	1998	CONCLUSIONS: Chloroquine has been shown to be capable of inhibiting the activity of CYP2D6 in vivo in humans.	Chloroquine	13-24	cytochrome P450 family 2 subfamily D member 6	Homo sapiens	84-90
9744804-3	1998	In this report, we have investigated the transport properties of ORCTL2 and show that this protein can confer resistance to chloroquine and quinidine when overexpressed in bacteria.	Chloroquine	124-135	solute carrier family 22 member 18	Homo sapiens	65-71
9744804-5	1998	These results suggest that ORCTL2 may play a role in the transport of chloroquine and quinidine related compounds in the kidney.	Chloroquine	70-81	solute carrier family 22 member 18	Homo sapiens	27-33
9749941-8	1998	Agents that elevate intracellular pH, such as ammonium chloride and chloroquine, also caused an intracellular accumulation of tropoelastin which appeared by immunofluorescence staining to be localized in secretory vesicles and/or endosomes.	Chloroquine	68-79	elastin	Bos taurus	126-138
9730897-4	1998	The antigen processing pathway used to present insulin to the Qa-1(b)- restricted T cells does not require transporters associated with antigen processing (TAP), and it is inhibited by chloroquine.	Chloroquine	185-196	histocompatibility 2, T region locus 23	Mus musculus	62-68
9800293-3	1998	Previously, we reported that chloroquine (CH) inhibited the cytotoxicity of cytotoxic T-cell (CTL) clones and tumour necrosis factor beta (TNF beta) production by TNF beta-producing clones in vitro, both the clones being derived from peripheral blood lymphocytes (PBMCs) of PT-GVHD patients.	Chloroquine	29-40	lymphotoxin alpha	Homo sapiens	139-147
9800293-3	1998	Previously, we reported that chloroquine (CH) inhibited the cytotoxicity of cytotoxic T-cell (CTL) clones and tumour necrosis factor beta (TNF beta) production by TNF beta-producing clones in vitro, both the clones being derived from peripheral blood lymphocytes (PBMCs) of PT-GVHD patients.	Chloroquine	29-40	lymphotoxin alpha	Homo sapiens	163-171
9800293-3	1998	Previously, we reported that chloroquine (CH) inhibited the cytotoxicity of cytotoxic T-cell (CTL) clones and tumour necrosis factor beta (TNF beta) production by TNF beta-producing clones in vitro, both the clones being derived from peripheral blood lymphocytes (PBMCs) of PT-GVHD patients.	Chloroquine	42-44	lymphotoxin alpha	Homo sapiens	139-147
9800293-3	1998	Previously, we reported that chloroquine (CH) inhibited the cytotoxicity of cytotoxic T-cell (CTL) clones and tumour necrosis factor beta (TNF beta) production by TNF beta-producing clones in vitro, both the clones being derived from peripheral blood lymphocytes (PBMCs) of PT-GVHD patients.	Chloroquine	42-44	lymphotoxin alpha	Homo sapiens	163-171
9691096-2	1998	We have found that the antimalarial and antiinflammatory drug, chloroquine, is able to stimulate NO synthase (NOS) activity in murine, porcine, and human endothelial cells in vitro: the increase of enzyme activity is dependent on a de novo synthesis of some regulatory protein, as it is inhibited by cycloheximide but is not accompanied by an increased expression of inducible or constitutive NOS isoforms.	Chloroquine	63-74	nitric oxide synthase 1, neuronal	Mus musculus	97-108
9691096-3	1998	Increased NO synthesis is, at least partly, responsible for chloroquine-induced inhibition of cell proliferation: indeed, NOS inhibitors revert the drug-evoked blockage of mitogenesis and ornithine decarboxylase activity in murine and porcine endothelial cells.	Chloroquine	60-71	ornithine decarboxylase, structural 1	Mus musculus	188-211
9726634-3	1998	The activity of the inducible NO synthase was not directly altered, but previous incubation of macrophages with chloroquine decreased it.	Chloroquine	112-123	nitric oxide synthase 2, inducible	Mus musculus	20-41
9726634-6	1998	Western blotting showed that inducible NO synthase synthesis was blocked by chloroquine.	Chloroquine	76-87	nitric oxide synthase 2, inducible	Mus musculus	29-50
9670045-9	1998	Finally, treatment of rats with two structurally distinct inhibitors of polyamine oxidase (aminoguanidine and chloroquine) attenuates brain polyamine oxidase activity, prevents the production of 3-aminopropanal, and significantly protects against the development of ischemic brain damage in vivo.	Chloroquine	110-121	polyamine oxidase	Rattus norvegicus	72-89
9670045-9	1998	Finally, treatment of rats with two structurally distinct inhibitors of polyamine oxidase (aminoguanidine and chloroquine) attenuates brain polyamine oxidase activity, prevents the production of 3-aminopropanal, and significantly protects against the development of ischemic brain damage in vivo.	Chloroquine	110-121	polyamine oxidase	Rattus norvegicus	140-157
9674599-1	1998	Incubation of cultured hippocampal slices with chloroquine, a compound that increases the pH of acidic subcellular organelles, for 10 h reduced the activity of cathepsin L by 83 +/- 0.87% (mean +/- s.e.m.)	Chloroquine	47-58	cathepsin L	Homo sapiens	160-171
9704973-0	1998	Chloroquine myopathy suggests that tau is degraded in lysosomes: implication for the formation of paired helical filaments in Alzheimer"s disease.	Chloroquine	0-11	microtubule associated protein tau	Homo sapiens	35-38
9619449-7	1998	Environmental antigens (Ag) were used to evaluate IP-10"s effect on CD4-dependent, chloroquine-sensitive cytokine synthesis.	Chloroquine	83-94	C-X-C motif chemokine ligand 10	Homo sapiens	50-55
9665342-6	1998	Degradation of both free and complexed UPA was reduced by 70% by colchicine, chloroquine and methylamine, indicating that degradation involved both internalization and lysosomal enzymes.	Chloroquine	77-88	plasminogen activator, urokinase	Homo sapiens	39-42
9603457-4	1998	Site-specific insertion of antigenic sequences into the CLIP region promoted enhanced antigenicity of li hybrids which were shown to be processed intracellularly in a chloroquine-sensitive compartment.	Chloroquine	167-178	CAP-Gly domain containing linker protein 1	Homo sapiens	56-60
9747439-5	1998	RESULTS: Immunoblots of whole cell lysates demonstrated increased levels of connexin43 in cultures treated with lysosomal inhibitors (chloroquine, leupeptin, E-64, or ammonium chloride) or proteasomal inhibitors (lactacystin or ALLN).	Chloroquine	134-145	gap junction protein, alpha 1	Rattus norvegicus	76-86
9747439-6	1998	Pulse-chase experiments showed that the half-life of connexin43 was 1.4 h in control cultures, but was prolonged to 2.0 or 2.8 h in cultures treated with chloroquine or lactacystin, respectively.	Chloroquine	154-165	gap junction protein, alpha 1	Rattus norvegicus	53-63
9747439-9	1998	Heat-induced connexin43 degradation was prevented by simultaneous treatment with lactacystin, ALLN, or chloroquine.	Chloroquine	103-114	gap junction protein, alpha 1	Rattus norvegicus	13-23
9593122-5	1998	Cross-resistance assays determined that STI1 also conferred resistance to mefloquine (3.4-fold), while CIN5 also conferred resistance to mefloquine (9.6-fold) and chloroquine (5.4-fold).	Chloroquine	163-174	Cin5p	Saccharomyces cerevisiae S288C	103-107
9704973-1	1998	We have found that amorphous tau deposits in chloroquine myopathy (CM), a vacuolar myopathy induced by the administration of chloroquine, a well-known lysosomotropic agent.	Chloroquine	45-56	microtubule associated protein tau	Homo sapiens	29-32
9704973-1	1998	We have found that amorphous tau deposits in chloroquine myopathy (CM), a vacuolar myopathy induced by the administration of chloroquine, a well-known lysosomotropic agent.	Chloroquine	125-136	microtubule associated protein tau	Homo sapiens	29-32
10896408-0	1998	Halofantrine and chloroquine inhibit CYP2D6 activity in healthy Zambians.	Chloroquine	17-28	cytochrome P450 family 2 subfamily D member 6	Homo sapiens	37-43
9575969-3	1998	Chloroquine revealed a dose-dependent inhibitory effect on endotoxin-induced secretion of tumor necrosis factor-alpha, interleukin-1 beta, and interleukin-6 that was associated with reduced cytokine mRNA expression.	Chloroquine	0-11	interleukin 1 beta	Homo sapiens	119-137
9575969-3	1998	Chloroquine revealed a dose-dependent inhibitory effect on endotoxin-induced secretion of tumor necrosis factor-alpha, interleukin-1 beta, and interleukin-6 that was associated with reduced cytokine mRNA expression.	Chloroquine	0-11	interleukin 6	Homo sapiens	143-156
9510087-10	1998	Quinacrine, and to a lesser extent chloroquine, has an inhibitory effect on the lipopolysaccharide- or zymosan-induced expression of interleukin 1beta and tumor necrosis factor alpha, both at the mRNA and protein levels.	Chloroquine	35-46	interleukin 1 beta	Mus musculus	133-182
9498761-5	1998	We show that approximately 25 to 35% of wild-type CD28 becomes endocytosed following Ab binding (t1/2 = 10 min), followed by segregation into two pools; one pool is destined for degradation in lysosomal compartments and is blocked by chloroquine, and another pool that is recycled to the cell surface (t1/2 = 2.5 h).	Chloroquine	234-245	CD28 molecule	Homo sapiens	50-54
10896408-1	1998	AIMS: To determine the effect of therapeutic loading doses of halofantrine and chloroquine on CYP2D6 activity in healthy black Zambians.	Chloroquine	79-90	cytochrome P450 family 2 subfamily D member 6	Homo sapiens	94-100
10896408-9	1998	CONCLUSIONS: Given in therapeutic loading doses, both halofantrine and chloroquine caused significant inhibition of CYP2D6 activity in healthy black Zambians.	Chloroquine	71-82	cytochrome P450 family 2 subfamily D member 6	Homo sapiens	116-122
9570525-2	1998	We report that quinacrine, chloroquine, and structurally related compounds completely inhibit the antiapoptotic effect of CpG-ODN on WEHI 231 murine B lymphoma cells and inhibit CpG-ODN-induced secretion of IL-6 by WEHI 231.	Chloroquine	27-38	interleukin 6	Mus musculus	207-211
9388254-8	1997	We found that C1-INH.125I-Cs complexes were efficiently degraded by normal murine fibroblasts expressing the low density lipoprotein receptor-related protein (LRP) and cellular degradation was significantly reduced by chloroquine and the receptor-associated protein, which is a potent inhibitor of the binding of all known ligands to LRP.	Chloroquine	218-229	serine (or cysteine) peptidase inhibitor, clade G, member 1	Mus musculus	14-20
9643651-8	1998	Alkalization of the endosomal compartments by treatment with NH4Cl or chloroquine also results in the loss of Hsp47 to the cell surface, presumably by inhibiting the retrieval of trans-Golgi network proteins from the cell surface.	Chloroquine	70-81	serpin family H member 1	Homo sapiens	110-115
9388254-8	1997	We found that C1-INH.125I-Cs complexes were efficiently degraded by normal murine fibroblasts expressing the low density lipoprotein receptor-related protein (LRP) and cellular degradation was significantly reduced by chloroquine and the receptor-associated protein, which is a potent inhibitor of the binding of all known ligands to LRP.	Chloroquine	218-229	low density lipoprotein receptor-related protein 1	Mus musculus	159-162
9455683-4	1997	The length of apical shaft, apical dendrites and basilar dendrites of the CA3 neurons showed a significant elongation (p &lt; 0.05) under low doses of Chloroquine.	Chloroquine	151-162	carbonic anhydrase 3	Rattus norvegicus	74-77
9323025-3	1997	Selective uptake of HDL3-CEs into a releasable pool (presumably located in the cellular plasma membrane) was temperature insensitive while prominent internalization into a non-releasable and subsequent hydrolysis in a non-chloroquine sensitive compartment occurred at 37 degrees C. Release of membrane bound endogenous LPL by heparin resulted in decreased HDL3 holoparticle, total CE and selective CE uptake.	Chloroquine	222-233	high density lipoprotein (HDL) level 3	Mus musculus	20-24
9414641-8	1997	Treatment with the antimalarial drug chloroquine may aggravate the defect in Epo production, because chloroquine inhibited Epo synthesis when tested in cell culture.	Chloroquine	37-48	erythropoietin	Homo sapiens	77-80
9414641-8	1997	Treatment with the antimalarial drug chloroquine may aggravate the defect in Epo production, because chloroquine inhibited Epo synthesis when tested in cell culture.	Chloroquine	37-48	erythropoietin	Homo sapiens	123-126
9414641-8	1997	Treatment with the antimalarial drug chloroquine may aggravate the defect in Epo production, because chloroquine inhibited Epo synthesis when tested in cell culture.	Chloroquine	101-112	erythropoietin	Homo sapiens	77-80
9414641-8	1997	Treatment with the antimalarial drug chloroquine may aggravate the defect in Epo production, because chloroquine inhibited Epo synthesis when tested in cell culture.	Chloroquine	101-112	erythropoietin	Homo sapiens	123-126
9341114-0	1997	Chloroquine extends the lifetime of the activated insulin receptor complex in endosomes.	Chloroquine	0-11	insulin receptor	Rattus norvegicus	50-66
9341114-6	1997	Chloroquine treatment also increased the insulin receptor content of endosomes after insulin injection (integrated over 0-45 min) by 31% when compared with controls (p &lt; 0.05).	Chloroquine	0-11	insulin receptor	Rattus norvegicus	41-57
9341114-7	1997	Similarly, chloroquine increased both insulin receptor phosphotyrosine content and its exogenous tyrosine kinase activity after insulin injection (64%; p &lt; 0.01 and 96% and p &lt; 0.	Chloroquine	11-22	insulin receptor	Rattus norvegicus	38-54
9341114-11	1997	These observations are consistent with the hypothesis that chloroquine-dependent inhibition of endosomal insulin receptor dissociation and subsequent degradation prolongs the half-life of the active endosomal receptor and potentiates insulin signaling from this compartment.	Chloroquine	59-70	insulin receptor	Rattus norvegicus	105-121
9385457-2	1997	In addition, the effect of the antimalarial chloroquine on blood levels of GSTM1 and GSTA in 19 subjects was studied.	Chloroquine	44-55	glutathione S-transferase mu 1	Homo sapiens	75-80
9385457-6	1997	Chloroquine decreased levels of blood GSTM1 and GSTA by 50% or more.	Chloroquine	0-11	glutathione S-transferase mu 1	Homo sapiens	38-43
9385457-7	1997	In populations treated with chloroquine, these decreases in GST activities might lead to compromised ability to detoxify xenobiotics, could confound GSTM1 phenotyping and might invalidate use of GSTA as an indicator of liver damage.	Chloroquine	28-39	glutathione S-transferase mu 1	Homo sapiens	149-154
9548465-2	1997	Indeed, inhibition of receptor internalization as well as NH4Cl and chloroquine blocked IL-1beta-mediated induction of NF-kappaB in OVCAR-3 and in other epithelial cell lines but not in lymphoid cells, indicating that distinct pathways are involved.	Chloroquine	68-79	interleukin 1 beta	Homo sapiens	88-96
9381529-4	1997	RESULTS: We found that similar concentrations of chloroquine and hydroxychloroquine suppress the T-cell response to MiHC in mice (C57BL/6 anti-BALB.B) and that lysosomotropic amines in combination with cyclosporine result in synergistic suppression of a proliferative response to MiHC.	Chloroquine	49-60	baculoviral IAP repeat-containing 3	Mus musculus	116-120
9381529-4	1997	RESULTS: We found that similar concentrations of chloroquine and hydroxychloroquine suppress the T-cell response to MiHC in mice (C57BL/6 anti-BALB.B) and that lysosomotropic amines in combination with cyclosporine result in synergistic suppression of a proliferative response to MiHC.	Chloroquine	49-60	baculoviral IAP repeat-containing 3	Mus musculus	280-284
9381529-6	1997	Direct inhibition by chloroquine of T-cell proliferative responses induced by anti-CD3epsilon in the absence of antigen-presenting cells is present at higher concentrations than that required to suppress responses to MiHC or MHC.	Chloroquine	21-32	CD3 antigen, epsilon polypeptide	Mus musculus	83-93
9381529-6	1997	Direct inhibition by chloroquine of T-cell proliferative responses induced by anti-CD3epsilon in the absence of antigen-presenting cells is present at higher concentrations than that required to suppress responses to MiHC or MHC.	Chloroquine	21-32	baculoviral IAP repeat-containing 3	Mus musculus	217-221
9332452-6	1997	Cell mediated insulin degradation in the presence of combinations of inhibitors suggested two pathways in adipocytes, one affected by inhibitors of the insulin degrading enzyme (IDE) (bacitracin and PCMBS) and the other altered by cell processing inhibitors (DC, CQ and phenylarsenoxide).	Chloroquine	263-265	insulin	Homo sapiens	14-21
9340579-2	1997	There was not effect of pertussis toxin and phorbol myristate acetate on the inhibiton of endogenous cholesterol synthesis, whereas calcium channel blocker verapamil and phospholipase A2-inhibitor chloroquine decreased it.	Chloroquine	197-208	phospholipase A2 group IB	Homo sapiens	170-186
9332452-7	1997	Chloroquine altered the pattern of the insulin-sized cell-associated HPLC assayed degradation products, further supporting two pathways of degradation; one a chloroquine-sensitive and one a chloroquine-insensitive pathway.	Chloroquine	0-11	insulin	Homo sapiens	39-46
9332452-7	1997	Chloroquine altered the pattern of the insulin-sized cell-associated HPLC assayed degradation products, further supporting two pathways of degradation; one a chloroquine-sensitive and one a chloroquine-insensitive pathway.	Chloroquine	158-169	insulin	Homo sapiens	39-46
9332452-7	1997	Chloroquine altered the pattern of the insulin-sized cell-associated HPLC assayed degradation products, further supporting two pathways of degradation; one a chloroquine-sensitive and one a chloroquine-insensitive pathway.	Chloroquine	190-201	insulin	Homo sapiens	39-46
9376759-2	1997	In the series with 14- and 21-day courses of chloroquine injections, inhibition of the thiol cathepsins B and L with simultaneous activation of the aspartic proteinase cathepsin D occurred.	Chloroquine	45-56	cathepsin D	Rattus norvegicus	168-179
9292530-8	1997	Antigen processing and presentation by CD38++ and CD38+ cells were abolished by treatment of the cells with chloroquine.	Chloroquine	108-119	CD38 molecule	Homo sapiens	39-43
9292530-8	1997	Antigen processing and presentation by CD38++ and CD38+ cells were abolished by treatment of the cells with chloroquine.	Chloroquine	108-119	CD38 molecule	Homo sapiens	50-54
9300184-5	1997	Secretion of beta-hexosaminidase activity doubled, whereas that of CD activity was unchanged, upon vacuolar alkalinization with ammonium chloride or chloroquine.	Chloroquine	149-160	O-GlcNAcase	Homo sapiens	13-32
9295226-0	1997	Amyloid precursor protein, A beta and amyloid-associated proteins involved in chloroquine retinopathy in rats--immunopathological studies.	Chloroquine	78-89	amyloid beta precursor protein	Rattus norvegicus	0-25
9295226-1	1997	To understand the retinal changes in Alzheimer disease (AD) patients, pathological and immunocytochemical studies were performed on retinal cells in the chloroquine-treated rats at 0, 4, 8, 12, 16, 20, and 24 weeks after the initial injection, using anti-amyloid precursor protein (APP), -amyloid beta protein (A beta), -apolipoprotein E (apoE), -ubiquitin, and -cathepsin D antibodies.	Chloroquine	153-164	amyloid beta precursor protein	Rattus norvegicus	250-280
9295226-1	1997	To understand the retinal changes in Alzheimer disease (AD) patients, pathological and immunocytochemical studies were performed on retinal cells in the chloroquine-treated rats at 0, 4, 8, 12, 16, 20, and 24 weeks after the initial injection, using anti-amyloid precursor protein (APP), -amyloid beta protein (A beta), -apolipoprotein E (apoE), -ubiquitin, and -cathepsin D antibodies.	Chloroquine	153-164	amyloid beta precursor protein	Rattus norvegicus	311-317
9295226-1	1997	To understand the retinal changes in Alzheimer disease (AD) patients, pathological and immunocytochemical studies were performed on retinal cells in the chloroquine-treated rats at 0, 4, 8, 12, 16, 20, and 24 weeks after the initial injection, using anti-amyloid precursor protein (APP), -amyloid beta protein (A beta), -apolipoprotein E (apoE), -ubiquitin, and -cathepsin D antibodies.	Chloroquine	153-164	apolipoprotein E	Rattus norvegicus	339-343
9295226-1	1997	To understand the retinal changes in Alzheimer disease (AD) patients, pathological and immunocytochemical studies were performed on retinal cells in the chloroquine-treated rats at 0, 4, 8, 12, 16, 20, and 24 weeks after the initial injection, using anti-amyloid precursor protein (APP), -amyloid beta protein (A beta), -apolipoprotein E (apoE), -ubiquitin, and -cathepsin D antibodies.	Chloroquine	153-164	cathepsin D	Rattus norvegicus	363-374
9295226-2	1997	Pathological alterations consistent with chloroquine retinopathy were recognized in the ganglion cells of the ganglion cell layer (GCL) and the inner plexiform layer (IPL) 4 weeks after initial chloroquine injection.	Chloroquine	41-52	germ cell-less 1, spermatogenesis associated	Rattus norvegicus	131-134
9274858-4	1997	The accumulation of intracellular Abeta was enhanced by chloroquine and blocked by cycloheximide and brefeldin A and pretreatment with trypsin, suggesting that the internalization of Abeta occurs by receptor-mediated endocytosis.	Chloroquine	56-67	amyloid beta precursor protein	Homo sapiens	34-39
9274858-4	1997	The accumulation of intracellular Abeta was enhanced by chloroquine and blocked by cycloheximide and brefeldin A and pretreatment with trypsin, suggesting that the internalization of Abeta occurs by receptor-mediated endocytosis.	Chloroquine	56-67	amyloid beta precursor protein	Homo sapiens	183-188
9277367-4	1997	Biochemical (such as antibody crosslinking of PGP or treatment of cells with chloroquine) and molecular (such as overexpression of Rab5) treatments were used to modulate the endocytic/ recycling traffic of PGP.	Chloroquine	77-88	ATP binding cassette subfamily B member 1	Homo sapiens	206-209
9278099-8	1997	Chloroquine (100 microM) inhibited the [3H]Ang II dissociation from cells, and monensin (25 microM) induced a 30% inhibition of [3H]Ang II binding (35 degrees, 3 hr), suggesting endosomal processing of the Ang II-receptor complex with receptor recycling to the cell surface.	Chloroquine	0-11	angiotensinogen	Rattus norvegicus	43-49
9220462-3	1997	The slow neurotensin-induced receptor down-regulation is thought to result from receptor degradation since it was reduced by the lysosomotropic drugs chloroquine and methylamine and because no change in neurotensin mRNA level could be measured after the neurotensin stimulation.	Chloroquine	150-161	neurotensin	Rattus norvegicus	9-20
9186501-4	1997	In fact, chloroquine enhances the signal-induced nuclear expression of NF-kappa B p50/p65 heterodimer by inhibiting the resynthesis of I kappa B alpha.	Chloroquine	9-20	nuclear factor of kappa light polypeptide gene enhancer in B cells 1, p105	Mus musculus	71-81
9186501-4	1997	In fact, chloroquine enhances the signal-induced nuclear expression of NF-kappa B p50/p65 heterodimer by inhibiting the resynthesis of I kappa B alpha.	Chloroquine	9-20	nuclear factor of kappa light polypeptide gene enhancer in B cells 1, p105	Mus musculus	82-85
9186501-4	1997	In fact, chloroquine enhances the signal-induced nuclear expression of NF-kappa B p50/p65 heterodimer by inhibiting the resynthesis of I kappa B alpha.	Chloroquine	9-20	v-rel reticuloendotheliosis viral oncogene homolog A (avian)	Mus musculus	86-89
9186501-4	1997	In fact, chloroquine enhances the signal-induced nuclear expression of NF-kappa B p50/p65 heterodimer by inhibiting the resynthesis of I kappa B alpha.	Chloroquine	9-20	nuclear factor of kappa light polypeptide gene enhancer in B cells inhibitor, alpha	Mus musculus	135-150
9201717-7	1997	In contrast to the behavior of previously studied type II Golgi proteins, overexpression of GPP130 led to a pronounced accumulation in endocytotic vesicles, and endogenous GPP130 reversibly redistributed to endocytotic vesicles after chloroquine treatment.	Chloroquine	234-245	golgi integral membrane protein 4	Homo sapiens	92-98
9201717-7	1997	In contrast to the behavior of previously studied type II Golgi proteins, overexpression of GPP130 led to a pronounced accumulation in endocytotic vesicles, and endogenous GPP130 reversibly redistributed to endocytotic vesicles after chloroquine treatment.	Chloroquine	234-245	golgi integral membrane protein 4	Homo sapiens	172-178
9201717-8	1997	Thus, localization of GPP130 to the early Golgi involves steps that are saturable and sensitive to lumenal pH, and GPP130 contains targeting information that specifies its return to the Golgi after chloroquine washout.	Chloroquine	198-209	golgi integral membrane protein 4	Homo sapiens	115-121
9144507-3	1997	Chloroquine was reported to inhibit production of TNF, although the underlying mechanism is poorly understood.	Chloroquine	0-11	tumor necrosis factor	Mus musculus	50-53
9185677-4	1997	Systemically administered CHL caused an astrocytic response and an increase in intracellular A beta immunoreactivity throughout the brain, but no plaque-like pathology.	Chloroquine	26-29	amyloid beta (A4) precursor protein	Mus musculus	93-99
9144507-6	1997	A pulse-chase experiment of pro-TNF produced in chloroquine-treated cells showed significant inhibition of processing of prohormone.	Chloroquine	48-59	tumor necrosis factor	Mus musculus	32-35
9144507-8	1997	Our results suggest that chloroquine inhibits production of TNF at the step of processing of membrane-bound pro-TNF to make soluble mature protein in a lysosome-independent manner.	Chloroquine	25-36	tumor necrosis factor	Mus musculus	60-63
9144507-8	1997	Our results suggest that chloroquine inhibits production of TNF at the step of processing of membrane-bound pro-TNF to make soluble mature protein in a lysosome-independent manner.	Chloroquine	25-36	tumor necrosis factor	Mus musculus	112-115
9013602-6	1997	In contrast, following basolateral internalization of the ligand, both chloroquine and leupeptin inhibited the intracellular degradation of 125I-TC II, which resulted in secretion of 60-65% of TC II-Cbl complex into the basolateral medium.	Chloroquine	71-82	transcobalamin 2	Homo sapiens	145-150
9209430-4	1997	This chloroquine-induced change suggests that the increase in intracellular pH and the upregulation of p21 with subsequent downregulation of cdc2 kinase are triggers for basophilic differentiation of this cell line.	Chloroquine	5-16	H3 histone pseudogene 16	Homo sapiens	103-106
9094156-7	1997	In the normal pancreas, CQ decreased the specific activity of lysosomal enzymes cathepsin B1, beta-hexosaminidase, beta-glucuronidase, and acid phosphatase.	Chloroquine	24-26	cathepsin B	Mus musculus	80-92
9094156-7	1997	In the normal pancreas, CQ decreased the specific activity of lysosomal enzymes cathepsin B1, beta-hexosaminidase, beta-glucuronidase, and acid phosphatase.	Chloroquine	24-26	O-GlcNAcase	Mus musculus	94-113
9094156-7	1997	In the normal pancreas, CQ decreased the specific activity of lysosomal enzymes cathepsin B1, beta-hexosaminidase, beta-glucuronidase, and acid phosphatase.	Chloroquine	24-26	glucuronidase, beta	Mus musculus	115-133
9518044-8	1997	In the presence of 100 microM chloroquine, the degradation of t-PA and r-PA was inhibited by 75% and 40%, respectively, indicating lysosomal degradation.	Chloroquine	30-41	plasminogen activator, tissue type	Homo sapiens	62-66
9029128-8	1997	Northern blot analysis revealed a rapidly increased expression of the bcl-x(s) gene without any change in the expression of the bcl-2 gene, indicating that HUVECs under chloroquine were undergoing apoptosis.	Chloroquine	169-180	BCL2 like 1	Homo sapiens	70-75
9029128-13	1997	Anti-IL-1alpha Ab or IL-1Ra only marginally reversed chloroquine-induced depression of proliferation for the low drug concentration, but not the massive cell death effect at and above 50 microM.	Chloroquine	53-64	interleukin 1 alpha	Homo sapiens	5-14
9029128-13	1997	Anti-IL-1alpha Ab or IL-1Ra only marginally reversed chloroquine-induced depression of proliferation for the low drug concentration, but not the massive cell death effect at and above 50 microM.	Chloroquine	53-64	interleukin 1 receptor antagonist	Homo sapiens	21-27
9029128-15	1997	The autocrine mechanism involving IL-1alpha accounts only for a minor fraction of the full antiendothelial effect of chloroquine, which is mainly dependent on apoptosis.	Chloroquine	117-128	interleukin 1 alpha	Homo sapiens	34-43
9281894-4	1997	It seems that the inhibitory effect of chloroquine is mediated through the production of epidermal growth factor (EGF).	Chloroquine	39-50	epidermal growth factor	Homo sapiens	89-112
9281894-4	1997	It seems that the inhibitory effect of chloroquine is mediated through the production of epidermal growth factor (EGF).	Chloroquine	39-50	epidermal growth factor	Homo sapiens	114-117
9158098-3	1997	In addition, chloroquine has been shown to have inhibitory action on TNF-alpha synthesis.	Chloroquine	13-24	tumor necrosis factor	Homo sapiens	69-78
9158098-5	1997	TNF-alpha and chloroquine varied in the same range on admission, but there was an inverse correlation between the two: the higher the chloroquine level, the lower the TNF-alpha level.	Chloroquine	14-25	tumor necrosis factor	Homo sapiens	167-176
9158098-5	1997	TNF-alpha and chloroquine varied in the same range on admission, but there was an inverse correlation between the two: the higher the chloroquine level, the lower the TNF-alpha level.	Chloroquine	134-145	tumor necrosis factor	Homo sapiens	0-9
9158098-8	1997	The above data suggest beneficial effects of chloroquine self-medication with respect to anti-TNF-alpha action.	Chloroquine	45-56	tumor necrosis factor	Homo sapiens	94-103
9113511-5	1997	Twenty-four hours after exposing NIH3T3.HER2 cells to the PL-rhuMAbHER2-pRSVLuc complexes and 100 microM chloroquine, luciferase expression was 180-fold higher than that obtained from a conjugate made with an isotype-matched antibody against an irrelevant target.	Chloroquine	105-116	erb-b2 receptor tyrosine kinase 2	Mus musculus	40-44
9013602-6	1997	In contrast, following basolateral internalization of the ligand, both chloroquine and leupeptin inhibited the intracellular degradation of 125I-TC II, which resulted in secretion of 60-65% of TC II-Cbl complex into the basolateral medium.	Chloroquine	71-82	transcobalamin 2	Homo sapiens	193-198
9085135-1	1997	Chloroquine has been shown to increase the cellular retention and nuclear incorporation of 125I-labeled monoclonal antibody (MAb) 425, a murine anti-epidermal growth factor receptor monoclonal antibody, in human high-grade glioma cells in vitro.	Chloroquine	0-11	epidermal growth factor receptor	Homo sapiens	149-181
9002011-0	1997	Chloroquine and hydroxychloroquine equally affect tumor necrosis factor-alpha, interleukin 6, and interferon-gamma production by peripheral blood mononuclear cells.	Chloroquine	0-11	tumor necrosis factor	Homo sapiens	50-77
9002011-7	1997	RESULTS: We observed that chloroquine and hydroxychloroquine equally inhibit PHA induced TNF-alpha and IFN-gamma production, and LPS induced TNF-alpha and IL-6 production, while PHA induced IL-6 production was not affected.	Chloroquine	26-37	tumor necrosis factor	Homo sapiens	89-98
9002011-7	1997	RESULTS: We observed that chloroquine and hydroxychloroquine equally inhibit PHA induced TNF-alpha and IFN-gamma production, and LPS induced TNF-alpha and IL-6 production, while PHA induced IL-6 production was not affected.	Chloroquine	26-37	interferon gamma	Homo sapiens	103-112
9002011-0	1997	Chloroquine and hydroxychloroquine equally affect tumor necrosis factor-alpha, interleukin 6, and interferon-gamma production by peripheral blood mononuclear cells.	Chloroquine	0-11	interleukin 6	Homo sapiens	79-92
9002011-7	1997	RESULTS: We observed that chloroquine and hydroxychloroquine equally inhibit PHA induced TNF-alpha and IFN-gamma production, and LPS induced TNF-alpha and IL-6 production, while PHA induced IL-6 production was not affected.	Chloroquine	26-37	interleukin 6	Homo sapiens	190-194
9002011-0	1997	Chloroquine and hydroxychloroquine equally affect tumor necrosis factor-alpha, interleukin 6, and interferon-gamma production by peripheral blood mononuclear cells.	Chloroquine	0-11	interferon gamma	Homo sapiens	98-114
9156650-2	1997	In addition, we have shown that both chloroquine and hydroxychloroquine can inhibit T cell responses in vitro to minor and major histocompatibility (MHC) antigens.	Chloroquine	37-48	major histocompatibility complex, class I, C	Homo sapiens	149-152
9051815-1	1996	Chloroquine (CHQ)-sensitive cellular compartments, identified as endosomes-lysosomes (ELs), have been implicated in the proteolysis of amyloid beta precursor protein (A beta PP) in Alzheimer"s disease.	Chloroquine	0-11	amyloid beta precursor protein	Homo sapiens	135-176
9051815-1	1996	Chloroquine (CHQ)-sensitive cellular compartments, identified as endosomes-lysosomes (ELs), have been implicated in the proteolysis of amyloid beta precursor protein (A beta PP) in Alzheimer"s disease.	Chloroquine	13-16	amyloid beta precursor protein	Homo sapiens	135-176
8937469-3	1996	By contrast, chloroquine competed poorly for the binding site on P-glycoprotein.	Chloroquine	13-24	ATP binding cassette subfamily B member 1	Homo sapiens	65-79
8967969-2	1996	Dose-dependent inhibition of ICAM-1 expression was obtained (IC50 = 500 nM) through treatment of cells with odn(ICAM-1) complexed with pLK carrying fucose residues in the presence of 100 microM chloroquine.	Chloroquine	194-205	intercellular adhesion molecule 1	Homo sapiens	29-35
8967969-2	1996	Dose-dependent inhibition of ICAM-1 expression was obtained (IC50 = 500 nM) through treatment of cells with odn(ICAM-1) complexed with pLK carrying fucose residues in the presence of 100 microM chloroquine.	Chloroquine	194-205	intercellular adhesion molecule 1	Homo sapiens	112-118
8967969-2	1996	Dose-dependent inhibition of ICAM-1 expression was obtained (IC50 = 500 nM) through treatment of cells with odn(ICAM-1) complexed with pLK carrying fucose residues in the presence of 100 microM chloroquine.	Chloroquine	194-205	polo like kinase 1	Homo sapiens	135-138
8871623-8	1996	In contrast, AP-1 generation was inhibited by wortmannin and was also variably sensitive to chloroquine.	Chloroquine	92-103	JunB proto-oncogene, AP-1 transcription factor subunit	Homo sapiens	13-17
8916270-1	1996	The mechanism(s) of degradation of the potent vasoconstrictor endothelin-1 (ET-1) by rat vascular smooth muscle A-10 cells, which possess the ETA receptor subtype, was investigated by incubating [125I]ET-1 (0.1 nM) with cells for 0-4 h at 37 degrees C in the presence and absence of lysosomal enzyme inhibitors, NH4Cl and chloroquine, and a neutral endopeptidase inhibitor, phosphoramidon.	Chloroquine	322-333	endothelin 1	Rattus norvegicus	62-74
8916270-1	1996	The mechanism(s) of degradation of the potent vasoconstrictor endothelin-1 (ET-1) by rat vascular smooth muscle A-10 cells, which possess the ETA receptor subtype, was investigated by incubating [125I]ET-1 (0.1 nM) with cells for 0-4 h at 37 degrees C in the presence and absence of lysosomal enzyme inhibitors, NH4Cl and chloroquine, and a neutral endopeptidase inhibitor, phosphoramidon.	Chloroquine	322-333	endothelin 1	Rattus norvegicus	76-80
8916270-5	1996	In the presence of 5 microM chloroquine there was no [125I]Tyr peak in the medium, indicating that internalization and putative lysosomal degradation of ET-1 were blocked.	Chloroquine	28-39	endothelin 1	Rattus norvegicus	153-157
8944708-4	1996	Bafilomycin A, monensin, and chloroquine, which prevent endosomal acidification, also blocked LPS-stimulated release of TNF-alpha by &gt; 90%.	Chloroquine	29-40	tumor necrosis factor	Rattus norvegicus	120-129
8824497-9	1996	The decrease in Cx43-P2 and the disappearance of cytoplasmic Cx43-positive structures were prevented by colchicine and chloroquine, which suggests that Cx43-P2-containing plaques were internalized and degraded in lysosomes.	Chloroquine	119-130	gap junction protein, alpha 1	Rattus norvegicus	16-20
8896943-11	1996	Limited in vitro studies and preliminary data from clinical experiments and observations point to CYP3A and CYP2D6 as the 2 major isoforms affected by or involved in chloroquine metabolism.	Chloroquine	166-177	cytochrome P450 family 3 subfamily A member 4	Homo sapiens	98-103
8896943-11	1996	Limited in vitro studies and preliminary data from clinical experiments and observations point to CYP3A and CYP2D6 as the 2 major isoforms affected by or involved in chloroquine metabolism.	Chloroquine	166-177	cytochrome P450 family 2 subfamily D member 6	Homo sapiens	108-114
8824497-9	1996	The decrease in Cx43-P2 and the disappearance of cytoplasmic Cx43-positive structures were prevented by colchicine and chloroquine, which suggests that Cx43-P2-containing plaques were internalized and degraded in lysosomes.	Chloroquine	119-130	gap junction protein, alpha 1	Rattus norvegicus	61-65
8824497-9	1996	The decrease in Cx43-P2 and the disappearance of cytoplasmic Cx43-positive structures were prevented by colchicine and chloroquine, which suggests that Cx43-P2-containing plaques were internalized and degraded in lysosomes.	Chloroquine	119-130	gap junction protein, alpha 1	Rattus norvegicus	61-65
8621095-4	1996	Purified, recombinant Mtx2 was toxic to Cq larvae.	Chloroquine	40-42	metaxin 2	Homo sapiens	22-26
8765464-0	1996	Arginine vasopressin mediates the chloroquine induced increase in renal sodium excretion.	Chloroquine	34-45	arginine vasopressin	Rattus norvegicus	9-20
8765464-1	1996	We postulated that chloroquine increases plasma arginine vasopressin (AVP) concentrations thus altering renal Na+ clearance.	Chloroquine	19-30	arginine vasopressin	Rattus norvegicus	57-68
8650203-4	1996	Expression of mouse Mdr1 in the mutant confers cross-resistance to daunomycin, quinidine, chloroquine, rhodamine 6G, and puromycin.	Chloroquine	90-101	ATP-binding cassette, sub-family B (MDR/TAP), member 1B	Mus musculus	20-24
8641177-4	1996	On the other hand, ammonium chloride and chloroquine, weak bases that neutralize the pH of acidic cell compartments, blocked IGFBP-3 potentiation of IGF-I-stimulated [3H]AIB uptake.	Chloroquine	41-52	insulin like growth factor binding protein 3	Bos taurus	125-132
8641177-4	1996	On the other hand, ammonium chloride and chloroquine, weak bases that neutralize the pH of acidic cell compartments, blocked IGFBP-3 potentiation of IGF-I-stimulated [3H]AIB uptake.	Chloroquine	41-52	IGFI	Bos taurus	149-154
8641177-7	1996	Competitive [125I]IGF-I binding and affinity cross-linking experiments suggested structure/function changes in cell-bound IGFBP-3 that were altered in the presence of chloroquine and bafilomycin.	Chloroquine	167-178	IGFI	Bos taurus	18-23
8641177-7	1996	Competitive [125I]IGF-I binding and affinity cross-linking experiments suggested structure/function changes in cell-bound IGFBP-3 that were altered in the presence of chloroquine and bafilomycin.	Chloroquine	167-178	insulin like growth factor binding protein 3	Bos taurus	122-129
20948025-1	1996	Two female patients suffering from rheumatoid arthritis were put on chloroquine 250 mg bid.	Chloroquine	68-79	BH3 interacting domain death agonist	Homo sapiens	87-90
8843733-7	1996	N-ethylmaleimide and bacitracin, two inhibitors of insulin-degrading enzyme (IDE), decreased the formation of chloroquine-dependent cellular peptides.	Chloroquine	110-121	insulin degrading enzyme	Rattus norvegicus	51-75
8843733-7	1996	N-ethylmaleimide and bacitracin, two inhibitors of insulin-degrading enzyme (IDE), decreased the formation of chloroquine-dependent cellular peptides.	Chloroquine	110-121	insulin degrading enzyme	Rattus norvegicus	77-80
8663244-3	1996	Iodinated recombinant mouse TSP2 bound to NIH 3T3 cells and was internalized and degraded through a chloroquine-inhibitable pathway.	Chloroquine	100-111	tumor suppressor region 2	Mus musculus	28-32
8858461-6	1996	The interferon-gamma induced production of reactive nitrogen intermediates (RNI) was slightly elevated in mice with cerebral malaria, but markedly elevated in artemether or chloroquine treated mice when compared with naive mice.	Chloroquine	173-184	interferon gamma	Mus musculus	4-20
8813406-3	1996	With preincubation of PC12 cells with the drugs indomethacin, dexamethasone and chloroquine, reduction in viability was limited to 51%, 48% and 44%, respectively, compared to 32% with A beta alone.	Chloroquine	80-91	amyloid beta precursor protein	Rattus norvegicus	184-190
8698396-7	1996	Chloroquine and leupeptin inhibited presentation of intact p66, but not of an immunodominant peptide, by FLC or CLC, thus indicating that both cells utilize antigen-processing mechanisms that are based on intracellular acidification and protease activity.	Chloroquine	0-11	DNA polymerase delta 3, accessory subunit	Homo sapiens	59-62
8730982-1	1996	The effects of chloroquine (CHQ) on debrisoquine hydroxylase (CYP2D6) and S-mephenytoin hydroxylase (CYP2C19) were assessed in 11 black Zimbabwean and 12 white Swedish healthy volunteers.	Chloroquine	15-26	cytochrome P450 family 2 subfamily D member 6	Homo sapiens	62-68
8730982-1	1996	The effects of chloroquine (CHQ) on debrisoquine hydroxylase (CYP2D6) and S-mephenytoin hydroxylase (CYP2C19) were assessed in 11 black Zimbabwean and 12 white Swedish healthy volunteers.	Chloroquine	28-31	cytochrome P450 family 2 subfamily D member 6	Homo sapiens	62-68
8772564-3	1996	We also studied the effects of estradiol, progesterone, and chloroquine on regulation of the angiotensin AT1 receptor in 48-h cell culture.	Chloroquine	60-71	angiotensin II receptor type 1	Homo sapiens	105-108
8772564-8	1996	In the freshly isolated trophoblast cells initially treated with unlabeled angiotensin II (200 nmol/L) for 30 min, chloroquine was shown to decrease angiotensin AT1 receptor recycling by 73%, whereas estradiol and progesterone had no effect.	Chloroquine	115-126	angiotensinogen	Homo sapiens	75-89
8772564-8	1996	In the freshly isolated trophoblast cells initially treated with unlabeled angiotensin II (200 nmol/L) for 30 min, chloroquine was shown to decrease angiotensin AT1 receptor recycling by 73%, whereas estradiol and progesterone had no effect.	Chloroquine	115-126	angiotensin II receptor type 1	Homo sapiens	161-164
8616629-4	1995	In this study, we demonstrate that amyloid-associated proteins, alpha 1-antichymotrypsin, apolipoprotein E, SP-40,40 and ubiquitin co-localize with A beta in vacuolated muscle fibers in chloroquine-induced myopathy.	Chloroquine	186-197	apolipoprotein E	Rattus norvegicus	90-106
8537661-5	1996	Further, drugs such as pentoxifylline, chloroquine, and the antioxidant apocynin similarly inhibited TNF-alpha release by PG- as well as LPS-stimulated cells.	Chloroquine	39-50	tumor necrosis factor	Homo sapiens	101-110
8787835-1	1995	Previous immunohistochemical studies from this laboratory demonstrated that monoclonal antibodies raised against various regions of amyloid precursor protein (APP) (i.e., N-terminus, amyloid beta protein (A beta), and C-terminus) strongly labeled vacuoles in chloroquine-induced myopathy-affected muscle in rats.	Chloroquine	259-270	amyloid beta precursor protein	Rattus norvegicus	132-157
8787835-4	1995	These results demonstrate that vacuoles in chloroquine-induced myopathy-affected muscle contain cleaved A beta, and that distribution of the two major A beta species is similar to what is observed in A beta deposition in Alzheimer"s disease (AD)-affected brain.	Chloroquine	43-54	amyloid beta precursor protein	Rattus norvegicus	104-110
8787835-5	1995	This provides further evidence that chloroquine-induced myopathy in rats provides a suitable model to understand APP processing into A beta, and the role of APP in terms of the pathogenesis of AD.	Chloroquine	36-47	amyloid beta precursor protein	Rattus norvegicus	133-139
8632700-4	1996	LDL receptor-mediated degradation was calcium dependent, and sensitive to pronase and chloroquine treatments.	Chloroquine	86-97	low density lipoprotein receptor	Homo sapiens	0-12
8632700-7	1996	Acetyl-LDL receptor-mediated degradation was calcium independent, inhibited by chloroquine, and was sensitive to pronase and fucoidin treatments.	Chloroquine	79-90	scavenger receptor class F member 1	Homo sapiens	0-19
8616629-4	1995	In this study, we demonstrate that amyloid-associated proteins, alpha 1-antichymotrypsin, apolipoprotein E, SP-40,40 and ubiquitin co-localize with A beta in vacuolated muscle fibers in chloroquine-induced myopathy.	Chloroquine	186-197	clusterin	Rattus norvegicus	108-113
8616629-6	1995	Chloroquine-induced myopathy in rats provides a suitable model not only to obtain insight into the basic mechanisms underlying RV formation in muscle, but also to understand amyloid precursor protein processing into A beta, and the role of amyloid-associated proteins in terms of the pathogenesis of AD.	Chloroquine	0-11	amyloid beta precursor protein	Rattus norvegicus	174-199
7559618-4	1995	Ammonium chloride or chloroquine inhibited partially the degradation of apoB100 and apoB48, indicating some degradation in lysosomes, or in an acidic compartment such as trans-Golgi or endosomes.	Chloroquine	21-32	apolipoprotein B	Rattus norvegicus	72-79
7487933-0	1995	Chloroquine augments the binding of insulin to its receptor.	Chloroquine	0-11	insulin	Homo sapiens	36-43
7487933-1	1995	The effect of chloroquine on the interaction of insulin with its receptor has been investigated under both equilibrium and non-equilibrium conditions.	Chloroquine	14-25	insulin	Homo sapiens	48-55
7487933-2	1995	Chloroquine was found to augment insulin binding in a pH-dependent manner between pH 6.0 and pH 8.5, with the maximum occurring at approximately pH 7.0.	Chloroquine	0-11	insulin	Homo sapiens	33-40
7487933-7	1995	The kinetics of association of insulin with the plasma-membrane receptor indicated that, although the net rate of association increased in the presence of chloroquine, this was due to a reduction in the dissociation rate rather than an increase in the association rate.	Chloroquine	155-166	insulin	Homo sapiens	31-38
7487933-10	1995	Curve fitting suggested that the decrease in dissociation rate in the presence of chloroquine was not due to a decrease in either of the two dissociation rate constants, but rather to an increase in the amount of insulin dissociating by the slow component.	Chloroquine	82-93	insulin	Homo sapiens	213-220
7487933-12	1995	Thus chloroquine appears to have the opposite effect to excess insulin, and evidence was found for the induction of positive co-operativity in the insulin-receptor interaction at high chloroquine concentrations.	Chloroquine	184-195	insulin receptor	Homo sapiens	147-163
7487933-13	1995	Evidence was also found for the presence of low-affinity chloroquine binding sites with binding parameters similar to the concentration dependence of the chloroquine-induced augmentation of insulin binding.	Chloroquine	57-68	insulin	Homo sapiens	190-197
7487933-13	1995	Evidence was also found for the presence of low-affinity chloroquine binding sites with binding parameters similar to the concentration dependence of the chloroquine-induced augmentation of insulin binding.	Chloroquine	154-165	insulin	Homo sapiens	190-197
7559618-4	1995	Ammonium chloride or chloroquine inhibited partially the degradation of apoB100 and apoB48, indicating some degradation in lysosomes, or in an acidic compartment such as trans-Golgi or endosomes.	Chloroquine	21-32	apolipoprotein B	Rattus norvegicus	84-90
7657617-9	1995	Incubation of islets with chloroquine or zinc enhances and diminishes accessibility of insulin disulfides, respectively.	Chloroquine	26-37	insulin	Homo sapiens	87-94
7554381-0	1995	Chloroquine inhibits T cell proliferation by interfering with IL-2 production and responsiveness.	Chloroquine	0-11	interleukin 2	Homo sapiens	62-66
7673175-14	1995	State 1 ASGP-Rs, purified from chloroquine- or monensin-treated hepatocytes, showed significantly less sensitivity to NH2OH treatment (both in kinetics and dose dependence).	Chloroquine	31-42	mucin 4, cell surface associated	Rattus norvegicus	8-12
7556439-6	1995	We have also determined that reagents disturbing pH of distinct endocytic compartments (chloroquine and bafilomycin A1, but not ammonium chloride) arrest recycling of the EBP and, at the same time, strongly inhibit deposition of insoluble elastin in cultures of sheep Ao SMC and in organ cultures of chicken aorta.	Chloroquine	88-99	3-beta-hydroxysteroid-Delta(8),Delta(7)-isomerase	Ovis aries	171-174
7556439-6	1995	We have also determined that reagents disturbing pH of distinct endocytic compartments (chloroquine and bafilomycin A1, but not ammonium chloride) arrest recycling of the EBP and, at the same time, strongly inhibit deposition of insoluble elastin in cultures of sheep Ao SMC and in organ cultures of chicken aorta.	Chloroquine	88-99	elastin	Ovis aries	239-246
8575649-10	1995	In frog hepatocytes the specific binding of 125I-insulin was increased twofold in the presence of the lysosomal inhibitor chloroquine.	Chloroquine	122-133	insulin	Canis lupus familiaris	49-56
8576639-7	1995	Lysosomotropic agents, ammonium chloride and chloroquine, on the other hand, inhibit apoE degradation by over 70 and 80%, respectively, while total cell protein degradation remains unaffected.	Chloroquine	45-56	apolipoprotein E	Mus musculus	85-89
8576639-15	1995	The block in apoE secretion in the presence of high concentrations of chloroquine leads to undiminished or higher concentrations of immunoreactive apoE in the endosomal/lysosomal compartment, suggesting that apoE is targeted for lysosomal degradation directly, without prior secretion or surface association.	Chloroquine	70-81	apolipoprotein E	Mus musculus	13-17
8576639-15	1995	The block in apoE secretion in the presence of high concentrations of chloroquine leads to undiminished or higher concentrations of immunoreactive apoE in the endosomal/lysosomal compartment, suggesting that apoE is targeted for lysosomal degradation directly, without prior secretion or surface association.	Chloroquine	70-81	apolipoprotein E	Mus musculus	147-151
8576639-15	1995	The block in apoE secretion in the presence of high concentrations of chloroquine leads to undiminished or higher concentrations of immunoreactive apoE in the endosomal/lysosomal compartment, suggesting that apoE is targeted for lysosomal degradation directly, without prior secretion or surface association.	Chloroquine	70-81	apolipoprotein E	Mus musculus	147-151
7474657-4	1995	Chloroquine (50 to 100 microns) and ammonium chloride (NH4Cl, 30mM), two lysosomotropic amines known to stimulate the secretion of lysosomal enzymes in fibroblasts and macrophages, also stimulated secreted NAG in PKSV-PCT cells.	Chloroquine	0-11	O-GlcNAcase	Mus musculus	206-209
7558124-5	1995	The majority of subjects (45 of 52) exhibited chloroquine-sensitive, CD4-dependent cytokine production in allergen-stimulated, short-term primary culture.	Chloroquine	46-57	CD4 molecule	Homo sapiens	69-72
7662701-7	1995	Degradation of t-PA/PAI-1 complexes is also inhibited by chloroquine and by pepstatin A, suggesting that a lysosomal aspartyl protease is likely involved.	Chloroquine	57-68	plasminogen activator, tissue type	Homo sapiens	15-19
7662701-7	1995	Degradation of t-PA/PAI-1 complexes is also inhibited by chloroquine and by pepstatin A, suggesting that a lysosomal aspartyl protease is likely involved.	Chloroquine	57-68	serpin family E member 1	Homo sapiens	20-25
7790772-5	1995	Complex molecules such as trinitrophenyl conjugated to ovalbumin (TNP-OVA) were internalized and modification required a chloroquine-sensitive proteolysis step and a cycloheximide-sensitive protein synthesis step.	Chloroquine	121-132	serine (or cysteine) peptidase inhibitor, clade B, member 1, pseudogene	Mus musculus	55-64
7631147-11	1995	The ability of T2Kb cells to present Sendai virus antigen in a TAP independent BFA resistant fashion was only partially blocked by lysosomal inhibitors such as methylamine, ammonium chloride and chloroquine.	Chloroquine	195-206	nuclear RNA export factor 1	Homo sapiens	63-66
7743993-5	1995	By transposon-mediated deletion mutagenesis we generated nematode strains with deleted P-glycoprotein genes and found that the pgp-3 deletion mutant, but not the pgp-1 mutant, is sensitive to both colchicine and chloroquine.	Chloroquine	212-223	Multidrug resistance protein pgp-3	Caenorhabditis elegans	127-132
7695477-0	1995	[Binding of racemic chloroquine and its derivatives to human serum albumin].	Chloroquine	20-31	albumin	Homo sapiens	67-74
7732030-6	1995	When expressed in mammalian cells, dSR-CI exhibited high affinity and saturable binding of 125I-labeled acetylated low density lipoprotein and mediated its chloroquine-dependent, presumably lysosomal, degradation.	Chloroquine	156-167	Scavenger receptor class C, type I	Drosophila melanogaster	35-41
7697908-6	1995	Cysteine and serine protease-dependent antigen presentation of PG was blocked at 4 degrees C, 18 degrees C and by chloroquine treatment, indicating that presentation required active uptake and processing in an acidic compartment, probably in lysosomes.	Chloroquine	114-125	complement component 1, s subcomponent 1	Mus musculus	13-28
7624839-1	1995	Chloroquine inhibited arachidonic acid liberation from membrane phospholipids of thrombin- and A23187- stimulated platelets.	Chloroquine	0-11	coagulation factor II, thrombin	Homo sapiens	81-89
7713312-4	1995	Encapsulated insulin at 10(-7) mol/l evoked receptor desensitization although it did not induce receptor down-regulation and did not alter receptor recycling for up to 6 h. Chloroquine decreased the action of native insulin on glycogen synthesis, but did not affect the dose-response characteristics of encapsulated insulin.	Chloroquine	173-184	insulin	Cricetulus griseus	13-20
7713312-4	1995	Encapsulated insulin at 10(-7) mol/l evoked receptor desensitization although it did not induce receptor down-regulation and did not alter receptor recycling for up to 6 h. Chloroquine decreased the action of native insulin on glycogen synthesis, but did not affect the dose-response characteristics of encapsulated insulin.	Chloroquine	173-184	insulin	Cricetulus griseus	216-223
7713312-4	1995	Encapsulated insulin at 10(-7) mol/l evoked receptor desensitization although it did not induce receptor down-regulation and did not alter receptor recycling for up to 6 h. Chloroquine decreased the action of native insulin on glycogen synthesis, but did not affect the dose-response characteristics of encapsulated insulin.	Chloroquine	173-184	insulin	Cricetulus griseus	216-223
7624839-3	1995	The linear correlation between the inhibition of arachidonic acid liberation and malondialdehyde formation indicated that chloroquine inhibited activated phospholipase A2 in thrombin-stimulated platelets, similarly as it does in different cells and tissues.	Chloroquine	122-133	phospholipase A2 group IB	Homo sapiens	154-170
7624839-3	1995	The linear correlation between the inhibition of arachidonic acid liberation and malondialdehyde formation indicated that chloroquine inhibited activated phospholipase A2 in thrombin-stimulated platelets, similarly as it does in different cells and tissues.	Chloroquine	122-133	coagulation factor II, thrombin	Homo sapiens	174-182
7773613-1	1995	Conjugates consisting of biotinylated transferrin and biotinylated poly-L-lysine attached to streptavidin have been prepared and found to transfer luciferase plasmid DNA very efficiently to HeLa cells in the presence of chloroquine.	Chloroquine	220-231	transferrin	Homo sapiens	38-49
9251753-0	1995	Opposing effects of quinacrine and chloroquine on the development of TA3 transplanted tumors in mice.	Chloroquine	35-46	RIKEN cDNA 2700049A03 gene	Mus musculus	69-72
7962117-6	1994	Furthermore, the ability of chloroquine to reduce the metabolism of insulin indicates a significant portion of the peptide is processed through a lysosomal pathway.	Chloroquine	28-39	insulin	Bos taurus	68-75
7715800-4	1994	In this study, we demonstrate, for the first time, immunohistochemical evidence that A beta and cathepsin D, a lysosomal enzyme, accumulate in vacuolated rat soleus muscle due to chloroquine-induced myopathy.	Chloroquine	179-190	amyloid beta precursor protein	Rattus norvegicus	85-91
7715800-4	1994	In this study, we demonstrate, for the first time, immunohistochemical evidence that A beta and cathepsin D, a lysosomal enzyme, accumulate in vacuolated rat soleus muscle due to chloroquine-induced myopathy.	Chloroquine	179-190	cathepsin D	Rattus norvegicus	96-107
7925845-2	1994	Chloroquine administration resulted in the appearance of a carboxyl-terminal fragment of the beta-amyloid precursor protein (APP); the 27-kDa antigen was detectable after 24 h, increased rapidly for 6-10 days, and was eliminated upon drug washout.	Chloroquine	0-11	amyloid beta precursor protein	Homo sapiens	93-123
7929600-10	1994	Internalized 24-kD bFGF is first processed to the 18-kD form via a chloroquine-insensitive pathway and then to smaller fragments into the lysosomal compartment.	Chloroquine	67-78	fibroblast growth factor 2	Homo sapiens	19-23
7816040-5	1994	Gel electrophoresis in the presence of chloroquine shows that GAL11 affects the chromatin structure of a circular plasmid.	Chloroquine	39-50	Gal11p	Saccharomyces cerevisiae S288C	62-67
7700578-0	1994	Apolipoprotein E uptake and degradation via chloroquine-sensitive pathway in cultivated monkey cells overexpressing low density lipoprotein receptor.	Chloroquine	44-55	apolipoprotein E	Homo sapiens	0-16
7700578-0	1994	Apolipoprotein E uptake and degradation via chloroquine-sensitive pathway in cultivated monkey cells overexpressing low density lipoprotein receptor.	Chloroquine	44-55	low density lipoprotein receptor	Homo sapiens	116-148
7700578-4	1994	Chase and chloroquine experiments strongly suggest that internalized ApoE travels through the endosomal-lysosomal pathway after dissociation from the receptor in early endosome.	Chloroquine	10-21	apolipoprotein E	Homo sapiens	69-73
8091644-7	1994	IPC were also tested for sensitivity to the lysosomotropic drug chloroquine, which diminishes IFN-alpha produced in response to HSV but not Sendai virus.	Chloroquine	64-75	interferon alpha 1	Homo sapiens	94-103
8091644-8	1994	With the exception of Sendai virus, chloroquine treatment abrogated the majority of IFN-alpha produced and IPC against each of the viruses.	Chloroquine	36-47	interferon alpha 1	Homo sapiens	84-93
8027580-6	1994	The ability of A20 to present trinitrophenol was inhibited by chloroquine.	Chloroquine	62-73	tumor necrosis factor, alpha-induced protein 3	Mus musculus	15-18
8063758-10	1994	Pretreatment of cells with lysosomotropic agents (chloroquine, ammonium chloride, and bacitracin) decreased hormone degradation and increased nuclear translocation of GH.	Chloroquine	50-61	gonadotropin releasing hormone receptor	Rattus norvegicus	167-169
8027580-8	1994	Paraformaldehyde fixation and chloroquine treatment had similar effects on the ability of A20 cells to present ovalbumin to ovalbumin-specific hybridomas as they had on the ability of trinitrophenol modified A20 cells to present trinitrophenol to the trinitrophenol specific hybridomas.	Chloroquine	30-41	serine (or cysteine) peptidase inhibitor, clade B, member 1, pseudogene	Mus musculus	124-133
8035515-6	1994	This Nef-induced acceleration of CD4 turnover was inhibited by lysosomotropic agents NH4Cl and chloroquine as well as by the protease inhibitor leupeptin.	Chloroquine	95-106	S100 calcium binding protein B	Homo sapiens	5-8
8035515-6	1994	This Nef-induced acceleration of CD4 turnover was inhibited by lysosomotropic agents NH4Cl and chloroquine as well as by the protease inhibitor leupeptin.	Chloroquine	95-106	CD4 molecule	Homo sapiens	33-36
7516869-5	1994	Chloroquine, an inhibitor of lysosomal enzymes involved in internalization of proteins and reduction of temperature, inhibited IGFBP-3 reduction in Sertoli cell medium.	Chloroquine	0-11	insulin-like growth factor binding protein 3	Rattus norvegicus	127-134
8026512-5	1994	Class I-restricted presentation of both epitopes processed from these hsp73-associated protein antigens was sensitive to NH4Cl and chloroquine.	Chloroquine	131-142	heat shock protein 8	Mus musculus	70-75
8027580-8	1994	Paraformaldehyde fixation and chloroquine treatment had similar effects on the ability of A20 cells to present ovalbumin to ovalbumin-specific hybridomas as they had on the ability of trinitrophenol modified A20 cells to present trinitrophenol to the trinitrophenol specific hybridomas.	Chloroquine	30-41	tumor necrosis factor, alpha-induced protein 3	Mus musculus	90-93
8027580-8	1994	Paraformaldehyde fixation and chloroquine treatment had similar effects on the ability of A20 cells to present ovalbumin to ovalbumin-specific hybridomas as they had on the ability of trinitrophenol modified A20 cells to present trinitrophenol to the trinitrophenol specific hybridomas.	Chloroquine	30-41	serine (or cysteine) peptidase inhibitor, clade B, member 1, pseudogene	Mus musculus	111-120
8085250-4	1994	For thrombin-stimulated aggregation the effect of chloroquine was partially decreased by corresponding isomolar calcium; platelet aggregation induced by ADP was not changed in the presence of extracellular Ca2+ ions.	Chloroquine	50-61	coagulation factor II	Rattus norvegicus	4-12
8085250-5	1994	Addition of chloroquine during aggregation resulted in disaggregation of ADP-stimulated platelets and inhibition of thrombin- and A23187-induced aggregation.	Chloroquine	12-23	coagulation factor II	Rattus norvegicus	116-124
8194522-3	1994	In this paper we show that when cells are treated with agents such as chloroquine which neutralize acidic organelles, the movement of TGN38 along the endocytic pathway is blocked.	Chloroquine	70-81	trans-golgi network protein 2	Homo sapiens	134-139
8194522-5	1994	We show that the cytoplasmic tail of furin is sufficient to confer a chloroquine-sensitive TGN localization on a heterologous protein.	Chloroquine	69-80	furin, paired basic amino acid cleaving enzyme	Homo sapiens	37-42
8005535-9	1994	In the presence of chloroquine, lysosomal protease inhibitor, the release of internalized 125I-r-EC-SOD C decreased to 59% compared with the control culture.	Chloroquine	19-30	superoxide dismutase 3	Bos taurus	97-103
7511608-6	1994	The degradation of an intracellularly retained human growth hormone (hGH)-DAF fusion protein containing a nonfunctional GPI signal shows some features of ER degradation, i.e. the degradation is insensitive to leupeptin, chloroquine, and ammonium chloride, and is inhibited at 16 degrees C or after ATP depletion.	Chloroquine	220-231	CD55 molecule (Cromer blood group)	Homo sapiens	74-77
7905875-6	1994	Treatment with the lysosomotropic agents chloroquine and primaquine prevents the degradation of CD4 in Nef-expressing CEM-SS cells, indicating that the degradation of CD4 likely occurs in an acidic compartment.	Chloroquine	41-52	S100 calcium binding protein B	Homo sapiens	103-106
8163646-4	1994	Chloroquine, which prevents release of iron from transferrin by raising endocytic and lysosomal pH, induced human Mphi to kill Hc.	Chloroquine	0-11	transferrin	Homo sapiens	49-60
7905875-6	1994	Treatment with the lysosomotropic agents chloroquine and primaquine prevents the degradation of CD4 in Nef-expressing CEM-SS cells, indicating that the degradation of CD4 likely occurs in an acidic compartment.	Chloroquine	41-52	CD4 molecule	Homo sapiens	167-170
7905875-6	1994	Treatment with the lysosomotropic agents chloroquine and primaquine prevents the degradation of CD4 in Nef-expressing CEM-SS cells, indicating that the degradation of CD4 likely occurs in an acidic compartment.	Chloroquine	41-52	CD4 molecule	Homo sapiens	96-99
8269998-5	1994	Addition of chloroquine, an inhibitor of lysosomal degradation, demonstrated that the relatively electron-lucent and electron-dense structures represent subsequent stages of the lysosomal pathway of Ac-LDL, which was also verified by detection of the lysosomal enzyme cathepsin D.	Chloroquine	12-23	cathepsin D	Rattus norvegicus	268-279
7506076-9	1994	However, in the presence of chloroquine, which blocks lysosomal degradation, this ligand-induced c-kit degradation at 37 degrees C was only suppressed in part.	Chloroquine	28-39	KIT proto-oncogene, receptor tyrosine kinase	Homo sapiens	97-102
7875186-0	1994	Stereoselective inhibition by chloroquine of histamine N-methyltransferase in the human liver and brain.	Chloroquine	30-41	histamine N-methyltransferase	Homo sapiens	45-74
7875186-1	1994	This study was designed to determine whether both enantiomers of chloroquine inhibit histamine N-methyltransferase.	Chloroquine	65-76	histamine N-methyltransferase	Homo sapiens	85-114
7875186-4	1994	If the adverse effects of chloroquine are due to the inhibition of histamine N-methyltransferase, therapy with the l-enantiomer might have lower toxicity.	Chloroquine	26-37	histamine N-methyltransferase	Homo sapiens	67-96
7875186-5	1994	The residual activity of histamine N-methyltransferase should reflect both the degree of inhibition by chloroquine and the level of enzyme expression.	Chloroquine	103-114	histamine N-methyltransferase	Homo sapiens	25-54
8257419-4	1993	Under conditions chosen to optimize Clq uptake, the weak base precluded insulin-induced GLUT4 translocation and the associated stimulation of glucose transport.	Chloroquine	36-39	solute carrier family 2 member 4	Rattus norvegicus	88-93
8270880-9	1994	Both MV H and NP presentations were sensitive to chloroquine inhibition indicating that antigens from CD46-mediated captured MV were likely processed in the endosome/lysosome compartment.	Chloroquine	49-60	CD46 antigen, complement regulatory protein	Mus musculus	102-106
7701627-8	1994	The specific binding of 125I-insulin was twice increased in the presence of lysosomal inhibitor chloroquin; contrary to this, no increase was found in the lamprey hepatocytes.	Chloroquine	96-106	insulin	Canis lupus familiaris	29-36
8257419-12	1993	Clq impairs the stimulation of glucose transport by blocking translocation of GLUT4 by a pH-independent mechanism.	Chloroquine	0-3	solute carrier family 2 member 4	Rattus norvegicus	78-83
8257419-13	1993	Clq may provide a useful tool to elucidate the signalling or fusion steps involved in insulin-induced GLUT4 translocation.	Chloroquine	0-3	solute carrier family 2 member 4	Rattus norvegicus	102-107
8143917-7	1993	A minor fraction of internalized 125I-bFGF was metabolized in lysosomes, as the inclusion of 50 microM chloroquine during the 6 h incubation at 37 degrees C inhibited most of the increase in TCA-soluble radioactivity appearing in the incubation medium.	Chloroquine	103-114	fibroblast growth factor 2	Rattus norvegicus	38-42
8312225-5	1993	By blocking thiol and serine proteases with specific inhibitors or by raising the intracellular pH with chloroquine during BI pulse, the presentation capacity of IFN-gamma-activated BMMph was significantly enhanced, while the presentation function of GM-CSF-pulsed macrophages was not positively influenced.	Chloroquine	104-115	interferon gamma	Bos taurus	162-171
8312225-5	1993	By blocking thiol and serine proteases with specific inhibitors or by raising the intracellular pH with chloroquine during BI pulse, the presentation capacity of IFN-gamma-activated BMMph was significantly enhanced, while the presentation function of GM-CSF-pulsed macrophages was not positively influenced.	Chloroquine	104-115	colony stimulating factor 2	Bos taurus	251-257
8409420-7	1993	Treatment of APC with chloroquine or paraformaldehyde interfered with the stimulation of Ag-specific CD4+ T cells by both transferrin-Ag conjugate and native Ag.	Chloroquine	22-33	transferrin	Homo sapiens	122-133
8211001-7	1993	Using mutant RMA-S cells, it was found that both Brefeldin A (BFA) and chloroquine, but not leupeptin, inhibited MHC-I upregulation response to both peptide and beta 2-m.	Chloroquine	71-82	beta-2 microglobulin	Mus musculus	161-169
8216225-6	1993	Since chloroquine and leupeptin inhibited CRP degradation, it was concluded that degradation of CRP occurred in the lysosomal compartment of the macrophage.	Chloroquine	6-17	C-reactive protein	Rattus norvegicus	42-45
8216225-6	1993	Since chloroquine and leupeptin inhibited CRP degradation, it was concluded that degradation of CRP occurred in the lysosomal compartment of the macrophage.	Chloroquine	6-17	C-reactive protein	Rattus norvegicus	96-99
8357820-7	1993	Significant uptake of 125I-TNF into T-24 cells was observed when these immunoliposomes were used, and this uptake of TNF was inhibited by cytochalasin B or chloroquine.	Chloroquine	156-167	tumor necrosis factor	Homo sapiens	27-30
8357820-7	1993	Significant uptake of 125I-TNF into T-24 cells was observed when these immunoliposomes were used, and this uptake of TNF was inhibited by cytochalasin B or chloroquine.	Chloroquine	156-167	tumor necrosis factor	Homo sapiens	117-120
8338148-0	1993	Five-compartment model of insulin kinetics and its use to investigate action of chloroquine in NIDDM.	Chloroquine	80-91	insulin	Homo sapiens	26-33
8244452-1	1993	Although chloroquine administration in vivo following haemorrhage in mice decreases tumour necrosis factor-alpha (TNF-alpha) release by macrophage (M phi), the mechanism remains unknown.	Chloroquine	9-20	tumor necrosis factor	Mus musculus	114-123
8244452-3	1993	Pretreatment of pM phi from various groups of mice with chloroquine resulted in 75-90% inhibition of TNF-alpha release, determined by bioassay.	Chloroquine	56-67	tumor necrosis factor	Mus musculus	101-110
8244452-5	1993	Chloroquine inhibited TNF-alpha mRNA expression without interfering with mRNA stability, suggesting that this agent reduces M phi TNF-alpha release by disrupting TNF-alpha gene transcription.	Chloroquine	0-11	tumor necrosis factor	Mus musculus	22-31
8244452-5	1993	Chloroquine inhibited TNF-alpha mRNA expression without interfering with mRNA stability, suggesting that this agent reduces M phi TNF-alpha release by disrupting TNF-alpha gene transcription.	Chloroquine	0-11	tumor necrosis factor	Mus musculus	130-139
8244452-5	1993	Chloroquine inhibited TNF-alpha mRNA expression without interfering with mRNA stability, suggesting that this agent reduces M phi TNF-alpha release by disrupting TNF-alpha gene transcription.	Chloroquine	0-11	tumor necrosis factor	Mus musculus	130-139
8244453-0	1993	Chloroquine-induced inhibition of the production of TNF, but not of IL-6, is affected by disruption of iron metabolism.	Chloroquine	0-11	tumor necrosis factor	Homo sapiens	52-55
8244453-6	1993	TNF and IL-6 production were suppressed in a dose-dependent manner when macrophages were treated with chloroquine, but not with other anti-malarial drugs.	Chloroquine	102-113	tumor necrosis factor	Homo sapiens	0-3
8244453-6	1993	TNF and IL-6 production were suppressed in a dose-dependent manner when macrophages were treated with chloroquine, but not with other anti-malarial drugs.	Chloroquine	102-113	interleukin 6	Homo sapiens	8-12
8244453-8	1993	Our results demonstrated that chloroquine-induced inhibition of TNF and IL-6 production is not mediated through a lysosomotropic mechanism, and that chloroquine probably acts on TNF secretion by disrupting iron homeostasis.	Chloroquine	30-41	tumor necrosis factor	Homo sapiens	64-67
8244453-8	1993	Our results demonstrated that chloroquine-induced inhibition of TNF and IL-6 production is not mediated through a lysosomotropic mechanism, and that chloroquine probably acts on TNF secretion by disrupting iron homeostasis.	Chloroquine	30-41	interleukin 6	Homo sapiens	72-76
8244453-8	1993	Our results demonstrated that chloroquine-induced inhibition of TNF and IL-6 production is not mediated through a lysosomotropic mechanism, and that chloroquine probably acts on TNF secretion by disrupting iron homeostasis.	Chloroquine	149-160	tumor necrosis factor	Homo sapiens	178-181
7902361-4	1993	P-glycoprotein (P-gP) has been implicated as playing a role in multidrug (MDR) resistance in cancer, chloroquine-resistant Plasmodium falciparum infection, and possibly human immunodeficiency virus-1 (HIV-1) resistance to nucleoside compounds.	Chloroquine	101-112	ATP binding cassette subfamily B member 1	Homo sapiens	0-14
7902361-4	1993	P-glycoprotein (P-gP) has been implicated as playing a role in multidrug (MDR) resistance in cancer, chloroquine-resistant Plasmodium falciparum infection, and possibly human immunodeficiency virus-1 (HIV-1) resistance to nucleoside compounds.	Chloroquine	101-112	phosphoglycolate phosphatase	Homo sapiens	16-20
8338148-6	1993	The model was employed to assess the effect of chloroquine on insulin kinetics in patients with non-insulin-dependent diabetes mellitus (NIDDM).	Chloroquine	47-58	insulin	Homo sapiens	62-69
7690043-9	1993	Treatment with chloroquine affected Golgi structures less than monensin and led to condensation of gal-T positive and to slight enlargement of sialyl-T positive structures.	Chloroquine	15-26	galactose-1-phosphate uridylyltransferase	Homo sapiens	99-104
8514796-9	1993	The mature, Endo H-resistant form of the EPO-R appears to be degraded in lysosomes or in other acidic organelles, since receptor degradation is blocked by treatment with NH4Cl, chloroquine, or leupeptin.	Chloroquine	177-188	erythropoietin receptor	Mus musculus	41-46
8500736-2	1993	The weak base chloroquine accumulates within acidic intracellular compartments, raises their pH, and can inhibit proteolysis as well as cathepsin B.	Chloroquine	14-25	cathepsin B	Homo sapiens	136-147
7685028-6	1993	Degradation of vitronectin was saturable, sensitive to chloroquine, and occurred intracellularly, suggesting that vitronectin was degraded through a lysosomal pathway.	Chloroquine	55-66	vitronectin	Homo sapiens	15-26
7685028-6	1993	Degradation of vitronectin was saturable, sensitive to chloroquine, and occurred intracellularly, suggesting that vitronectin was degraded through a lysosomal pathway.	Chloroquine	55-66	vitronectin	Homo sapiens	114-125
8223708-11	1993	Two inhibitors of MPR-mediated enzyme transport, tunicamycin and chloroquine, were used.	Chloroquine	65-76	progesterone receptor membrane component 1	Rattus norvegicus	18-21
8391306-9	1993	Significantly, these cells presented the endogenously synthesized antigen to autologous gp340-specific T cell clones via a chloroquine-resistant pathway.	Chloroquine	123-134	deleted in malignant brain tumors 1	Homo sapiens	88-93
8473726-7	1993	Constitutive presentation of endogenous HEL46-61 by the cytHEL and ERHEL transfectants was inhibited by chloroquine, and recovery of presentation of endogenous HEL was slower in cytHEL compared with ERHEL transfectants.	Chloroquine	104-115	golgi membrane protein 1	Homo sapiens	40-45
8473302-6	1993	The enhanced degradation of Lp(a) by foam cells was chloroquine-sensitive and dependent upon the presence of calcium in the extracellular medium.	Chloroquine	52-63	lipoprotein(a)	Homo sapiens	28-33
8099744-5	1993	Potentially important differences in calmodulin sequences involve amino acids with side-chains forming the hydrophobic clefts as well as in the central helix; these differences could alter interactions with small hydrophobic molecules such as chloroquine and with enzymes modulated by calmodulin.	Chloroquine	243-254	calmodulin 1	Homo sapiens	37-47
8099744-6	1993	Our modelling studies suggest that neither of the antimalarials examined (chloroquine and quinine) bind tightly to calmodulin.	Chloroquine	74-85	calmodulin 1	Homo sapiens	115-125
7681081-9	1993	Ag presentation to CD4+ T cell clones by monocytes of SL3261-pNP-2, purified recombinant NP, and live influenza virus, but not the synthetic peptide 206-229, was inhibited by chloroquine and the protease inhibitors pepstatin A and leupeptin, suggesting that the major route of processing in each case was via the exogenous pathway.	Chloroquine	175-186	CD4 molecule	Homo sapiens	19-22
8473293-10	1993	Chloroquine and NH4Cl significantly reduced apoE degradation; however, ALLN plus either of these reagents appear to have an additive effect.	Chloroquine	0-11	apolipoprotein E	Homo sapiens	44-48
8460675-2	1993	In another group of Mg-deficient animals chloroquine treatment diminished significantly the levels of circulating cytokines (interleukin-1, interleukin-6, and tumor necrosis factor-alpha) and also resulted in a major decrease in myocardial lesions.	Chloroquine	41-52	interleukin 6	Rattus norvegicus	140-153
8487662-2	1993	Chloroquine reduced the fasting serum concentrations of total cholesterol (6.16 +/- 0.31 to 5.67 +/- 0.31 mmol/L, P &lt; .05), low-density lipoprotein (LDL) cholesterol (4.38 +/- 0.35 to 3.93 +/- 0.32 mmol/L, P &lt; .05), and apolipoprotein (apo) B (1.46 +/- 0.08 to 1.24 +/- 0.06 g/L, P &lt; .01), and the ratio of apo B to apo A-I (0.81 +/- 0.05 to 0.71 +/- 0.03, P &lt; .05).	Chloroquine	0-11	apolipoprotein B	Homo sapiens	226-248
8487662-2	1993	Chloroquine reduced the fasting serum concentrations of total cholesterol (6.16 +/- 0.31 to 5.67 +/- 0.31 mmol/L, P &lt; .05), low-density lipoprotein (LDL) cholesterol (4.38 +/- 0.35 to 3.93 +/- 0.32 mmol/L, P &lt; .05), and apolipoprotein (apo) B (1.46 +/- 0.08 to 1.24 +/- 0.06 g/L, P &lt; .01), and the ratio of apo B to apo A-I (0.81 +/- 0.05 to 0.71 +/- 0.03, P &lt; .05).	Chloroquine	0-11	apolipoprotein B	Homo sapiens	316-321
8487662-3	1993	Chloroquine also caused a decrease in fasting plasma glucose levels (11.1 +/- 0.5 to 9.2 +/- 0.4 mmol/L, P &lt; .01) and an increase in fasting plasma insulin levels (0.12 +/- 0.01 to 0.14 +/- 0.01 nmol/L, P &lt; .01).	Chloroquine	0-11	insulin	Homo sapiens	151-158
8460675-2	1993	In another group of Mg-deficient animals chloroquine treatment diminished significantly the levels of circulating cytokines (interleukin-1, interleukin-6, and tumor necrosis factor-alpha) and also resulted in a major decrease in myocardial lesions.	Chloroquine	41-52	tumor necrosis factor	Rattus norvegicus	159-186
8095048-13	1993	Recycling of GC/ANF-R was impaired by chloroquine, dinitrophenol, and low temperature (22 degrees C).	Chloroquine	38-49	natriuretic peptide type A	Mus musculus	16-19
8486572-4	1993	At concentrations exceeding the peak serum levels achieved with therapeutic dosages, chloroquine, in a dose-dependent manner, inhibited IFN-gamma- and malaria antigen-induced RNI production.	Chloroquine	85-96	interferon gamma	Mus musculus	136-145
8424811-8	1993	Since SAG, endogenously formed in erythrocyte membranes, is a potent activator of phospholipase A2, this membrane-stabilizing action of chloroquine may partially account for the phospholipase A2-inhibiting properties of this drug, and, consequently, for both its therapeutic and toxic modes of action.	Chloroquine	136-147	phospholipase A2 group IB	Homo sapiens	82-98
8424811-8	1993	Since SAG, endogenously formed in erythrocyte membranes, is a potent activator of phospholipase A2, this membrane-stabilizing action of chloroquine may partially account for the phospholipase A2-inhibiting properties of this drug, and, consequently, for both its therapeutic and toxic modes of action.	Chloroquine	136-147	phospholipase A2 group IB	Homo sapiens	178-194
1445281-4	1992	Pretreatment of cells with the lysosomotropic agent chloroquine and the energy depleter dinitrophenol led to an increase in the intracellular 125I-ANF radioactivity.	Chloroquine	52-63	natriuretic peptide A	Rattus norvegicus	147-150
8259265-0	1993	Prevention of chloroquine-induced electroretinographic damage by a new platelet-activating factor antagonist, BN 50730.	Chloroquine	14-25	PCNA clamp associated factor	Rattus norvegicus	71-97
8259265-7	1993	The results obtained indicate that (i) chloroquine is a toxic drug for retinal function, (ii) PAF plays a key role in the mediation of chloroquine retinopathy and (iii) PAF antagonists may constitute valuable agents for the treatment of this retinal impairment.	Chloroquine	39-50	PCNA clamp associated factor	Rattus norvegicus	169-172
8259265-7	1993	The results obtained indicate that (i) chloroquine is a toxic drug for retinal function, (ii) PAF plays a key role in the mediation of chloroquine retinopathy and (iii) PAF antagonists may constitute valuable agents for the treatment of this retinal impairment.	Chloroquine	135-146	PCNA clamp associated factor	Rattus norvegicus	94-97
8259265-7	1993	The results obtained indicate that (i) chloroquine is a toxic drug for retinal function, (ii) PAF plays a key role in the mediation of chloroquine retinopathy and (iii) PAF antagonists may constitute valuable agents for the treatment of this retinal impairment.	Chloroquine	135-146	PCNA clamp associated factor	Rattus norvegicus	169-172
8093425-9	1993	In regenerating liver, both vinblastine and chloroquine decreased 125I-[tyr11]-SS-14 in bile and the liver.	Chloroquine	44-55	somatostatin	Rattus norvegicus	79-84
8093425-11	1993	After 70% hepatectomy was performed, chloroquine also inhibited 125I-[tyr11]-SS-14 accumulation.	Chloroquine	37-48	somatostatin	Rattus norvegicus	77-82
7678223-4	1993	The rapid disappearance of surface E-selectin is temperature dependent and sensitive to the lysosomotropic agent chloroquine.	Chloroquine	113-124	selectin E	Homo sapiens	35-45
1445281-5	1992	After 60 min incubation at 37 degrees C, cell-associated 125I-ANF radioactivity fell rapidly in chloroquine-treated cells (&gt; 85%) compared with the controls (&lt; 45%).	Chloroquine	96-107	natriuretic peptide A	Rattus norvegicus	62-65
1332057-7	1992	Western analyses using an anti-N-terminal mIL-3R beta IL-3 chain antibody reveal that this proteolytic cleavage also occurs rapidly in intact cells following stimulation with mIL-3 and occurs at the cell surface, since it takes place within minutes at 37 degrees C, is observed with purified plasma membranes, and is not inhibited by chloroquine.	Chloroquine	334-345	colony stimulating factor 2 receptor, beta, low-affinity (granulocyte-macrophage)	Mus musculus	42-48
1332057-7	1992	Western analyses using an anti-N-terminal mIL-3R beta IL-3 chain antibody reveal that this proteolytic cleavage also occurs rapidly in intact cells following stimulation with mIL-3 and occurs at the cell surface, since it takes place within minutes at 37 degrees C, is observed with purified plasma membranes, and is not inhibited by chloroquine.	Chloroquine	334-345	interleukin 3	Mus musculus	43-47
1332057-7	1992	Western analyses using an anti-N-terminal mIL-3R beta IL-3 chain antibody reveal that this proteolytic cleavage also occurs rapidly in intact cells following stimulation with mIL-3 and occurs at the cell surface, since it takes place within minutes at 37 degrees C, is observed with purified plasma membranes, and is not inhibited by chloroquine.	Chloroquine	334-345	interleukin 3	Mus musculus	42-47
1445281-6	1992	125I-ANF radioactivity increased to a peak of 65% of the initial level within 15 min in chloroquine-treated cells compared with only 22% in the control cells.	Chloroquine	88-99	natriuretic peptide A	Rattus norvegicus	5-8
1445281-7	1992	During the initial incubation period at 37 degrees C, chloroquine inhibited the release of both intact and degraded 125I-ANF in a time-dependent manner.	Chloroquine	54-65	natriuretic peptide A	Rattus norvegicus	121-124
1478276-6	1992	TR-bFGF stimulated EC growth was inhibited in a dose-dependent fashion when cells were coincubated with microM chloroquine.	Chloroquine	111-122	fibroblast growth factor 2	Bos taurus	3-7
1318035-8	1992	Degradation of 125I-t-PA at 37 degrees C by both cell types was inhibited by chloroquine or NH4Cl, indicating that t-PA is degraded lysosomally.	Chloroquine	77-88	plasminogen activator, tissue type	Rattus norvegicus	20-24
1457266-11	1992	Chloroquine carried a mixed non-competitive inhibition of hepatic histamine N-methyl transferase.	Chloroquine	0-11	histamine N-methyltransferase	Homo sapiens	66-96
1457266-12	1992	Some side-effects of chloroquine may be explained by inhibition of histamine N-methyl transferase.	Chloroquine	21-32	histamine N-methyltransferase	Homo sapiens	67-97
1395098-6	1992	In the malaria patients an increased level of MBP was maintained during 30 days of treatment with chloroquine.	Chloroquine	98-109	myelin basic protein	Homo sapiens	46-49
1422229-5	1992	Preincubation of cells with chloroquine, which inhibits lysosomal degradative enzyme activity, caused a continuous accumulation of bound EGF over a 4 h study period at 37 degrees C, and TSH stimulated an increase in internalized EGF.	Chloroquine	28-39	epidermal growth factor	Homo sapiens	137-140
1422229-5	1992	Preincubation of cells with chloroquine, which inhibits lysosomal degradative enzyme activity, caused a continuous accumulation of bound EGF over a 4 h study period at 37 degrees C, and TSH stimulated an increase in internalized EGF.	Chloroquine	28-39	epidermal growth factor	Homo sapiens	229-232
1422229-6	1992	In the presence of chloroquine, total specific bound EGF was linearly correlated to incubation time up to 4 h and can be expressed as Bound = slope*time+intercept (time0) Addition of TSH during the binding assay significantly increased the value of the slope when compared to control (p &lt; 0.002).	Chloroquine	19-30	epidermal growth factor	Homo sapiens	53-56
1527011-7	1992	Lysosomotropic agents, such as NH4Cl, chloroquine, and monensin inhibited CD4 degradation, consistent with a lysosomal fate for CD4.	Chloroquine	38-49	CD4 molecule	Homo sapiens	74-77
1432999-0	1992	Cyclosporine and chloroquine synergistically inhibit the interferon-gamma production by CD4 positive and CD8 positive synovial T cell clones derived from a patient with rheumatoid arthritis.	Chloroquine	17-28	interferon gamma	Homo sapiens	57-73
1432999-0	1992	Cyclosporine and chloroquine synergistically inhibit the interferon-gamma production by CD4 positive and CD8 positive synovial T cell clones derived from a patient with rheumatoid arthritis.	Chloroquine	17-28	CD4 molecule	Homo sapiens	88-91
1432999-0	1992	Cyclosporine and chloroquine synergistically inhibit the interferon-gamma production by CD4 positive and CD8 positive synovial T cell clones derived from a patient with rheumatoid arthritis.	Chloroquine	17-28	CD8a molecule	Homo sapiens	105-108
1612121-4	1992	Endocytosis and/or degradation of anti-CD4 mAb was suppressed by H7, and by inhibitors of membrane traffic (Monensin) and lysosome function (methylamine, chloroquine).	Chloroquine	154-165	CD4 molecule	Homo sapiens	39-42
1606164-3	1992	The acidotropic amines chloroquine (20 microM) and ammonium chloride (10 mM) cause accumulation (both approximately 4-fold) of GLUT-1 protein and a small increase (both approximately 25%) in hexose transport in glucose-fed fibroblasts (24 h).	Chloroquine	23-34	solute carrier family 2 (facilitated glucose transporter), member 1	Mus musculus	127-133
1606164-7	1992	In contrast, chloroquine or leupeptin diminish the reversal by glucose refeeding of the glucose deprivation induced accumulation of GLUT-1 protein but fail to alter the return of hexose transport to control levels.	Chloroquine	13-24	solute carrier family 2 (facilitated glucose transporter), member 1	Mus musculus	132-138
1363104-1	1992	The multidrug resistance gene 1 (mdr 1) product, the P-glycoprotein (Pgp), is a 170-kD transmembrane transport protein, whose overexpression is associated with multidrug resistance in cancer cells and in chloroquine-resistant Plasmodium falciparum infection.	Chloroquine	204-215	ATP binding cassette subfamily B member 1	Homo sapiens	4-31
1363104-1	1992	The multidrug resistance gene 1 (mdr 1) product, the P-glycoprotein (Pgp), is a 170-kD transmembrane transport protein, whose overexpression is associated with multidrug resistance in cancer cells and in chloroquine-resistant Plasmodium falciparum infection.	Chloroquine	204-215	ATP binding cassette subfamily B member 1	Homo sapiens	33-38
1363104-1	1992	The multidrug resistance gene 1 (mdr 1) product, the P-glycoprotein (Pgp), is a 170-kD transmembrane transport protein, whose overexpression is associated with multidrug resistance in cancer cells and in chloroquine-resistant Plasmodium falciparum infection.	Chloroquine	204-215	ATP binding cassette subfamily B member 1	Homo sapiens	53-67
1363104-1	1992	The multidrug resistance gene 1 (mdr 1) product, the P-glycoprotein (Pgp), is a 170-kD transmembrane transport protein, whose overexpression is associated with multidrug resistance in cancer cells and in chloroquine-resistant Plasmodium falciparum infection.	Chloroquine	204-215	ATP binding cassette subfamily B member 1	Homo sapiens	69-72
1432999-1	1992	OBJECTIVE: To investigate synergistic interaction between cyclosporine (Cy) and chloroquine (Chl) in an in vitro system, with regard to interferon-gamma (IFN) production by OKT3 activated T cell clones.	Chloroquine	80-91	interferon gamma	Mus musculus	136-158
1432999-1	1992	OBJECTIVE: To investigate synergistic interaction between cyclosporine (Cy) and chloroquine (Chl) in an in vitro system, with regard to interferon-gamma (IFN) production by OKT3 activated T cell clones.	Chloroquine	93-96	interferon gamma	Mus musculus	136-158
1318035-8	1992	Degradation of 125I-t-PA at 37 degrees C by both cell types was inhibited by chloroquine or NH4Cl, indicating that t-PA is degraded lysosomally.	Chloroquine	77-88	plasminogen activator, tissue type	Rattus norvegicus	115-119
1317209-10	1992	Control cells and cells treated with either GM1 or GM1OS-Tf were exposed to CT in the presence of chloroquine.	Chloroquine	98-109	transferrin	Homo sapiens	57-59
1317209-11	1992	Whereas chloroquine had little or no effect on the response of control or GM1-treated cells to CT, it made the cells treated with GM1OS-Tf responsive to the toxin.	Chloroquine	8-19	transferrin	Homo sapiens	136-138
1567890-6	1992	Growth factor-responsive NADH oxidase, however, was inhibited greater than 90% by chloroquine and quinone analogues.	Chloroquine	82-93	myotrophin	Rattus norvegicus	0-13
1556093-4	1992	The addition of the lysosomotropic agent chloroquine inhibited this receptor-mediated degradation of IL-6 without affecting ligand internalization.	Chloroquine	41-52	interleukin 6	Rattus norvegicus	101-105
1313799-6	1992	However, the membrane IFCR activity recovered to 100 or 75%, respectively, when the slices were cultured with intrinsic factor-cobalamin mixed with either leupeptin or chloroquine.	Chloroquine	168-179	cubilin	Rattus norvegicus	22-26
1312808-7	1992	The reduction and release of transferrin-derived Fe2+ were inhibited by apotransferrin and chloroquine, indicating a dependence on receptor-specific binding of transferrin to the RPAEC cell surface, with subsequent endocytosis, acidification, and reduction of transferrin-bound Fe3+ to Fe2+.	Chloroquine	91-102	transferrin	Homo sapiens	29-40
1372484-2	1992	The basal as well as caerulein-stimulated in vivo rate of cathepsin B was further increased by infusion of either chloroquine or methylamine while neither the basal nor the secretagogue-stimulated rates of amylase secretion were altered by the lysosomotropic agents.	Chloroquine	114-125	cathepsin B	Rattus norvegicus	58-69
1372484-5	1992	That in vitro rate of cathepsin B secretion stimulated by caerulein was not increased in acini prepared from animals infused with caerulein, chloroquine, or methylamine, but the in vitro rate of cathepsin B secretion stimulated by caerulein was increased in acini prepared from animals infused with caerulein plus either chloroquine or methylamine.	Chloroquine	321-332	cathepsin B	Rattus norvegicus	22-33
1563542-5	1992	Chloroquine and quinacrine treatment also increases the insulin receptor content of endosomal fractions and, in rats injected by native insulin, the ligand-induced accumulation of receptors in endosomal fractions at late times after injection.	Chloroquine	0-11	insulin receptor	Rattus norvegicus	56-72
1730806-3	1992	At 2.5 mM Ca, two inhibitors of cellular proteolysis, 3-methyladenine and chloroquine, stimulated secretion of both PA activity and PTH.	Chloroquine	74-85	parathyroid hormone	Homo sapiens	132-135
1370207-4	1992	Platelets from two patients with the Bernard-Soulier syndrome (BSS) were HPA-2(a-,b-) in the immunofluorescence test with HPA-2 alloantibodies on chloroquine-treated platelets.	Chloroquine	146-157	heparanase 2 (inactive)	Homo sapiens	73-78
1370207-4	1992	Platelets from two patients with the Bernard-Soulier syndrome (BSS) were HPA-2(a-,b-) in the immunofluorescence test with HPA-2 alloantibodies on chloroquine-treated platelets.	Chloroquine	146-157	heparanase 2 (inactive)	Homo sapiens	122-127
1559183-0	1992	[Involvement of PAF (Platelet-Activating Factor) in chloroquine-induced retinopathy].	Chloroquine	52-63	PCNA clamp associated factor	Rattus norvegicus	16-19
1559183-0	1992	[Involvement of PAF (Platelet-Activating Factor) in chloroquine-induced retinopathy].	Chloroquine	52-63	PCNA clamp associated factor	Rattus norvegicus	21-47
1559183-3	1992	In order to test the possible involvement of Platelet-Activating Factor (PAF) in chloroquine-induced retinopathy and the use of PAF antagonists for prevention of this condition, we have examined the effect of these substances on the electroretinogram (ERG) of isolated rat retina.	Chloroquine	81-92	PCNA clamp associated factor	Rattus norvegicus	73-76
1559183-6	1992	The results obtained indicate that (i) chloroquine is a toxic drug for retinal function, (ii) PAF plays a key role in chloroquine retinopathy and (iii) PAF antagonists may constitute valuable agents for the treatment of this retinal impairment.	Chloroquine	39-50	PCNA clamp associated factor	Rattus norvegicus	152-155
1559183-6	1992	The results obtained indicate that (i) chloroquine is a toxic drug for retinal function, (ii) PAF plays a key role in chloroquine retinopathy and (iii) PAF antagonists may constitute valuable agents for the treatment of this retinal impairment.	Chloroquine	118-129	PCNA clamp associated factor	Rattus norvegicus	94-97
1547655-6	1992	Transfection with DEAE-dextran and chloroquine did enable 40% of the surviving cells to express GST, but only 0.01% of the cells that survived transfection formed colonies in cloning assays.	Chloroquine	35-46	glutathione S-transferase kappa 1	Homo sapiens	96-99
1285806-2	1992	Chloroquine-treated platelet membranes generated the cleanest blots, giving end-point titres of 4000-16,000 for three different anti-PlA1 sera.	Chloroquine	0-11	POU class 2 homeobox 3	Homo sapiens	133-137
1531639-5	1992	Pulse-chase biosynthetic assays demonstrated that the fate of the unglycosylated CD45 proteins underwent a late non-lysosomal degradation, since it was not prevented either by monensin, an inhibitor of Golgi transport, or by the lysosomal function inhibitor chloroquine.	Chloroquine	258-269	protein tyrosine phosphatase receptor type C	Homo sapiens	81-85
1732381-5	1992	Moreover, chloroquine partially reversed the inhibitory effect of transforming growth factor-beta (TGF beta) on T-cell activation induced by cultured normal EAPC.	Chloroquine	10-21	transforming growth factor beta 1	Homo sapiens	66-97
1732381-5	1992	Moreover, chloroquine partially reversed the inhibitory effect of transforming growth factor-beta (TGF beta) on T-cell activation induced by cultured normal EAPC.	Chloroquine	10-21	transforming growth factor beta 1	Homo sapiens	99-107
1343942-0	1992	Chloroquine inhibits the insulin binding and the imprinting of nuclear envelope in Tetrahymena.	Chloroquine	0-11	insulin	Homo sapiens	25-32
1343942-1	1992	Chloroquine possessing lysosomotrop effects inhibits the development of insulin imprinting both on the plasma membrane and the nuclear envelope.	Chloroquine	0-11	insulin	Homo sapiens	72-79
1343942-2	1992	Simultaneously chloroquine can inhibit the insulin binding in the nucleus itself but not in the plasma membrane.	Chloroquine	15-26	insulin	Homo sapiens	43-50
1563542-6	1992	Subfractionation of endosomal fractions on Percoll gradients shows that chloroquine treatment shifts the distribution of both insulin and the insulin receptor towards higher densities, the receptor shift being slightly more pronounced in insulin-injected rats.	Chloroquine	72-83	insulin receptor	Rattus norvegicus	142-158
1958695-6	1991	The lysosomotrophic agents (chloroquine, NH4Cl) greatly decreased the extent of CRP degradation without altering binding or internalization.	Chloroquine	28-39	C-reactive protein	Homo sapiens	80-83
1939248-7	1991	GLUT4 reduction was not observed in the presence of chloroquine or at 18 degrees C suggesting involvement of the lysosomal pathway.	Chloroquine	52-63	solute carrier family 2 member 4	Rattus norvegicus	0-5
1319501-6	1992	Inhibition of lysosomal acidification by chloroquine increased the amounts of surface-bound IGF-II and intracellular IGF-I and reduced the degradation of IGF-I.	Chloroquine	41-52	insulin-like growth factor 2	Rattus norvegicus	92-98
1319501-6	1992	Inhibition of lysosomal acidification by chloroquine increased the amounts of surface-bound IGF-II and intracellular IGF-I and reduced the degradation of IGF-I.	Chloroquine	41-52	insulin-like growth factor 1	Rattus norvegicus	92-97
1319501-6	1992	Inhibition of lysosomal acidification by chloroquine increased the amounts of surface-bound IGF-II and intracellular IGF-I and reduced the degradation of IGF-I.	Chloroquine	41-52	insulin-like growth factor 1	Rattus norvegicus	117-122
1934357-7	1991	Chloroquine inhibition experiments demonstrate that autologous monocytes/macrophages are required by CD4+ T-cell precursors for the processing of EC-derived alloantigens and their subsequent presentation in the context of self-MHC molecules.	Chloroquine	0-11	CD4 molecule	Homo sapiens	101-104
1659207-1	1991	Although chloroquine, an agent that disrupts regulated protein secretion, has previously been shown to decrease the adrenocorticotropic hormone (ACTH) secretory response to adenosine 3",5"-cyclic monophosphate or corticotropin-releasing factor (CRF) in AtT-20 and rat anterior pituitary cells, respectively, it has no effect on the response to vasopressin.	Chloroquine	9-20	pro-opiomelanocortin-alpha	Mus musculus	116-143
1659207-1	1991	Although chloroquine, an agent that disrupts regulated protein secretion, has previously been shown to decrease the adrenocorticotropic hormone (ACTH) secretory response to adenosine 3",5"-cyclic monophosphate or corticotropin-releasing factor (CRF) in AtT-20 and rat anterior pituitary cells, respectively, it has no effect on the response to vasopressin.	Chloroquine	9-20	pro-opiomelanocortin-alpha	Mus musculus	145-149
1659207-1	1991	Although chloroquine, an agent that disrupts regulated protein secretion, has previously been shown to decrease the adrenocorticotropic hormone (ACTH) secretory response to adenosine 3",5"-cyclic monophosphate or corticotropin-releasing factor (CRF) in AtT-20 and rat anterior pituitary cells, respectively, it has no effect on the response to vasopressin.	Chloroquine	9-20	corticotropin releasing hormone	Mus musculus	213-243
1659207-1	1991	Although chloroquine, an agent that disrupts regulated protein secretion, has previously been shown to decrease the adrenocorticotropic hormone (ACTH) secretory response to adenosine 3",5"-cyclic monophosphate or corticotropin-releasing factor (CRF) in AtT-20 and rat anterior pituitary cells, respectively, it has no effect on the response to vasopressin.	Chloroquine	9-20	arginine vasopressin	Rattus norvegicus	344-355
1659207-2	1991	The present study extended experiments with chloroquine to cultured sheep anterior pituitary cells, which have a greater maximum response to vasopressin.	Chloroquine	44-55	arginine vasopressin	Rattus norvegicus	141-152
1659207-7	1991	The results indicate ACTH release in response to vasopressin is chloroquine insensitive in this way, can be dissociated from the mechanism that responds to CRF, and would be consistent with the CRF response mechanism involving pathways that can alter the secretory pool of ACTH.	Chloroquine	64-75	pro-opiomelanocortin-alpha	Mus musculus	21-25
1659207-7	1991	The results indicate ACTH release in response to vasopressin is chloroquine insensitive in this way, can be dissociated from the mechanism that responds to CRF, and would be consistent with the CRF response mechanism involving pathways that can alter the secretory pool of ACTH.	Chloroquine	64-75	arginine vasopressin	Rattus norvegicus	49-60
1874723-5	1991	Chloroquine and the thiol protease inhibitors leupeptin and E-64 inhibit the insulin-induced loss of the intact beta subunit from the membranes and induce an accumulation of the intact subunit in the membranes.	Chloroquine	0-11	insulin	Homo sapiens	77-84
1912565-0	1991	Chloroquine attenuates hemorrhagic shock-induced suppression of Kupffer cell antigen presentation and major histocompatibility complex class II antigen expression through blockade of tumor necrosis factor and prostaglandin release.	Chloroquine	0-11	tumor necrosis factor	Mus musculus	183-204
1912565-6	1991	The administration of CQ led to a significant reduction in the hemorrhage-induced elevation of TNF, IL-6, and PGE2 release by KC; however, IL-1 secretion was not affected by CQ.	Chloroquine	22-24	tumor necrosis factor	Mus musculus	95-98
1912565-6	1991	The administration of CQ led to a significant reduction in the hemorrhage-induced elevation of TNF, IL-6, and PGE2 release by KC; however, IL-1 secretion was not affected by CQ.	Chloroquine	22-24	interleukin 6	Mus musculus	100-104
1912565-7	1991	In addition, CQ treatment abolished the hemorrhage-induced increase in circulating TNF and IL-6.	Chloroquine	13-15	tumor necrosis factor	Mus musculus	83-86
1912565-7	1991	In addition, CQ treatment abolished the hemorrhage-induced increase in circulating TNF and IL-6.	Chloroquine	13-15	interleukin 6	Mus musculus	91-95
1931028-2	1991	With a modified DEAE-dextran/chloroquine method, we obtained 80% more transfected cells expressing the recombinant human interleukin-2 receptor than with transfection with cationic liposomes, one of the most efficient techniques to date.	Chloroquine	29-40	interleukin 2	Homo sapiens	121-134
1918985-8	1991	Chloroquine abrogates depletion of sIi by brefeldin A, apparently by inhibition of internalization of sIi.	Chloroquine	0-11	transcription elongation factor A1	Homo sapiens	35-38
1918985-8	1991	Chloroquine abrogates depletion of sIi by brefeldin A, apparently by inhibition of internalization of sIi.	Chloroquine	0-11	transcription elongation factor A1	Homo sapiens	102-105
1912565-10	1991	Our data indicate that CQ selectively inhibits the release of TNF, IL-6, and PGE2 by KC, while IL-1 secretion was unaffected.	Chloroquine	23-25	tumor necrosis factor	Mus musculus	62-65
1912565-10	1991	Our data indicate that CQ selectively inhibits the release of TNF, IL-6, and PGE2 by KC, while IL-1 secretion was unaffected.	Chloroquine	23-25	interleukin 6	Mus musculus	67-71
1915742-1	1991	The in vitro growth of Plasmodium falciparum is sensitive to some calmodulin antagonists and these compounds show antagonism with classic antimalarials such as chloroquine suggesting competition for the same drug binding site.	Chloroquine	160-171	calmodulin 1	Homo sapiens	66-76
1915742-2	1991	In order to ask if calmodulin is involved in resistance to chloroquine we cloned the calmodulin gene of P. falciparum.	Chloroquine	59-70	calmodulin 1	Homo sapiens	19-29
1915742-2	1991	In order to ask if calmodulin is involved in resistance to chloroquine we cloned the calmodulin gene of P. falciparum.	Chloroquine	59-70	calmodulin 1	Homo sapiens	85-95
1874723-6	1991	However, in the presence of leupeptin, E-64, or chloroquine, the insulin-induced loss of insulin binding activity occurs normally.	Chloroquine	48-59	insulin	Homo sapiens	65-72
2052558-7	1991	Under conditions of inhibition of protein synthesis in situ by chloroquine in the culture, the parasite eukaryotic initiation factor 2 alpha- (eIF-2 alpha) is phosphorylated in the parasite lysate to a greater extent than that observed in the control culture.	Chloroquine	63-74	eukaryotic translation initiation factor 2A	Oryctolagus cuniculus	143-154
2058666-8	1991	In addition, chloroquine increased fasting C-peptide secretion by 17% and reduced feedback inhibition of C-peptide by 9.1 and 10.6% during low- and high-dose insulin infusions, respectively.	Chloroquine	13-24	insulin	Homo sapiens	158-165
1674943-1	1991	Resistance to chloroquine in Plasmodium falciparum bears a striking similarity to the multi-drug resistance (MDR) phenotype of mammalian tumor cells which is mediated by overexpression of P-glycoprotein.	Chloroquine	14-25	ATP binding cassette subfamily B member 1	Homo sapiens	188-202
1867651-1	1991	Chloroquine caused only slight reductions in NAT activity when added in vitro, and had no detectable influence when animals were pretreated with it for 4 days.	Chloroquine	0-11	N-acetyltransferase 1	Rattus norvegicus	45-48
1648388-6	1991	The LDL receptor of D3-induced macrophages was found to exhibit specificity for apolipoprotein B- and E-containing lipoproteins, to be calcium dependent, and to be inhibited by pronase and chloroquine.	Chloroquine	189-200	low density lipoprotein receptor	Homo sapiens	4-16
1752220-5	1991	The common saline purgatives sodium sulphate at 7.5 mg/ml increased the B-50 for chloroquine slightly from 376 to 444 mg whereas it has little or no effect on the adsorption of mefloquine to activated charcoal.	Chloroquine	81-92	growth associated protein 43	Homo sapiens	72-76
2005115-7	1991	Dansylcadaverine, chloroquine, and staurosporine blocked the appearance of the 40-kDa complex concurrent with the blockage of internalization of the receptor-bound HBGF-1.	Chloroquine	18-29	fibroblast growth factor 1	Homo sapiens	164-170
1645358-6	1991	Internalization/degradation of TM in HUVECs incubated with PMA or cytokines was suggested by co-culture with chloroquine.	Chloroquine	109-120	thrombomodulin	Homo sapiens	31-33
1847707-7	1991	Preincubation of cells with chloroquine (which blocks degradation of the ANP-receptor complex by inhibiting lysosomal hydrolase) caused a 146% increase in internalized [125I]ANP by 30 min (39% compared to 15% control), while medium radioactivity decreased from 52% to 16%, suggesting that processing of the receptor complex is mediated via lysosomal enzymes.	Chloroquine	28-39	natriuretic peptide A	Homo sapiens	73-76
1847707-7	1991	Preincubation of cells with chloroquine (which blocks degradation of the ANP-receptor complex by inhibiting lysosomal hydrolase) caused a 146% increase in internalized [125I]ANP by 30 min (39% compared to 15% control), while medium radioactivity decreased from 52% to 16%, suggesting that processing of the receptor complex is mediated via lysosomal enzymes.	Chloroquine	28-39	natriuretic peptide A	Homo sapiens	174-177
1847707-8	1991	In chase studies employing cells pretreated with chloroquine, TSH stimulated the internalization rate of ANP-receptor complex.	Chloroquine	49-60	natriuretic peptide A	Homo sapiens	105-108
1985897-2	1991	A rapid purification procedure for the NF-kappa B transcription factor from the cytosol of human placenta is demonstrated which exploits the insensitivity of the NF-kappa B.DNA complex toward the intercalating agent chloroquine.	Chloroquine	216-227	nuclear factor kappa B subunit 1	Homo sapiens	39-49
1931436-9	1991	Inclusion of chloroquine (1 mM) in the suspending medium, both in uptake and release experiments, resulted in more PVP and Tf passing through the cells, while Fe uptake was reduced.	Chloroquine	13-24	transferrin	Rattus norvegicus	123-125
1844318-4	1991	Repeated chloroquine treatment of rats resulted in increased activity of liver lysosomal enzymes acid phosphatase and beta-galactosidase and a significant enhancement of the activities of cathepsin D and cysteine proteinases were found.	Chloroquine	9-20	galactosidase, beta 1	Rattus norvegicus	118-136
1844318-4	1991	Repeated chloroquine treatment of rats resulted in increased activity of liver lysosomal enzymes acid phosphatase and beta-galactosidase and a significant enhancement of the activities of cathepsin D and cysteine proteinases were found.	Chloroquine	9-20	cathepsin D	Rattus norvegicus	188-199
1824916-12	1991	Treatment of Raji cells with the lysosomotropic agent chloroquine inhibited the degradation of IL-1 without having any effect on the amount of intact IL-1 in the intracellular compartments.	Chloroquine	54-65	interleukin 1 alpha	Homo sapiens	95-99
1710912-11	1991	Degradation of bFGF appeared to occur in the lysosomal compartment since it was inhibited by chloroquine, an inhibitor of lysosomal proteases; aFGF internalization and degradation followed the same kinetics as bFGF with the appearance of 7 kDa and 5 kDa fragments.	Chloroquine	93-104	fibroblast growth factor 2	Bos taurus	15-19
1991464-2	1991	The binding and presumed internalisation of 125I-Fe3+(2)-transferrin by freshly isolated hepatocytes was only partially inhibited by up to a 10(4)-fold molar excess of unlabelled ligand and was virtually insensitive to chloroquine.	Chloroquine	219-230	transferrin	Rattus norvegicus	57-68
1725340-7	1991	In contrast, 10 mM NH4Cl or 0.2 mM chloroquine (both lysosomal function inhibitors) reduced TGF-beta-stimulated ET-1 secretion in the basolateral bath whereas big ET-1 secretion in the apical bath increased two times.	Chloroquine	35-46	endothelin 1	Canis lupus familiaris	112-116
1683722-8	1991	In addition, the activities of two lysosomal enzymes, acid phosphatase and cathepsin B, increased in the AV-fractions following chloroquine treatment.	Chloroquine	128-139	cathepsin B	Rattus norvegicus	75-86
1848562-8	1991	Proteolytic cleavage of mature TGF-beta 2 from pro-TGF-beta 2 was inhibited by monensin and chloroquine suggesting that binding to this receptor and subsequent transport to acidic vesicles may be involved in the processing of rTGF-beta 2 precursor.	Chloroquine	92-103	transforming growth factor, beta 2	Rattus norvegicus	31-41
1848562-8	1991	Proteolytic cleavage of mature TGF-beta 2 from pro-TGF-beta 2 was inhibited by monensin and chloroquine suggesting that binding to this receptor and subsequent transport to acidic vesicles may be involved in the processing of rTGF-beta 2 precursor.	Chloroquine	92-103	transforming growth factor, beta 2	Rattus norvegicus	51-61
1848562-8	1991	Proteolytic cleavage of mature TGF-beta 2 from pro-TGF-beta 2 was inhibited by monensin and chloroquine suggesting that binding to this receptor and subsequent transport to acidic vesicles may be involved in the processing of rTGF-beta 2 precursor.	Chloroquine	92-103	transforming growth factor, beta 2	Rattus norvegicus	226-237
1725297-9	1991	Similar to chloroquine, 0.5 microM monensin increased the secretion of ET-1 by 40-60%.	Chloroquine	11-22	endothelin 1	Bos taurus	71-75
1964415-5	1990	When chloroquine-treated cells were double labeled with antibodies to both the 215 and 46 kDa M6PR, all of the endosomes which contained detectable 46 kDa also contained 215 kDa receptor.	Chloroquine	5-16	mannose-6-phosphate receptor, cation dependent	Rattus norvegicus	94-98
2175711-5	1990	The capacity of chloroquine to inhibit either phospholipase C (PLC) or phospholipase A2 (PLA2) could explain the antisecretory activity of this drug.	Chloroquine	16-27	phospholipase A2 group IB	Homo sapiens	71-87
1701722-11	1990	The assembly of myosin, titin, and actin into sarcomeric bands, as well as X22, is inhibited by chloroquine.	Chloroquine	96-107	titin	Rattus norvegicus	24-29
2269328-3	1990	Furthermore, presentation of the insulin fragment as well as presentation of ovalbumin (OVA) was inhibited by treatment of APC with chloroquine, cerulenin or tunicamycin.	Chloroquine	132-143	insulin	Homo sapiens	33-40
2175711-5	1990	The capacity of chloroquine to inhibit either phospholipase C (PLC) or phospholipase A2 (PLA2) could explain the antisecretory activity of this drug.	Chloroquine	16-27	phospholipase A2 group IB	Homo sapiens	89-93
2148320-4	1990	Both monensin and chloroquine inhibited anti-CD3-pulsed monocyte-induced T-cell DNA synthesis and CD25 expression in a dose-dependent manner.	Chloroquine	18-29	interleukin 2 receptor subunit alpha	Homo sapiens	98-102
1965033-9	1990	Degradation of internalized 125I-VIP was significantly reduced by chloroquine phenanthroline and pepstatin-A.	Chloroquine	66-77	vasoactive intestinal peptide	Homo sapiens	33-36
1965033-11	1990	Chloroquine reduced surface-bound 125I-VIP, but caused retention of internalized 125I-VIP.	Chloroquine	0-11	vasoactive intestinal peptide	Homo sapiens	39-42
1965033-11	1990	Chloroquine reduced surface-bound 125I-VIP, but caused retention of internalized 125I-VIP.	Chloroquine	0-11	vasoactive intestinal peptide	Homo sapiens	86-89
2222420-10	1990	Finally, chloroquine inhibited the alpha-carboxyamidation of CCK.	Chloroquine	9-20	cholecystokinin	Rattus norvegicus	61-64
2126528-3	1990	No effect of rHuIFN-gamma was seen against experimental relapsing stage compared with controls; however, it appears that chloroquine (CHL) may have interfered with the antimalarial effect of IFN, since treatment with CHL inhibits the antiviral activity of mouse alpha/beta IFN and polyinosinic-polycytidylic acid (poly I:C) against Semliki forest virus (SFV) in mice.	Chloroquine	121-132	interferon alpha 1	Homo sapiens	191-194
1697643-7	1990	Glutaraldehyde fixation and chloroquine treatment of presenting cells abolished their capacity to present insulin.	Chloroquine	28-39	LOC105613195	Ovis aries	106-113
1973824-2	1990	This superfamily includes the well characterized periplasmic binding protein-dependent uptake systems of prokaryotes, bacterial exporters, and eukaryotic proteins including the P-glycoprotein associated with multidrug resistance in tumours (MDR), the STE6 gene product that mediates export of yeast a-factor mating pheromone, pfMDR that is implicated in chloroquine resistance of the malarial parasite, and the product of the cystic fibrosis gene (CFTR).	Chloroquine	354-365	ATP-binding cassette a-factor transporter STE6	Saccharomyces cerevisiae S288C	251-255
2188977-5	1990	Chloroquine, a lysosomotropic agent, inhibited degradation of both the wild-type hIR and the chimeric hIR.ros and increased their intracellular accumulation.	Chloroquine	0-11	potassium inwardly rectifying channel subfamily J member 4	Homo sapiens	81-84
2218068-0	1990	Effects of chloroquine and hepatic stimulator substance on cellular accumulation and nuclear binding of 125I-epidermal growth factor in primary culture of adult rat hepatocytes.	Chloroquine	11-22	epidermal growth factor	Rattus norvegicus	104-132
2218068-2	1990	When intact hepatocytes were incubated at 37 degrees C with 125I-EGF, the cellular accumulation and the nuclear binding reached a peak at 1 h and declined thereafter, where the nuclear binding was 2.49% at 1 h and 2.53% at 2 h. Chloroquine resulted in a time-dependent increase in the cellular accumulation and the nuclear binding was 3.37% at 1 h and 3.72% at 2 h. In contrast, HSS produced no change in each value, suggesting that HSS does not modulate EGF receptors in plasma membrane and nucleus.	Chloroquine	228-239	epidermal growth factor	Rattus norvegicus	65-68
2163622-9	1990	The rapidity of the receptor-mediated process and its sensitivity to NH4Cl and chloroquine suggest that the 125I-hANF is proteolytically processed in the endosomes of BAECs and that its receptors cycle between the cell surface and intracellular stores.	Chloroquine	79-90	HESX homeobox 1	Homo sapiens	113-117
2188977-5	1990	Chloroquine, a lysosomotropic agent, inhibited degradation of both the wild-type hIR and the chimeric hIR.ros and increased their intracellular accumulation.	Chloroquine	0-11	potassium inwardly rectifying channel subfamily J member 4	Homo sapiens	102-105
2188977-6	1990	However, the chloroquine effect was much more marked for the hIR.ros receptors whose intracellular accumulation was increased by greater than 300% (in comparison with approximately 60% increase for the wild-type hIR), demonstrating marked intracellular degradation of the hybrid hIR.ros at chloroquine-sensitive sites.	Chloroquine	13-24	potassium inwardly rectifying channel subfamily J member 4	Homo sapiens	61-64
2188977-6	1990	However, the chloroquine effect was much more marked for the hIR.ros receptors whose intracellular accumulation was increased by greater than 300% (in comparison with approximately 60% increase for the wild-type hIR), demonstrating marked intracellular degradation of the hybrid hIR.ros at chloroquine-sensitive sites.	Chloroquine	13-24	potassium inwardly rectifying channel subfamily J member 4	Homo sapiens	212-215
2188977-6	1990	However, the chloroquine effect was much more marked for the hIR.ros receptors whose intracellular accumulation was increased by greater than 300% (in comparison with approximately 60% increase for the wild-type hIR), demonstrating marked intracellular degradation of the hybrid hIR.ros at chloroquine-sensitive sites.	Chloroquine	13-24	potassium inwardly rectifying channel subfamily J member 4	Homo sapiens	212-215
2188977-6	1990	However, the chloroquine effect was much more marked for the hIR.ros receptors whose intracellular accumulation was increased by greater than 300% (in comparison with approximately 60% increase for the wild-type hIR), demonstrating marked intracellular degradation of the hybrid hIR.ros at chloroquine-sensitive sites.	Chloroquine	290-301	potassium inwardly rectifying channel subfamily J member 4	Homo sapiens	61-64
1970614-3	1990	The discovery that verapamil partially reverses chloroquine resistance in vitro led to the proposal that efflux may involve an ATP-driven P-glycoprotein pump similar to that in mammalian multidrug-resistant (mdr) tumor cell lines.	Chloroquine	48-59	ATP binding cassette subfamily B member 1	Homo sapiens	138-152
1692728-2	1990	With chloroquine treatment of virus-infected cells, significant size reduction of the cell- and virus-associated surface glycoproteins, gp90 of REV-A and gp120 of HIV-1, was observed.	Chloroquine	5-16	Rev	Human immunodeficiency virus 1	144-147
2109681-3	1990	PA secretion at high [Ca], like that of PTH, was increased by treatment of cells with chloroquine and/or 3-methyladenine.	Chloroquine	86-97	parathyroid hormone	Bos taurus	40-43
2323395-0	1990	Plasmodium chabaudi: in vivo effects of Ca2+ antagonists on chloroquine-resistant and chloroquine-sensitive parasites.	Chloroquine	60-71	carbonic anhydrase 2	Mus musculus	40-43
2323395-7	1990	These results indicate that Ca2+ antagonists increase the susceptibility to chloroquine in a sensitive line of P. chabaudi and reverse chloroquine resistance in a resistant line.	Chloroquine	76-87	carbonic anhydrase 2	Mus musculus	28-31
2323395-7	1990	These results indicate that Ca2+ antagonists increase the susceptibility to chloroquine in a sensitive line of P. chabaudi and reverse chloroquine resistance in a resistant line.	Chloroquine	135-146	carbonic anhydrase 2	Mus musculus	28-31
1692728-2	1990	With chloroquine treatment of virus-infected cells, significant size reduction of the cell- and virus-associated surface glycoproteins, gp90 of REV-A and gp120 of HIV-1, was observed.	Chloroquine	5-16	Envelope surface glycoprotein gp160, precursor	Human immunodeficiency virus 1	154-159
1968359-5	1990	Chloroquine only marginally increased drug sensitivity in mdr1-transfected cells.	Chloroquine	0-11	ATP binding cassette subfamily B member 1	Homo sapiens	58-62
2157592-8	1990	The degradation of the uPA-PAI-1 complex is preceded by internalization and is inhibited by chloroquine, an inhibitor of lysosomal protein degradation.	Chloroquine	92-103	plasminogen activator, urokinase	Homo sapiens	23-26
2157592-8	1990	The degradation of the uPA-PAI-1 complex is preceded by internalization and is inhibited by chloroquine, an inhibitor of lysosomal protein degradation.	Chloroquine	92-103	serpin family E member 1	Homo sapiens	27-32
19210393-0	1990	Chloroquine Decreases Adrenocorticotrophin-Secretory Response to Corticotrophin-Releasing Factor but not to Vasopressin in Rat Pituitary Cells: Further Evidence for Differentially Responsive Subpopulations.	Chloroquine	0-11	corticotropin releasing hormone	Rattus norvegicus	65-96
2326500-0	1990	Chloroquine alters the processing of secretin in isolated rat pancreatic acinar cells.	Chloroquine	0-11	secretin	Rattus norvegicus	37-45
2326500-1	1990	In this study we considered the effect of chloroquine on the processing and intracellular distribution of internalized secretin radioligand in acinar cells.	Chloroquine	42-53	secretin	Rattus norvegicus	119-127
2326500-4	1990	Chloroquine also increased the amount of intact 125I-secretin radioligand within the cell as measured by rebinding to pancreatic plasma membranes.	Chloroquine	0-11	secretin	Rattus norvegicus	53-61
2326500-6	1990	To determine if chloroquine affected intracellular localization of the secretin radioligand, we measured the amount of radioactivity in soluble and particulate fractions of cell homogenates.	Chloroquine	16-27	secretin	Rattus norvegicus	71-79
2326500-8	1990	This study demonstrates that (1) chloroquine inhibits the intracellular degradation of secretin in acinar cells and (2) chloroquine alters intracellular localization of this peptide during processing.	Chloroquine	33-44	secretin	Rattus norvegicus	87-95
2326500-8	1990	This study demonstrates that (1) chloroquine inhibits the intracellular degradation of secretin in acinar cells and (2) chloroquine alters intracellular localization of this peptide during processing.	Chloroquine	120-131	secretin	Rattus norvegicus	87-95
33815808-8	2021	Aloe, azadirachtin, columbin, cirsilineol, nimbiol, nimbocinol and sage exhibited highest binding affinity and interacted with active sites of RdRp surpassing the ability of chloroquine, lamivudine, favipiravir and remdesivir to target the same.	Chloroquine	174-185	ORF1a polyprotein;ORF1ab polyprotein	Severe acute respiratory syndrome coronavirus 2	143-147
1689515-4	1990	The effect of chloroquine and acid elution in stripping HLA antigens is shown to be due to the removal of beta2-M, as only that component was detected in eluates from reactive RBCs.	Chloroquine	14-25	beta-2-microglobulin	Homo sapiens	106-113
2175857-7	1990	While release of the major secretory proteins, including chromogranin B, was inhibited with 200 microM chloroquine, chromogranin A was secreted upon stimulation of these cells.	Chloroquine	103-114	chromogranin B	Rattus norvegicus	57-71
2173587-4	1990	We now report that chloroquine inhibits NADH diferric transferrin reductase as well as the proton release stimulated by diferric transferrin from liver and HeLa cells.	Chloroquine	19-30	transferrin	Homo sapiens	54-65
2173587-4	1990	We now report that chloroquine inhibits NADH diferric transferrin reductase as well as the proton release stimulated by diferric transferrin from liver and HeLa cells.	Chloroquine	19-30	transferrin	Homo sapiens	129-140
2173587-6	1990	NADH diferric transferrin reductase of isolated rat liver plasma membrane is inhibited by chloroquine at concentrations similar to those required for inhibition of diferric transferrin reduction by whole cells.	Chloroquine	90-101	transferrin	Homo sapiens	14-25
2173587-6	1990	NADH diferric transferrin reductase of isolated rat liver plasma membrane is inhibited by chloroquine at concentrations similar to those required for inhibition of diferric transferrin reduction by whole cells.	Chloroquine	90-101	transferrin	Rattus norvegicus	173-184
2298825-15	1990	Likewise, chloroquine was an equipotent inhibitor when added either before or after mTNF regardless of the presence of cycloheximide.	Chloroquine	10-21	tumor necrosis factor	Mus musculus	84-88
33824292-7	2021	CHX-chase experiments showed that TA could facilitate RNF31 degradation, which was inhibited by the administration of chloroquine.	Chloroquine	118-129	ring finger protein 31	Homo sapiens	54-59
33765976-9	2021	Chloroquine (CQ) was used an endosomal escape enhancing agent to enhance endosomal escape of RGD4C-scFv.	Chloroquine	0-11	immunglobulin heavy chain variable region	Homo sapiens	99-103
33820956-8	2021	In the presence of chloroquine or spautin-1, inhibitors of autophagy, fenoldopam further increased ATG5 and LC3-II expression, indicating an important role of D5R in the positive regulation of autophagy.	Chloroquine	19-30	autophagy related 5	Homo sapiens	99-103
33820956-8	2021	In the presence of chloroquine or spautin-1, inhibitors of autophagy, fenoldopam further increased ATG5 and LC3-II expression, indicating an important role of D5R in the positive regulation of autophagy.	Chloroquine	19-30	microtubule associated protein 1 light chain 3 alpha	Homo sapiens	108-111
33820956-8	2021	In the presence of chloroquine or spautin-1, inhibitors of autophagy, fenoldopam further increased ATG5 and LC3-II expression, indicating an important role of D5R in the positive regulation of autophagy.	Chloroquine	19-30	dopamine receptor D5	Mus musculus	159-162
33765976-9	2021	Chloroquine (CQ) was used an endosomal escape enhancing agent to enhance endosomal escape of RGD4C-scFv.	Chloroquine	13-15	immunglobulin heavy chain variable region	Homo sapiens	99-103
33765976-15	2021	In addition, chloroquine (CQ) could increase endosomal escape and improve antitumor activity of RGD4C-scFv in SW480 cells.	Chloroquine	13-24	immunglobulin heavy chain variable region	Homo sapiens	102-106
33765976-15	2021	In addition, chloroquine (CQ) could increase endosomal escape and improve antitumor activity of RGD4C-scFv in SW480 cells.	Chloroquine	26-28	immunglobulin heavy chain variable region	Homo sapiens	102-106
33800526-6	2021	Co-treatment with the late-stage autophagy inhibitor chloroquine (CQ) and OxyR caused significantly higher microtubule-associated protein light chain 3 (LC3)-II protein levels and LC3 puncta counts, demonstrating that OxyR stimulated autophagic flux.	Chloroquine	53-64	microtubule-associated protein 1 light chain 3 alpha	Mus musculus	153-156
33766785-6	2021	This hepatoprotective effects was dependent on enhanced autophagy in Dj-1 knockout mice, because inhibition of autophagy by 3-Methyladenine (3-MA) and chloroquine (CQ) could reverse the protective effect on hepatic I/R injury in Dj-1 knockout mice CONCLUSION: Dj-1 deficiency in hepatocytes significantly enhanced mitochondrial accumulation and protein stability of PARKIN, which in turn promotes the onset of mitophagy resulting in elevated clearance of damaged mitochondria during I/R injury.	Chloroquine	151-162	Parkinson disease (autosomal recessive, early onset) 7	Mus musculus	69-73
33766785-6	2021	This hepatoprotective effects was dependent on enhanced autophagy in Dj-1 knockout mice, because inhibition of autophagy by 3-Methyladenine (3-MA) and chloroquine (CQ) could reverse the protective effect on hepatic I/R injury in Dj-1 knockout mice CONCLUSION: Dj-1 deficiency in hepatocytes significantly enhanced mitochondrial accumulation and protein stability of PARKIN, which in turn promotes the onset of mitophagy resulting in elevated clearance of damaged mitochondria during I/R injury.	Chloroquine	164-166	Parkinson disease (autosomal recessive, early onset) 7	Mus musculus	69-73
33766785-6	2021	This hepatoprotective effects was dependent on enhanced autophagy in Dj-1 knockout mice, because inhibition of autophagy by 3-Methyladenine (3-MA) and chloroquine (CQ) could reverse the protective effect on hepatic I/R injury in Dj-1 knockout mice CONCLUSION: Dj-1 deficiency in hepatocytes significantly enhanced mitochondrial accumulation and protein stability of PARKIN, which in turn promotes the onset of mitophagy resulting in elevated clearance of damaged mitochondria during I/R injury.	Chloroquine	164-166	Parkinson disease (autosomal recessive, early onset) 7	Mus musculus	229-233
33766785-6	2021	This hepatoprotective effects was dependent on enhanced autophagy in Dj-1 knockout mice, because inhibition of autophagy by 3-Methyladenine (3-MA) and chloroquine (CQ) could reverse the protective effect on hepatic I/R injury in Dj-1 knockout mice CONCLUSION: Dj-1 deficiency in hepatocytes significantly enhanced mitochondrial accumulation and protein stability of PARKIN, which in turn promotes the onset of mitophagy resulting in elevated clearance of damaged mitochondria during I/R injury.	Chloroquine	164-166	Parkinson disease (autosomal recessive, early onset) 7	Mus musculus	229-233
33799790-0	2021	Tioconazole and Chloroquine Act Synergistically to Combat Doxorubicin-Induced Toxicity via Inactivation of PI3K/AKT/mTOR Signaling Mediated ROS-Dependent Apoptosis and Autophagic Flux Inhibition in MCF-7 Breast Cancer Cells.	Chloroquine	16-27	AKT serine/threonine kinase 1	Homo sapiens	112-115
33799790-0	2021	Tioconazole and Chloroquine Act Synergistically to Combat Doxorubicin-Induced Toxicity via Inactivation of PI3K/AKT/mTOR Signaling Mediated ROS-Dependent Apoptosis and Autophagic Flux Inhibition in MCF-7 Breast Cancer Cells.	Chloroquine	16-27	mechanistic target of rapamycin kinase	Homo sapiens	116-120
33799790-5	2021	Molecular docking revealed that chloroquine (CQ) and TIC could be potential PI3K and ATG4B pathway inhibitors.	Chloroquine	32-43	autophagy related 4B cysteine peptidase	Homo sapiens	85-90
33799790-5	2021	Molecular docking revealed that chloroquine (CQ) and TIC could be potential PI3K and ATG4B pathway inhibitors.	Chloroquine	45-47	autophagy related 4B cysteine peptidase	Homo sapiens	85-90
33799790-8	2021	Additionally, CQ and/or TIC combination therapy with DOX exerts its activity on the redox balance of cancer cells mediated ROS-dependent apoptosis induction achieved by GPX3 suppression.	Chloroquine	14-16	glutathione peroxidase 3	Homo sapiens	169-173
33799790-11	2021	These results suggest CQ and/or TIC combination with DOX could act as effective cocktail therapy targeting autophagy and PI3K/AKT/mTOR pathways in MCF-7 breast cancer cells and hence, sensitizes cancer cells to doxorubicin treatment and combat its toxicity.	Chloroquine	22-24	AKT serine/threonine kinase 1	Homo sapiens	126-129
33799790-11	2021	These results suggest CQ and/or TIC combination with DOX could act as effective cocktail therapy targeting autophagy and PI3K/AKT/mTOR pathways in MCF-7 breast cancer cells and hence, sensitizes cancer cells to doxorubicin treatment and combat its toxicity.	Chloroquine	22-24	mechanistic target of rapamycin kinase	Homo sapiens	130-134
33805935-2	2021	Screening of the Harbor Branch enriched fraction library against the Plasmodium falciparum chloroquine-resistant strain (Dd2) followed by bioassay-guided fractionation led to the identification of two potent antiplasmodials; a novel diterpene designated as bebrycin A (1) and the known C21 degraded terpene nitenin (2).	Chloroquine	91-102	aldo-keto reductase family 1 member C2	Homo sapiens	121-124
33800526-7	2021	We also found that OxyR significantly reduced the levels of the autophagy substrate p62/SQSTM1, and p62 levels were significantly augmented by co-treatment with OxyR and CQ, because of the impaired deficiency of p62 in autolysosome.	Chloroquine	170-172	sequestosome 1	Mus musculus	84-87
33800526-7	2021	We also found that OxyR significantly reduced the levels of the autophagy substrate p62/SQSTM1, and p62 levels were significantly augmented by co-treatment with OxyR and CQ, because of the impaired deficiency of p62 in autolysosome.	Chloroquine	170-172	sequestosome 1	Mus musculus	88-94
33800526-7	2021	We also found that OxyR significantly reduced the levels of the autophagy substrate p62/SQSTM1, and p62 levels were significantly augmented by co-treatment with OxyR and CQ, because of the impaired deficiency of p62 in autolysosome.	Chloroquine	170-172	sequestosome 1	Mus musculus	100-103
33800526-7	2021	We also found that OxyR significantly reduced the levels of the autophagy substrate p62/SQSTM1, and p62 levels were significantly augmented by co-treatment with OxyR and CQ, because of the impaired deficiency of p62 in autolysosome.	Chloroquine	170-172	sequestosome 1	Mus musculus	100-103
33800526-6	2021	Co-treatment with the late-stage autophagy inhibitor chloroquine (CQ) and OxyR caused significantly higher microtubule-associated protein light chain 3 (LC3)-II protein levels and LC3 puncta counts, demonstrating that OxyR stimulated autophagic flux.	Chloroquine	53-64	microtubule-associated protein 1 light chain 3 alpha	Mus musculus	180-183
33800526-6	2021	Co-treatment with the late-stage autophagy inhibitor chloroquine (CQ) and OxyR caused significantly higher microtubule-associated protein light chain 3 (LC3)-II protein levels and LC3 puncta counts, demonstrating that OxyR stimulated autophagic flux.	Chloroquine	66-68	microtubule-associated protein 1 light chain 3 alpha	Mus musculus	153-156
33800526-6	2021	Co-treatment with the late-stage autophagy inhibitor chloroquine (CQ) and OxyR caused significantly higher microtubule-associated protein light chain 3 (LC3)-II protein levels and LC3 puncta counts, demonstrating that OxyR stimulated autophagic flux.	Chloroquine	66-68	microtubule-associated protein 1 light chain 3 alpha	Mus musculus	180-183
34729910-0	2022	Investigating of interactions between chloroquine/hydroxychloroquine and their single enantiomers and angiotensin-converting enzyme 2 by a cell membrane chromatography method.	Chloroquine	38-49	angiotensin converting enzyme 2	Homo sapiens	102-133
26327112-9	2015	Treatment of tongue sole with the imidazoquinoline compound R848 (TLR7 activator) and the endosomal acidification inhibitor chloroquine (TLR7 inhibitor) caused enhanced and reduced resistance against bacterial infection respectively.	Chloroquine	124-135	toll-like receptor 7	Cynoglossus semilaevis	137-141
34713488-0	2022	THE EFFECTS OF AUTOPHAGY INHIBITION BY CHLOROQUINE ON HEPATIC STELLATE CELL ACTIVATION IN CCl4 -INDUCED ACUTE LIVER INJURY MOUSE MODEL.	Chloroquine	39-50	chemokine (C-C motif) ligand 4	Mus musculus	90-94
34713488-6	2022	RESULTS: In vivo, CQ attenuates CCl4 -induced acute liver damage as evidenced by: 1) the reduction of liver enlargement, 2) the reduction of liver swelling and necrosis also supported by a certain decrease of circulating transaminases level, 3) the reduction of liver fibrosis evaluated by collagen deposition and alpha-sma protein expression.	Chloroquine	18-20	chemokine (C-C motif) ligand 4	Mus musculus	32-36
34713488-6	2022	RESULTS: In vivo, CQ attenuates CCl4 -induced acute liver damage as evidenced by: 1) the reduction of liver enlargement, 2) the reduction of liver swelling and necrosis also supported by a certain decrease of circulating transaminases level, 3) the reduction of liver fibrosis evaluated by collagen deposition and alpha-sma protein expression.	Chloroquine	18-20	actin alpha 2, smooth muscle, aorta	Mus musculus	314-323
34713488-7	2022	In HSCs isolated from CQ treated group, we observed the inhibition of autophagy proved by the increase in p62 protein and the decrease of lc3 protein.	Chloroquine	22-24	nucleoporin 62	Mus musculus	106-109
34713488-7	2022	In HSCs isolated from CQ treated group, we observed the inhibition of autophagy proved by the increase in p62 protein and the decrease of lc3 protein.	Chloroquine	22-24	microtubule-associated protein 1 light chain 3 alpha	Mus musculus	138-141
34713488-8	2022	In addition, CQ reduced the expression of the HSCs activation markers alpha-sma/collagen-I and downregulated the expression of the proliferative marker ki67.	Chloroquine	13-15	antigen identified by monoclonal antibody Ki 67	Mus musculus	152-156
34863979-8	2022	Knockdown of SIDT2 or pretreatment with chloroquine (a lysosome inhibitor) reduced DTX-induced NOX4 and TNF-alpha expression and mitigated JNK-mediated HuR phosphorylation.	Chloroquine	40-51	NADPH oxidase 4	Homo sapiens	95-99
34863979-8	2022	Knockdown of SIDT2 or pretreatment with chloroquine (a lysosome inhibitor) reduced DTX-induced NOX4 and TNF-alpha expression and mitigated JNK-mediated HuR phosphorylation.	Chloroquine	40-51	tumor necrosis factor	Homo sapiens	104-113
34863979-8	2022	Knockdown of SIDT2 or pretreatment with chloroquine (a lysosome inhibitor) reduced DTX-induced NOX4 and TNF-alpha expression and mitigated JNK-mediated HuR phosphorylation.	Chloroquine	40-51	mitogen-activated protein kinase 8	Homo sapiens	139-142
34863979-8	2022	Knockdown of SIDT2 or pretreatment with chloroquine (a lysosome inhibitor) reduced DTX-induced NOX4 and TNF-alpha expression and mitigated JNK-mediated HuR phosphorylation.	Chloroquine	40-51	ELAV like RNA binding protein 1	Homo sapiens	152-155
34729910-5	2022	R-chloroquine showed better ACE2 receptor binding ability compared to S-chloroquine/chloroquine (racemate).	Chloroquine	70-83	angiotensin converting enzyme 2	Homo sapiens	28-32
34729910-5	2022	R-chloroquine showed better ACE2 receptor binding ability compared to S-chloroquine/chloroquine (racemate).	Chloroquine	84-95	angiotensin converting enzyme 2	Homo sapiens	28-32
34729910-9	2022	In conclusion, R-chloroquine showed better ACE2 receptor binding ability and inhibitory effects compared to S-chloroquine/chloroquine (racemate).	Chloroquine	108-121	angiotensin converting enzyme 2	Homo sapiens	43-47
34729910-9	2022	In conclusion, R-chloroquine showed better ACE2 receptor binding ability and inhibitory effects compared to S-chloroquine/chloroquine (racemate).	Chloroquine	122-133	angiotensin converting enzyme 2	Homo sapiens	43-47
34897628-12	2022	Chloroquine was used to treat these injured endothelial cells overexpressing miR-124-3p, and endothelial cell apoptosis was assessed via TUNEL+CD31 immunofluorescence staining.	Chloroquine	0-11	microRNA 124a-3	Mus musculus	77-87
34657240-4	2022	And we found that when cells were treated with different vesicles uptake inhibitors (chlorpromazine, methyl-beta-cyclodextrin (MbetaCD), cytochalasin D, chloroquine and heparin) and heparinase (HSPE), only heparin and HSPE counteracted the uptake enhancement effect caused by DAL-1/4.1B.	Chloroquine	153-164	erythrocyte membrane protein band 4.1 like 3	Homo sapiens	282-286
34825483-9	2022	Chloroquine, compound D, and tamoxifen were employed as the inhibitor for autophagy and AMPK, estrogen receptors (ERs) modulator, respectively.	Chloroquine	0-11	protein kinase AMP-activated catalytic subunit alpha 2	Homo sapiens	88-92
34957557-11	2021	When autophagy was inhibited by CQ, the positive effects of Sirt1 were attenuated.	Chloroquine	32-34	sirtuin 1	Mus musculus	60-65
34658419-9	2021	For instance, the binding affinity of ligand and complex was found to be better than docking results of chloroquine (-6.293 kcal/mol), hydroxychloroquine (-5.573 kcal/mol) and remdesivir (-6.352 kcal/mol) with Mpro protein.	Chloroquine	104-115	NEWENTRY	Severe acute respiratory syndrome-related coronavirus	210-214
34907164-6	2021	Furthermore, LUC7L2 knockdown in combination with autophagy inhibitor, chloroquine (CQ), resulted in more NPC-radioresistant cell death.	Chloroquine	71-82	LUC7 like 2, pre-mRNA splicing factor	Homo sapiens	13-19
34907164-6	2021	Furthermore, LUC7L2 knockdown in combination with autophagy inhibitor, chloroquine (CQ), resulted in more NPC-radioresistant cell death.	Chloroquine	84-86	LUC7 like 2, pre-mRNA splicing factor	Homo sapiens	13-19
34813288-7	2021	Our results showed that 50 mug CQ/mg FM decreased MX1 expression and IFN-alpha production after TLR activation with either synthetic nucleic acid agonists or immune complex-rich sera from SLE patients.	Chloroquine	31-33	MX dynamin like GTPase 1	Homo sapiens	50-53
34813288-7	2021	Our results showed that 50 mug CQ/mg FM decreased MX1 expression and IFN-alpha production after TLR activation with either synthetic nucleic acid agonists or immune complex-rich sera from SLE patients.	Chloroquine	31-33	interferon alpha 1	Homo sapiens	69-78
34653791-5	2022	Transcriptome profiling identified 1611 differentially expressed genes (DEGs) (776 up- and 835 down-regulated) (20 muM CQ vs. DMSO), mainly involved in MAPK cascade, cell proliferation/apoptosis, HIF-1, PI3K-Akt and lysosome signaling pathways.	Chloroquine	119-121	AKT serine/threonine kinase 1	Homo sapiens	208-211
34986325-6	2022	Moreover, Nmb in MRGPRA3+ afferents and NMBR+ DH neurons are required for chloroquine-induced scratching.	Chloroquine	74-85	neuromedin B	Mus musculus	10-13
34986325-6	2022	Moreover, Nmb in MRGPRA3+ afferents and NMBR+ DH neurons are required for chloroquine-induced scratching.	Chloroquine	74-85	MAS-related GPR, member A3	Mus musculus	17-24
34986325-6	2022	Moreover, Nmb in MRGPRA3+ afferents and NMBR+ DH neurons are required for chloroquine-induced scratching.	Chloroquine	74-85	neuromedin B receptor	Mus musculus	40-44
34923568-7	2021	Chloroquine experiment, immunofluorescence autophagosome, and lysosome fusion assay, and Ad-mcherry-GFP-LC3B further indicated that, after Sidt2 deletion, the production of autophagosomes did not increase, but the fusion of autophagosomes and lysosomes and the degradation of autophagolysosomes were impaired.	Chloroquine	0-11	SID1 transmembrane family, member 2	Mus musculus	139-144
34785211-5	2021	We found hyperpolarizing shifts of tens of mV, larger for chloroquine, in the voltage-dependent activation but not inactivation, as well as a voltage-dependent block of hERG current, larger at positive potentials.	Chloroquine	58-69	ETS transcription factor ERG	Homo sapiens	169-173
34785211-6	2021	We also found inhibitory effects on peak and late INa and on IK1, with IC50 of tens of muM and larger for chloroquine.	Chloroquine	106-117	IKAROS family zinc finger 1	Homo sapiens	61-64
34897628-12	2022	Chloroquine was used to treat these injured endothelial cells overexpressing miR-124-3p, and endothelial cell apoptosis was assessed via TUNEL+CD31 immunofluorescence staining.	Chloroquine	0-11	platelet/endothelial cell adhesion molecule 1	Mus musculus	143-147
34774530-6	2021	Micromolar concentrations of several DIF derivatives strongly suppressed the growth of the four laboratory strains, including strains that exhibited resistance to chloroquine and artemisinin, as well as strains that were susceptible to these drugs.	Chloroquine	163-174	tumor necrosis factor	Homo sapiens	37-40
34873177-10	2021	Subsequent administration of chloroquine markedly attenuated the detrimental effects of CRH on IBD severity and inflammatory reactions via inhibition of autophagy.	Chloroquine	29-40	corticotropin releasing hormone	Mus musculus	88-91
34917923-5	2022	Moreover, although chloroquine and ivermectin effectively inhibited the expression of LC3B in the nucleus, chloroquine specifically maintained the performance of LC3B in cytoplasm, thereby contributing to the differentiation of ciliated cells and subsequent improvement in the beating functions of the cilia, whereas ivermectin only facilitated differentiation of goblet cells.	Chloroquine	19-30	microtubule associated protein 1 light chain 3 beta	Homo sapiens	86-90
34917923-5	2022	Moreover, although chloroquine and ivermectin effectively inhibited the expression of LC3B in the nucleus, chloroquine specifically maintained the performance of LC3B in cytoplasm, thereby contributing to the differentiation of ciliated cells and subsequent improvement in the beating functions of the cilia, whereas ivermectin only facilitated differentiation of goblet cells.	Chloroquine	107-118	microtubule associated protein 1 light chain 3 beta	Homo sapiens	162-166
33820486-7	2021	Pretreating cells with CQ, but not DEX, attenuated poly IC-induced MCP-1 and CCL5 expression; however, HCQ pretreatment attenuated poly IC-induced CCL5, but not MCP-1.	Chloroquine	23-25	C-C motif chemokine ligand 2	Homo sapiens	67-72
34302047-8	2021	The high prevalence of variants in the G6PD gene found in this analysis suggests that it may be a significant interaction factor in clinical trials of chloroquine and hydroxychloroquine for treatment of COVID-19 in Africans.	Chloroquine	151-162	glucose-6-phosphate dehydrogenase	Homo sapiens	39-43
33820486-7	2021	Pretreating cells with CQ, but not DEX, attenuated poly IC-induced MCP-1 and CCL5 expression; however, HCQ pretreatment attenuated poly IC-induced CCL5, but not MCP-1.	Chloroquine	23-25	C-C motif chemokine ligand 5	Homo sapiens	77-81
33820486-7	2021	Pretreating cells with CQ, but not DEX, attenuated poly IC-induced MCP-1 and CCL5 expression; however, HCQ pretreatment attenuated poly IC-induced CCL5, but not MCP-1.	Chloroquine	23-25	C-C motif chemokine ligand 5	Homo sapiens	147-151
33820486-10	2021	Interestingly, CQ is a rather powerful inhibitor compared with HCQ on TLR3 signaling-induced chemokine expression in GECs.	Chloroquine	15-17	toll like receptor 3	Homo sapiens	70-74
34852220-3	2021	CHK1 inhibition also activates ERK and AMPK and increases autophagy, providing a mechanistic basis for increased efficacy of concurrent CHK1 and ERK inhibition and/or autophagy inhibition with chloroquine.	Chloroquine	193-204	checkpoint kinase 1	Homo sapiens	0-4
34852220-3	2021	CHK1 inhibition also activates ERK and AMPK and increases autophagy, providing a mechanistic basis for increased efficacy of concurrent CHK1 and ERK inhibition and/or autophagy inhibition with chloroquine.	Chloroquine	193-204	mitogen-activated protein kinase 1	Homo sapiens	31-34
34852220-3	2021	CHK1 inhibition also activates ERK and AMPK and increases autophagy, providing a mechanistic basis for increased efficacy of concurrent CHK1 and ERK inhibition and/or autophagy inhibition with chloroquine.	Chloroquine	193-204	protein kinase AMP-activated catalytic subunit alpha 1	Homo sapiens	39-43
34842499-8	2021	For instance, the binding affinity of complex (Ni(L)(DMF))(1) is found to be better than that of recently docking results of anti-SARS-CoV-2 drugs like chloroquine (-6.293 kcal/mol), hydroxychloroquine (-5.573 kcal/mol) and remdesivir (-6.352 kcal/mol) when targeted to the active-site of SARS-CoV-2 Mpro.	Chloroquine	152-163	NEWENTRY	Severe acute respiratory syndrome-related coronavirus	300-304
34884765-9	2021	Moreover, primaquine and chloroquine induce the apoptosis of breast cancer cells through c-Myc/Bcl-2 downregulation, induce early endosome damage and reduce nEGFR levels, and induce apoptosis in breast cancer through nEGFR/Stat3-dependent c-Myc downregulation.	Chloroquine	25-36	MYC proto-oncogene, bHLH transcription factor	Homo sapiens	89-94
34884765-9	2021	Moreover, primaquine and chloroquine induce the apoptosis of breast cancer cells through c-Myc/Bcl-2 downregulation, induce early endosome damage and reduce nEGFR levels, and induce apoptosis in breast cancer through nEGFR/Stat3-dependent c-Myc downregulation.	Chloroquine	25-36	BCL2 apoptosis regulator	Homo sapiens	95-100
34884765-9	2021	Moreover, primaquine and chloroquine induce the apoptosis of breast cancer cells through c-Myc/Bcl-2 downregulation, induce early endosome damage and reduce nEGFR levels, and induce apoptosis in breast cancer through nEGFR/Stat3-dependent c-Myc downregulation.	Chloroquine	25-36	signal transducer and activator of transcription 3	Homo sapiens	223-228
34884765-9	2021	Moreover, primaquine and chloroquine induce the apoptosis of breast cancer cells through c-Myc/Bcl-2 downregulation, induce early endosome damage and reduce nEGFR levels, and induce apoptosis in breast cancer through nEGFR/Stat3-dependent c-Myc downregulation.	Chloroquine	25-36	MYC proto-oncogene, bHLH transcription factor	Homo sapiens	239-244
34884765-10	2021	Our study of primaquine and chloroquine provides a rationale for targeting EGFR signaling components in the treatment of breast cancer.	Chloroquine	28-39	epidermal growth factor receptor	Homo sapiens	75-79
34454753-9	2021	Treatment with CQ led to overactivation of NF-kappaB signaling and NLRP3 inflammasome.	Chloroquine	15-17	NLR family pyrin domain containing 3	Bos taurus	67-72
34837219-6	2022	KEY RESULTS: Chloroquine and hydroxychloroquine blocked hERG with IC50 of 1.47+-0.07 muM and 3.78+-0.17 muM respectively, indicating proarrhythmic risk at concentrations effective against SARS-CoV-2 in vitro.	Chloroquine	13-24	ETS transcription factor ERG	Homo sapiens	56-60
34837219-8	2022	Acidosis significantly reduced potency of all drugs, whereas increased temperature decreased potency of chloroquine and hydroxychloroquine against hERG but increased potency for azithromycin.	Chloroquine	104-115	ETS transcription factor ERG	Homo sapiens	147-151
34825320-9	2022	Meanwhile, q-PCR results showed that the mRNA levels of collagen I, collagen III and alpha-SMA decreased in LX-2 cells after treatment with autophagy inhibitor chloroquine, whereas they increased when combination with CsESPs.	Chloroquine	160-171	actin alpha 1, skeletal muscle	Homo sapiens	85-94
34555396-6	2021	Therefore, 5-HT is involved in the attenuating effects of milnacipran and mirtazapine on CQ- and histamine-induced scratching events, and 5-HT7 and 5-HT3 receptors play different roles in pruriceptive processing induced by histamine or CQ.	Chloroquine	236-238	5-hydroxytryptamine (serotonin) receptor 7	Mus musculus	138-163
34771150-0	2021	Chloroquine Potentiates the Anticancer Effect of Pterostilbene on Pancreatic Cancer by Inhibiting Autophagy and Downregulating the RAGE/STAT3 Pathway.	Chloroquine	0-11	advanced glycosylation end-product specific receptor	Homo sapiens	131-135
34771150-0	2021	Chloroquine Potentiates the Anticancer Effect of Pterostilbene on Pancreatic Cancer by Inhibiting Autophagy and Downregulating the RAGE/STAT3 Pathway.	Chloroquine	0-11	signal transducer and activator of transcription 3	Homo sapiens	136-141
34771150-6	2021	The results indicated that pterostilbene combined with chloroquine significantly inhibited autophagy, decreased cell viability, and sensitized the cells to pterostilbene-induced apoptosis via downregulation of the RAGE/STAT3 and protein kinase B (AKT)/mammalian target of rapamycin (mTOR) pathways in PDAC cells.	Chloroquine	55-66	advanced glycosylation end-product specific receptor	Homo sapiens	214-218
34771150-6	2021	The results indicated that pterostilbene combined with chloroquine significantly inhibited autophagy, decreased cell viability, and sensitized the cells to pterostilbene-induced apoptosis via downregulation of the RAGE/STAT3 and protein kinase B (AKT)/mammalian target of rapamycin (mTOR) pathways in PDAC cells.	Chloroquine	55-66	signal transducer and activator of transcription 3	Homo sapiens	219-224
34771150-6	2021	The results indicated that pterostilbene combined with chloroquine significantly inhibited autophagy, decreased cell viability, and sensitized the cells to pterostilbene-induced apoptosis via downregulation of the RAGE/STAT3 and protein kinase B (AKT)/mammalian target of rapamycin (mTOR) pathways in PDAC cells.	Chloroquine	55-66	protein tyrosine kinase 2 beta	Homo sapiens	229-245
34771150-6	2021	The results indicated that pterostilbene combined with chloroquine significantly inhibited autophagy, decreased cell viability, and sensitized the cells to pterostilbene-induced apoptosis via downregulation of the RAGE/STAT3 and protein kinase B (AKT)/mammalian target of rapamycin (mTOR) pathways in PDAC cells.	Chloroquine	55-66	AKT serine/threonine kinase 1	Homo sapiens	247-250
34771150-6	2021	The results indicated that pterostilbene combined with chloroquine significantly inhibited autophagy, decreased cell viability, and sensitized the cells to pterostilbene-induced apoptosis via downregulation of the RAGE/STAT3 and protein kinase B (AKT)/mammalian target of rapamycin (mTOR) pathways in PDAC cells.	Chloroquine	55-66	mechanistic target of rapamycin kinase	Homo sapiens	252-281
34771150-6	2021	The results indicated that pterostilbene combined with chloroquine significantly inhibited autophagy, decreased cell viability, and sensitized the cells to pterostilbene-induced apoptosis via downregulation of the RAGE/STAT3 and protein kinase B (AKT)/mammalian target of rapamycin (mTOR) pathways in PDAC cells.	Chloroquine	55-66	mechanistic target of rapamycin kinase	Homo sapiens	283-287
34771150-7	2021	The results of the orthotopic animal model showed that pterostilbene combined with chloroquine significantly inhibited pancreatic cancer growth, delayed tumor quadrupling times, and inhibited autophagy and STAT3 in pancreatic tumors.	Chloroquine	83-94	signal transducer and activator of transcription 3	Homo sapiens	206-211
34771150-8	2021	In summary, the present study suggested the novel therapeutic strategy of pterostilbene combined with chloroquine against the growth of pancreatic ductal adenocarcinoma by inhibiting autophagy and downregulating the RAGE/STAT3 signaling pathways.	Chloroquine	102-113	advanced glycosylation end-product specific receptor	Homo sapiens	216-220
34771150-8	2021	In summary, the present study suggested the novel therapeutic strategy of pterostilbene combined with chloroquine against the growth of pancreatic ductal adenocarcinoma by inhibiting autophagy and downregulating the RAGE/STAT3 signaling pathways.	Chloroquine	102-113	signal transducer and activator of transcription 3	Homo sapiens	221-226
34278709-4	2021	In this study, CQ and HCQ treatments inhibited the migration and invasion of two BC cell types (5637 and T24) through expression modulation of matrix metalloproteinase-2 (MMP-2), which belongs to the matrix MMP family and is a key mediator of cancer progression.	Chloroquine	15-17	matrix metallopeptidase 2	Homo sapiens	143-169
34278709-4	2021	In this study, CQ and HCQ treatments inhibited the migration and invasion of two BC cell types (5637 and T24) through expression modulation of matrix metalloproteinase-2 (MMP-2), which belongs to the matrix MMP family and is a key mediator of cancer progression.	Chloroquine	15-17	matrix metallopeptidase 2	Homo sapiens	171-176
34278709-4	2021	In this study, CQ and HCQ treatments inhibited the migration and invasion of two BC cell types (5637 and T24) through expression modulation of matrix metalloproteinase-2 (MMP-2), which belongs to the matrix MMP family and is a key mediator of cancer progression.	Chloroquine	15-17	matrix metallopeptidase 2	Homo sapiens	207-210
34278709-6	2021	In conclusion, our research demonstrated that CQ and HCQ regulated cell motility in BC through MMP-2 downregulation by targeting autophagy functions, providing a novel therapeutic strategy for BC treatment.	Chloroquine	46-48	matrix metallopeptidase 2	Homo sapiens	95-100
34813005-0	2021	Chloroquine Induces ROS-mediated Macrophage Migration Inhibitory Factor Secretion and Epithelial to Mesenchymal Transition in ER-positive Breast Cancer Cell Lines.	Chloroquine	0-11	macrophage migration inhibitory factor	Homo sapiens	33-71
34813005-0	2021	Chloroquine Induces ROS-mediated Macrophage Migration Inhibitory Factor Secretion and Epithelial to Mesenchymal Transition in ER-positive Breast Cancer Cell Lines.	Chloroquine	0-11	epiregulin	Homo sapiens	126-128
34278709-0	2021	Attenuation of chloroquine and hydroxychloroquine on the invasive potential of bladder cancer through targeting matrix metalloproteinase 2 expression.	Chloroquine	15-26	matrix metallopeptidase 2	Homo sapiens	112-138
34561749-3	2021	The pfcrt 76 T molecular marker for CQ resistance was detected in 66.4% (156/235) of the isolates, while the K76 CQ-sensitive wild type was detected in 33.6%.	Chloroquine	113-115	keratin 76	Homo sapiens	109-112
34339727-9	2021	When autophagy was inhibited by 3-MA or CQ, confirmed by corresponding changes of these indicators of autophagy, cellular proliferation, migration and tube formation of RF/6A cells were weakened by AGGF1 treatment when compared with that of AGGF1 treatment alone.	Chloroquine	40-42	angiogenic factor with G patch and FHA domains 1	Macaca mulatta	198-203
34339727-9	2021	When autophagy was inhibited by 3-MA or CQ, confirmed by corresponding changes of these indicators of autophagy, cellular proliferation, migration and tube formation of RF/6A cells were weakened by AGGF1 treatment when compared with that of AGGF1 treatment alone.	Chloroquine	40-42	angiogenic factor with G patch and FHA domains 1	Macaca mulatta	241-246
34260096-5	2021	The degradation of gB by Nedd4 was inhibited by proteasome inhibitor MG132, lysosome inhibitor chloroquine, and the co-expression of UL42 proteins.	Chloroquine	95-106	NEDD4 E3 ubiquitin protein ligase	Homo sapiens	25-30
34520793-5	2021	Our results showed that DM enhanced autophagy in association with an accumulation of autophagosomes and increase in the levels of autophagy markers LC3-II/LC3-I ratio and p62 which were much elevated in the presence of lysosomal inhibitors bafilomycin A1 and chloroquine.	Chloroquine	259-270	nucleoporin 62	Homo sapiens	171-174
34768959-11	2021	DOX suppressed cell proliferation and increased the autophagy protein LC3, while chloroquine enhanced LC3 accumulation and suppressed cell death.	Chloroquine	81-92	microtubule associated protein 1 light chain 3 alpha	Homo sapiens	102-105
34708340-11	2022	Furthermore, CQ and LY294002 neutralized the effects of overexpressed ACE2 on neuronal apoptosis, cerebral edema, and neurological deficits in SAH mice.	Chloroquine	13-15	angiotensin I converting enzyme (peptidyl-dipeptidase A) 2	Mus musculus	70-74
34567221-13	2021	Pretreating cells with chloroquine (CQ) to block autophagic flux could diminish the pharmacological effect of Idebenone to clear alpha-synuclein.	Chloroquine	23-34	synuclein alpha	Homo sapiens	129-144
34746149-6	2021	Our results also showed that administration of FGF21 upregulated autophagy, and the beneficial effects of FGF21 were reversed by the well-known autophagy inhibitor chloroquine (CQ), indicating that FGF21-activated autophagy played a central role in the treatment.	Chloroquine	164-175	fibroblast growth factor 21	Danio rerio	47-52
34746149-6	2021	Our results also showed that administration of FGF21 upregulated autophagy, and the beneficial effects of FGF21 were reversed by the well-known autophagy inhibitor chloroquine (CQ), indicating that FGF21-activated autophagy played a central role in the treatment.	Chloroquine	164-175	fibroblast growth factor 21	Danio rerio	106-111
34746149-6	2021	Our results also showed that administration of FGF21 upregulated autophagy, and the beneficial effects of FGF21 were reversed by the well-known autophagy inhibitor chloroquine (CQ), indicating that FGF21-activated autophagy played a central role in the treatment.	Chloroquine	164-175	fibroblast growth factor 21	Danio rerio	198-203
34746149-6	2021	Our results also showed that administration of FGF21 upregulated autophagy, and the beneficial effects of FGF21 were reversed by the well-known autophagy inhibitor chloroquine (CQ), indicating that FGF21-activated autophagy played a central role in the treatment.	Chloroquine	177-179	fibroblast growth factor 21	Danio rerio	47-52
34746149-6	2021	Our results also showed that administration of FGF21 upregulated autophagy, and the beneficial effects of FGF21 were reversed by the well-known autophagy inhibitor chloroquine (CQ), indicating that FGF21-activated autophagy played a central role in the treatment.	Chloroquine	177-179	fibroblast growth factor 21	Danio rerio	106-111
34746149-6	2021	Our results also showed that administration of FGF21 upregulated autophagy, and the beneficial effects of FGF21 were reversed by the well-known autophagy inhibitor chloroquine (CQ), indicating that FGF21-activated autophagy played a central role in the treatment.	Chloroquine	177-179	fibroblast growth factor 21	Danio rerio	198-203
34516972-5	2021	MTTP was synergistically accumulated after Cd exposure or treated with proteasome inhibitor MG132 and lysosome inhibitor chloroquine (CQ), which suggested the Cd increased MTTP protein stability by inhibiting both the proteasome and the lysosomal protein degradation pathways.	Chloroquine	121-132	microsomal triglyceride transfer protein	Homo sapiens	0-4
34516972-5	2021	MTTP was synergistically accumulated after Cd exposure or treated with proteasome inhibitor MG132 and lysosome inhibitor chloroquine (CQ), which suggested the Cd increased MTTP protein stability by inhibiting both the proteasome and the lysosomal protein degradation pathways.	Chloroquine	121-132	microsomal triglyceride transfer protein	Homo sapiens	172-176
34516972-5	2021	MTTP was synergistically accumulated after Cd exposure or treated with proteasome inhibitor MG132 and lysosome inhibitor chloroquine (CQ), which suggested the Cd increased MTTP protein stability by inhibiting both the proteasome and the lysosomal protein degradation pathways.	Chloroquine	134-136	microsomal triglyceride transfer protein	Homo sapiens	0-4
34516972-5	2021	MTTP was synergistically accumulated after Cd exposure or treated with proteasome inhibitor MG132 and lysosome inhibitor chloroquine (CQ), which suggested the Cd increased MTTP protein stability by inhibiting both the proteasome and the lysosomal protein degradation pathways.	Chloroquine	134-136	microsomal triglyceride transfer protein	Homo sapiens	172-176
34556021-7	2021	In support, we further found that chloroquine (CQ) treatment abrogated calcitriol-induced autophagy and compromised Nrf2 activation with increased Keap1 accumulation and reduced expression of Nrf2-targeted genes.	Chloroquine	34-45	NFE2 like bZIP transcription factor 2	Homo sapiens	116-120
34556021-7	2021	In support, we further found that chloroquine (CQ) treatment abrogated calcitriol-induced autophagy and compromised Nrf2 activation with increased Keap1 accumulation and reduced expression of Nrf2-targeted genes.	Chloroquine	34-45	kelch like ECH associated protein 1	Homo sapiens	147-152
34556021-7	2021	In support, we further found that chloroquine (CQ) treatment abrogated calcitriol-induced autophagy and compromised Nrf2 activation with increased Keap1 accumulation and reduced expression of Nrf2-targeted genes.	Chloroquine	34-45	NFE2 like bZIP transcription factor 2	Homo sapiens	192-196
34556021-7	2021	In support, we further found that chloroquine (CQ) treatment abrogated calcitriol-induced autophagy and compromised Nrf2 activation with increased Keap1 accumulation and reduced expression of Nrf2-targeted genes.	Chloroquine	47-49	NFE2 like bZIP transcription factor 2	Homo sapiens	116-120
34556021-7	2021	In support, we further found that chloroquine (CQ) treatment abrogated calcitriol-induced autophagy and compromised Nrf2 activation with increased Keap1 accumulation and reduced expression of Nrf2-targeted genes.	Chloroquine	47-49	kelch like ECH associated protein 1	Homo sapiens	147-152
34556021-7	2021	In support, we further found that chloroquine (CQ) treatment abrogated calcitriol-induced autophagy and compromised Nrf2 activation with increased Keap1 accumulation and reduced expression of Nrf2-targeted genes.	Chloroquine	47-49	NFE2 like bZIP transcription factor 2	Homo sapiens	192-196
34530854-9	2021	The protective effect of NRBF2 on ERS-associated neuroinflammation and oxidative stress after SAH was eliminated by treatment with CQ.	Chloroquine	131-133	nuclear receptor binding factor 2	Homo sapiens	25-30
34303662-4	2021	Moreover, chloroquine, an off labeled COVID-19 drug is able to induce DUSP1 and attenuate MAPK pathway; and is expected to improve sensitivity to steroid treatment.	Chloroquine	10-21	dual specificity phosphatase 1	Homo sapiens	70-75
34529881-7	2021	We further used chloroquine (CQ) to block autophagy and showed that suppressing either FOXO1 or autophagy abrogated the anti-inflammatory action of AVE.	Chloroquine	16-27	forkhead box O1	Mus musculus	87-92
34529881-9	2021	Cotreatment with AS1842856 or CQ all led to autophagic inhibition and thereby abolished Ang(1-7)-induced remission on NLRP3 inflammasome activation caused by LPS exposure, shifting the microglial polarization from M1 to M2 phenotype.	Chloroquine	30-32	angiogenin, ribonuclease, RNase A family, 5	Mus musculus	88-95
34529881-9	2021	Cotreatment with AS1842856 or CQ all led to autophagic inhibition and thereby abolished Ang(1-7)-induced remission on NLRP3 inflammasome activation caused by LPS exposure, shifting the microglial polarization from M1 to M2 phenotype.	Chloroquine	30-32	NLR family, pyrin domain containing 3	Mus musculus	118-123
34547132-6	2021	Notably, LGMDD2 mutation increase TNPO3 at the transcript and protein level in the Drosophila model Upregulated muscle autophagy observed in LGMDD2 patients was also confirmed in the fly model, in which the anti-autophagic drug chloroquine was able to rescue histologic and functional phenotypes.	Chloroquine	228-239	Transportin-Serine/Arginine rich	Drosophila melanogaster	34-39
34650437-4	2021	In the current study, we found that RANKL dramatically induced autophagy and osteoclastogenesis, inhibition of autophagy with chloroquine (CQ) markedly attenuates RANKL-induced osteoclastogenesis.	Chloroquine	126-137	TNF superfamily member 11	Homo sapiens	163-168
34650437-4	2021	In the current study, we found that RANKL dramatically induced autophagy and osteoclastogenesis, inhibition of autophagy with chloroquine (CQ) markedly attenuates RANKL-induced osteoclastogenesis.	Chloroquine	139-141	TNF superfamily member 11	Homo sapiens	163-168
34563224-10	2021	Inhibition of the lysosomes with chloroquine attenuates BMPR2 trafficking to the lysosome and cell death induced by BMPR2 inhibitors.	Chloroquine	33-44	bone morphogenetic protein receptor type 2	Homo sapiens	56-61
34563224-10	2021	Inhibition of the lysosomes with chloroquine attenuates BMPR2 trafficking to the lysosome and cell death induced by BMPR2 inhibitors.	Chloroquine	33-44	bone morphogenetic protein receptor type 2	Homo sapiens	116-121
34567221-13	2021	Pretreating cells with chloroquine (CQ) to block autophagic flux could diminish the pharmacological effect of Idebenone to clear alpha-synuclein.	Chloroquine	36-38	synuclein alpha	Homo sapiens	129-144
34510030-4	2021	These effects reflected caspase 3-mediated apoptosis and could be attenuated or abolished by inhibiting ROS production with N-acetyl-L-cysteine, inhibiting autophagy with chloroquine, or silencing ATG7 with targeted siRNA.	Chloroquine	171-182	caspase 3	Homo sapiens	24-33
34463093-4	2021	Here, we found that beta-lactoglobulin (beta-LG), alpha-lactalbumin (alpha-LA), bovine serum albumin (BSA), and lactoferrin (LF) in whey proteins were able to interact with CQ to form complexes as suggested by fluorescence resonance energy transfer (FRET) and molecular docking.	Chloroquine	173-175	lactalbumin alpha	Homo sapiens	50-67
34463093-4	2021	Here, we found that beta-lactoglobulin (beta-LG), alpha-lactalbumin (alpha-LA), bovine serum albumin (BSA), and lactoferrin (LF) in whey proteins were able to interact with CQ to form complexes as suggested by fluorescence resonance energy transfer (FRET) and molecular docking.	Chloroquine	173-175	albumin	Homo sapiens	87-100
34575683-9	2021	The activation of autophagy by everolimus decreased ESR1 by promoting p62 degradation, whereas autophagy inhibition with chloroquine increased ESR1 expression.	Chloroquine	121-132	estrogen receptor 1	Homo sapiens	143-147
34369083-5	2021	We further delineate that autophagy protects from PLK1/FGFR1 inhibitor cytotoxicity and that antagonizing the compensation mechanism by clinically approved chloroquine fully realizes the therapeutic potential of PLK1 and FGFR1 targeting therapy, producing potent and durable responses in KRAS-mutant patient-derived xenografts and a genetically engineered mouse model of Kras-induced lung adenocarcinoma.	Chloroquine	156-167	fibroblast growth factor receptor 1	Homo sapiens	55-60
34659548-8	2021	Additionally, autophagy was induced by BHGJT via the AMPK/mTORC1/ULK1 signaling pathway, and blocking autophagy with either chloroquine or a ULK1 inhibitor increased the killing efficiency of BHGJT in lung cancer cells.	Chloroquine	124-135	CREB regulated transcription coactivator 1	Mus musculus	58-64
34369083-5	2021	We further delineate that autophagy protects from PLK1/FGFR1 inhibitor cytotoxicity and that antagonizing the compensation mechanism by clinically approved chloroquine fully realizes the therapeutic potential of PLK1 and FGFR1 targeting therapy, producing potent and durable responses in KRAS-mutant patient-derived xenografts and a genetically engineered mouse model of Kras-induced lung adenocarcinoma.	Chloroquine	156-167	polo like kinase 1	Homo sapiens	212-216
34369083-5	2021	We further delineate that autophagy protects from PLK1/FGFR1 inhibitor cytotoxicity and that antagonizing the compensation mechanism by clinically approved chloroquine fully realizes the therapeutic potential of PLK1 and FGFR1 targeting therapy, producing potent and durable responses in KRAS-mutant patient-derived xenografts and a genetically engineered mouse model of Kras-induced lung adenocarcinoma.	Chloroquine	156-167	fibroblast growth factor receptor 1	Homo sapiens	221-226
34369083-5	2021	We further delineate that autophagy protects from PLK1/FGFR1 inhibitor cytotoxicity and that antagonizing the compensation mechanism by clinically approved chloroquine fully realizes the therapeutic potential of PLK1 and FGFR1 targeting therapy, producing potent and durable responses in KRAS-mutant patient-derived xenografts and a genetically engineered mouse model of Kras-induced lung adenocarcinoma.	Chloroquine	156-167	KRAS proto-oncogene, GTPase	Homo sapiens	288-292
34369083-5	2021	We further delineate that autophagy protects from PLK1/FGFR1 inhibitor cytotoxicity and that antagonizing the compensation mechanism by clinically approved chloroquine fully realizes the therapeutic potential of PLK1 and FGFR1 targeting therapy, producing potent and durable responses in KRAS-mutant patient-derived xenografts and a genetically engineered mouse model of Kras-induced lung adenocarcinoma.	Chloroquine	156-167	Kirsten rat sarcoma viral oncogene homolog	Mus musculus	371-375
34355491-0	2021	Ouabain and chloroquine trigger senolysis of BRAF-V600E-induced senescent cells by targeting autophagy.	Chloroquine	12-23	B-Raf proto-oncogene, serine/threonine kinase	Homo sapiens	45-49
34355491-9	2021	Consequently, we identified autophagy inhibitor chloroquine as a novel senolytic in BRAF senescence based on the mode of action of cardioglycosides.	Chloroquine	48-59	B-Raf proto-oncogene, serine/threonine kinase	Homo sapiens	84-88
34146852-0	2021	Chloroquine attenuates thymic stromal lymphopoietin production via suppressing caspase-1 signaling in mast cells.	Chloroquine	0-11	thymic stromal lymphopoietin	Homo sapiens	23-51
34217752-8	2021	The inhibition of SARS-CoV-2 replication by chloroquine and hydroxychloroquine coincided with an inhibitory effect on the autophagy pathway as visualized by a dose-dependent increase in LC3-positive puncta.	Chloroquine	44-55	microtubule associated protein 1 light chain 3 alpha	Homo sapiens	186-189
34146852-0	2021	Chloroquine attenuates thymic stromal lymphopoietin production via suppressing caspase-1 signaling in mast cells.	Chloroquine	0-11	caspase 1	Homo sapiens	79-88
34146852-3	2021	This study aims to clarify an anti-inflammatory effect of CQ through modulating TSLP levels using an in vitro model of phorbol myristate acetate (PMA) + A23187-activated human mast cell line (HMC-1) and an in vivo model of PMA-irritated ear edema.	Chloroquine	58-60	thymic stromal lymphopoietin	Homo sapiens	80-84
34146852-4	2021	CQ treatment reduced the production and mRNA expression levels of TSLP in activated HMC-1 cells.	Chloroquine	0-2	thymic stromal lymphopoietin	Homo sapiens	66-70
34146852-5	2021	CQ down-regulated caspase-1 (CASP1), MAPKs, and NF-kappaB levels enhanced by stimulation with PMA + A23187.	Chloroquine	0-2	caspase 1	Homo sapiens	18-27
34146852-5	2021	CQ down-regulated caspase-1 (CASP1), MAPKs, and NF-kappaB levels enhanced by stimulation with PMA + A23187.	Chloroquine	0-2	caspase 1	Homo sapiens	29-34
34146852-5	2021	CQ down-regulated caspase-1 (CASP1), MAPKs, and NF-kappaB levels enhanced by stimulation with PMA + A23187.	Chloroquine	0-2	nuclear factor kappa B subunit 1	Homo sapiens	48-57
34146852-7	2021	CQ decreased CASP1 and NF-kappaB levels in the ear tissue.	Chloroquine	0-2	caspase 1	Homo sapiens	13-18
34146852-7	2021	CQ decreased CASP1 and NF-kappaB levels in the ear tissue.	Chloroquine	0-2	nuclear factor kappa B subunit 1	Homo sapiens	23-32
34146852-8	2021	TSLP levels in the ear tissue and serum were reduced following CQ treatment.	Chloroquine	63-65	thymic stromal lymphopoietin	Homo sapiens	0-4
34146852-9	2021	Collectively, the above findings elucidate that CQ inhibits the pro-inflammatory mechanisms of TSLP via the down-regulation of distinct intracellular signaling cascade in mast cells.	Chloroquine	48-50	thymic stromal lymphopoietin	Homo sapiens	95-99
34146852-10	2021	Therefore, CQ may have protective roles against TSLP-mediated inflammatory disorders.	Chloroquine	11-13	thymic stromal lymphopoietin	Homo sapiens	48-52
34428517-5	2021	Of note, downregulation of PRDX1 decreases the phosphorylation of AKT, thereby inducing cytoprotective autophagy and combinational use of NAT and chloroquine (CQ) achieves better anti-tumor efficacy.	Chloroquine	146-157	peroxiredoxin 1	Homo sapiens	27-32
34440609-6	2021	The increased level of LC3B-II induced by CB-2 was neither eliminated when autophagy initiation was suppressed by wortmannin nor further increased when autophagosome degradation was inhibited by chloroquine (CQ).	Chloroquine	195-206	microtubule associated protein 1 light chain 3 beta	Homo sapiens	23-27
34440609-6	2021	The increased level of LC3B-II induced by CB-2 was neither eliminated when autophagy initiation was suppressed by wortmannin nor further increased when autophagosome degradation was inhibited by chloroquine (CQ).	Chloroquine	195-206	cannabinoid receptor 2	Homo sapiens	42-46
34440609-6	2021	The increased level of LC3B-II induced by CB-2 was neither eliminated when autophagy initiation was suppressed by wortmannin nor further increased when autophagosome degradation was inhibited by chloroquine (CQ).	Chloroquine	208-210	microtubule associated protein 1 light chain 3 beta	Homo sapiens	23-27
34440609-6	2021	The increased level of LC3B-II induced by CB-2 was neither eliminated when autophagy initiation was suppressed by wortmannin nor further increased when autophagosome degradation was inhibited by chloroquine (CQ).	Chloroquine	208-210	cannabinoid receptor 2	Homo sapiens	42-46
34303829-6	2021	RESULTS: Chloroquine inhibited TNF secretion, mitochondrial ROS production, MAPK, and Syk activation induced by heme.	Chloroquine	9-20	tumor necrosis factor	Mus musculus	31-34
34303829-6	2021	RESULTS: Chloroquine inhibited TNF secretion, mitochondrial ROS production, MAPK, and Syk activation induced by heme.	Chloroquine	9-20	spleen tyrosine kinase	Mus musculus	86-89
34303829-8	2021	IL-6 and IL-1beta secretions induced by heme in the presence of PRRs agonists were inhibited by chloroquine, but not by calcium chelator BAPTA or inhibitor of endosomal acidification concamycin B.	Chloroquine	96-107	interleukin 6	Mus musculus	0-4
34303829-8	2021	IL-6 and IL-1beta secretions induced by heme in the presence of PRRs agonists were inhibited by chloroquine, but not by calcium chelator BAPTA or inhibitor of endosomal acidification concamycin B.	Chloroquine	96-107	interleukin 1 alpha	Mus musculus	9-17
34290084-8	2021	MAO-B inhibition preferentially facilitated the secretion of detergent-insoluble alpha-syn protein and decreased its intracellular accumulation under chloroquine-induced lysosomal dysfunction.	Chloroquine	150-161	monoamine oxidase B	Homo sapiens	0-5
34290084-14	2021	MAO-B inhibition preferentially facilitated secretion of detergent-insoluble alpha-synuclein protein and reduced its intracellular accumulation under chloroquine-induced lysosomal dysfunction.	Chloroquine	150-161	monoamine oxidase B	Homo sapiens	0-5
34146643-4	2021	And chloroquine treatment increased LC3B levels in ILK-knockdown GES-1 cells.	Chloroquine	4-15	microtubule associated protein 1 light chain 3 beta	Homo sapiens	36-40
34428517-5	2021	Of note, downregulation of PRDX1 decreases the phosphorylation of AKT, thereby inducing cytoprotective autophagy and combinational use of NAT and chloroquine (CQ) achieves better anti-tumor efficacy.	Chloroquine	146-157	AKT serine/threonine kinase 1	Homo sapiens	66-69
34428517-5	2021	Of note, downregulation of PRDX1 decreases the phosphorylation of AKT, thereby inducing cytoprotective autophagy and combinational use of NAT and chloroquine (CQ) achieves better anti-tumor efficacy.	Chloroquine	159-161	peroxiredoxin 1	Homo sapiens	27-32
34428517-5	2021	Of note, downregulation of PRDX1 decreases the phosphorylation of AKT, thereby inducing cytoprotective autophagy and combinational use of NAT and chloroquine (CQ) achieves better anti-tumor efficacy.	Chloroquine	159-161	AKT serine/threonine kinase 1	Homo sapiens	66-69
34410522-0	2021	Suppressed PLIN3 frequently occurs in prostate cancer, promoting docetaxel resistance via intensified autophagy, an event reversed by chloroquine.	Chloroquine	134-145	perilipin 3	Homo sapiens	11-16
34410522-13	2021	Given the frequent loss of PLIN3 expression in PCa specimens, we suggest that combination of docetaxel with chloroquine may improve the efficacy of docetaxel treatment in PLIN3-deficient cancer patients.	Chloroquine	108-119	perilipin 3	Homo sapiens	27-32
34430715-11	2021	The number of single-strand DNA-positive (apoptotic) cells was significantly higher in the tumors of mice treated with a CDK4/6 inhibitor plus CQ than in mice treated with either CQ or a CDK4/6 inhibitor.	Chloroquine	143-145	cyclin-dependent kinase 4	Mus musculus	121-127
34407152-0	2021	Antitumor effects of chloroquine/hydroxychloroquine mediated by inhibition of the NF-kappaB signaling pathway through abrogation of autophagic p47 degradation in adult T-cell leukemia/lymphoma cells.	Chloroquine	21-32	nuclear factor of kappa light polypeptide gene enhancer in B cells 1, p105	Mus musculus	82-91
34407152-0	2021	Antitumor effects of chloroquine/hydroxychloroquine mediated by inhibition of the NF-kappaB signaling pathway through abrogation of autophagic p47 degradation in adult T-cell leukemia/lymphoma cells.	Chloroquine	21-32	NSFL1 (p97) cofactor (p47)	Mus musculus	143-146
34407152-4	2021	In this paper, we determined the therapeutic efficacy of CQ/HCQ, as NF-kappaB inhibitors, in ATLL mediated by blockade of p47 degradation.	Chloroquine	57-59	nuclear factor kappa B subunit 1	Homo sapiens	68-77
34407152-4	2021	In this paper, we determined the therapeutic efficacy of CQ/HCQ, as NF-kappaB inhibitors, in ATLL mediated by blockade of p47 degradation.	Chloroquine	57-59	NSFL1 (p97) cofactor (p47)	Mus musculus	122-125
34407152-6	2021	As to the molecular mechanism, autophagy was inhibited in CQ-treated ATLL cells, and activation of the NF-kappaB pathway was suppressed with the restoration of the p47 level.	Chloroquine	58-60	nuclear factor kappa B subunit 1	Homo sapiens	103-112
34407152-6	2021	As to the molecular mechanism, autophagy was inhibited in CQ-treated ATLL cells, and activation of the NF-kappaB pathway was suppressed with the restoration of the p47 level.	Chloroquine	58-60	NSFL1 (p97) cofactor (p47)	Mus musculus	164-167
34539987-8	2021	IK1 antagonist chloroquine or BaCl2 reversed these effects.	Chloroquine	15-26	potassium calcium-activated channel subfamily N member 4	Rattus norvegicus	0-3
34492927-5	2021	Besides, both 3-MA and CQ addition increased NLRP3, Caspase-1, NEK7, ASC, GSDMA, GSDME, IL-1beta, IL-18 mRNA levels, NLRP3, Caspase-1 p20, ASC, GSDMD protein and ROS levels, and NO, LDH, IL-1beta, IL-18 releases.	Chloroquine	23-25	NLR family pyrin domain containing 3	Homo sapiens	45-50
34492927-5	2021	Besides, both 3-MA and CQ addition increased NLRP3, Caspase-1, NEK7, ASC, GSDMA, GSDME, IL-1beta, IL-18 mRNA levels, NLRP3, Caspase-1 p20, ASC, GSDMD protein and ROS levels, and NO, LDH, IL-1beta, IL-18 releases.	Chloroquine	23-25	caspase 1	Homo sapiens	52-61
34492927-5	2021	Besides, both 3-MA and CQ addition increased NLRP3, Caspase-1, NEK7, ASC, GSDMA, GSDME, IL-1beta, IL-18 mRNA levels, NLRP3, Caspase-1 p20, ASC, GSDMD protein and ROS levels, and NO, LDH, IL-1beta, IL-18 releases.	Chloroquine	23-25	NIMA related kinase 7	Homo sapiens	63-67
34492927-5	2021	Besides, both 3-MA and CQ addition increased NLRP3, Caspase-1, NEK7, ASC, GSDMA, GSDME, IL-1beta, IL-18 mRNA levels, NLRP3, Caspase-1 p20, ASC, GSDMD protein and ROS levels, and NO, LDH, IL-1beta, IL-18 releases.	Chloroquine	23-25	PYD and CARD domain containing	Homo sapiens	69-72
34492927-5	2021	Besides, both 3-MA and CQ addition increased NLRP3, Caspase-1, NEK7, ASC, GSDMA, GSDME, IL-1beta, IL-18 mRNA levels, NLRP3, Caspase-1 p20, ASC, GSDMD protein and ROS levels, and NO, LDH, IL-1beta, IL-18 releases.	Chloroquine	23-25	gasdermin A	Homo sapiens	74-79
34492927-5	2021	Besides, both 3-MA and CQ addition increased NLRP3, Caspase-1, NEK7, ASC, GSDMA, GSDME, IL-1beta, IL-18 mRNA levels, NLRP3, Caspase-1 p20, ASC, GSDMD protein and ROS levels, and NO, LDH, IL-1beta, IL-18 releases.	Chloroquine	23-25	interleukin 1 alpha	Homo sapiens	88-96
34492927-5	2021	Besides, both 3-MA and CQ addition increased NLRP3, Caspase-1, NEK7, ASC, GSDMA, GSDME, IL-1beta, IL-18 mRNA levels, NLRP3, Caspase-1 p20, ASC, GSDMD protein and ROS levels, and NO, LDH, IL-1beta, IL-18 releases.	Chloroquine	23-25	interleukin 18	Homo sapiens	98-103
34492927-5	2021	Besides, both 3-MA and CQ addition increased NLRP3, Caspase-1, NEK7, ASC, GSDMA, GSDME, IL-1beta, IL-18 mRNA levels, NLRP3, Caspase-1 p20, ASC, GSDMD protein and ROS levels, and NO, LDH, IL-1beta, IL-18 releases.	Chloroquine	23-25	NLR family pyrin domain containing 3	Homo sapiens	117-122
34492927-5	2021	Besides, both 3-MA and CQ addition increased NLRP3, Caspase-1, NEK7, ASC, GSDMA, GSDME, IL-1beta, IL-18 mRNA levels, NLRP3, Caspase-1 p20, ASC, GSDMD protein and ROS levels, and NO, LDH, IL-1beta, IL-18 releases.	Chloroquine	23-25	caspase 1	Homo sapiens	124-133
34492927-5	2021	Besides, both 3-MA and CQ addition increased NLRP3, Caspase-1, NEK7, ASC, GSDMA, GSDME, IL-1beta, IL-18 mRNA levels, NLRP3, Caspase-1 p20, ASC, GSDMD protein and ROS levels, and NO, LDH, IL-1beta, IL-18 releases.	Chloroquine	23-25	tubulin polymerization promoting protein family member 3	Homo sapiens	134-137
34492927-5	2021	Besides, both 3-MA and CQ addition increased NLRP3, Caspase-1, NEK7, ASC, GSDMA, GSDME, IL-1beta, IL-18 mRNA levels, NLRP3, Caspase-1 p20, ASC, GSDMD protein and ROS levels, and NO, LDH, IL-1beta, IL-18 releases.	Chloroquine	23-25	PYD and CARD domain containing	Homo sapiens	139-142
34492927-5	2021	Besides, both 3-MA and CQ addition increased NLRP3, Caspase-1, NEK7, ASC, GSDMA, GSDME, IL-1beta, IL-18 mRNA levels, NLRP3, Caspase-1 p20, ASC, GSDMD protein and ROS levels, and NO, LDH, IL-1beta, IL-18 releases.	Chloroquine	23-25	gasdermin D	Homo sapiens	144-149
34492927-5	2021	Besides, both 3-MA and CQ addition increased NLRP3, Caspase-1, NEK7, ASC, GSDMA, GSDME, IL-1beta, IL-18 mRNA levels, NLRP3, Caspase-1 p20, ASC, GSDMD protein and ROS levels, and NO, LDH, IL-1beta, IL-18 releases.	Chloroquine	23-25	interleukin 1 alpha	Homo sapiens	187-195
34492927-5	2021	Besides, both 3-MA and CQ addition increased NLRP3, Caspase-1, NEK7, ASC, GSDMA, GSDME, IL-1beta, IL-18 mRNA levels, NLRP3, Caspase-1 p20, ASC, GSDMD protein and ROS levels, and NO, LDH, IL-1beta, IL-18 releases.	Chloroquine	23-25	interleukin 18	Homo sapiens	197-202
34306988-4	2021	Since Chloroquine has been looked as potential therapy against COVID-19, we also compared the binding of chloroquine and artemisinin for its interaction with spike proteins (6VXX, 6VYB) and its variant 7NXA, respectively.	Chloroquine	105-116	surface glycoprotein	Severe acute respiratory syndrome coronavirus 2	158-163
34382418-8	2021	Upon protein colocalization, TBK1 phosphorylated RAB7, in line with the finding that chloroquine or a TBK1 inhibitor reversed NDP52-dependent beneficial responses.	Chloroquine	85-96	calcium binding and coiled-coil domain 2	Homo sapiens	126-131
34360754-5	2021	The activation of pexophagy under PEX16 knockdown was shown by (i) abrogated peroxisome loss under PEX16 knockdown in autophagy-deficient ATG5 knockout cell lines, and (ii) increased autophagy flux and co-localization of p62-an autophagy adaptor protein-with ABCD3 in the presence of the autophagy inhibitor chloroquine.	Chloroquine	308-319	peroxisomal biogenesis factor 16	Homo sapiens	34-39
34360754-5	2021	The activation of pexophagy under PEX16 knockdown was shown by (i) abrogated peroxisome loss under PEX16 knockdown in autophagy-deficient ATG5 knockout cell lines, and (ii) increased autophagy flux and co-localization of p62-an autophagy adaptor protein-with ABCD3 in the presence of the autophagy inhibitor chloroquine.	Chloroquine	308-319	nucleoporin 62	Homo sapiens	221-224
34360754-5	2021	The activation of pexophagy under PEX16 knockdown was shown by (i) abrogated peroxisome loss under PEX16 knockdown in autophagy-deficient ATG5 knockout cell lines, and (ii) increased autophagy flux and co-localization of p62-an autophagy adaptor protein-with ABCD3 in the presence of the autophagy inhibitor chloroquine.	Chloroquine	308-319	ATP binding cassette subfamily D member 3	Homo sapiens	259-264
34087318-7	2021	The decreased level of p62 and additional accumulation of LC3BII caused by chloroquine (CQ) further indicated that DDIT3/CHOP enhanced autophagic flux.	Chloroquine	75-86	nucleoporin 62	Mus musculus	23-26
34087318-7	2021	The decreased level of p62 and additional accumulation of LC3BII caused by chloroquine (CQ) further indicated that DDIT3/CHOP enhanced autophagic flux.	Chloroquine	75-86	DNA-damage inducible transcript 3	Mus musculus	115-120
34087318-7	2021	The decreased level of p62 and additional accumulation of LC3BII caused by chloroquine (CQ) further indicated that DDIT3/CHOP enhanced autophagic flux.	Chloroquine	75-86	DNA-damage inducible transcript 3	Mus musculus	121-125
34087318-7	2021	The decreased level of p62 and additional accumulation of LC3BII caused by chloroquine (CQ) further indicated that DDIT3/CHOP enhanced autophagic flux.	Chloroquine	88-90	nucleoporin 62	Mus musculus	23-26
34087318-7	2021	The decreased level of p62 and additional accumulation of LC3BII caused by chloroquine (CQ) further indicated that DDIT3/CHOP enhanced autophagic flux.	Chloroquine	88-90	DNA-damage inducible transcript 3	Mus musculus	115-120
34087318-7	2021	The decreased level of p62 and additional accumulation of LC3BII caused by chloroquine (CQ) further indicated that DDIT3/CHOP enhanced autophagic flux.	Chloroquine	88-90	DNA-damage inducible transcript 3	Mus musculus	121-125
34299065-5	2021	The relationship of TLR9 to the induction of a pro-regenerative state in the cervical DRG neurons was confirmed by the shorter lengths of regenerated axons distal to ulnar nerve crush following a previous sciatic nerve lesion and intrathecal chloroquine injection compared with control rats.	Chloroquine	242-253	toll-like receptor 9	Rattus norvegicus	20-24
34299093-5	2021	It was found that chloroquine, NH4Cl and 3MA markedly increased tau accumulation.	Chloroquine	18-29	microtubule associated protein tau	Homo sapiens	64-67
34356312-8	2021	Interestingly, using autophagy inhibitors such as 3-methyladenine (3-MA) and chloroquine (CQ) both showed an increase in cleaved-PARP protein level, indicating apoptosis induction.	Chloroquine	77-88	poly(ADP-ribose) polymerase 1	Homo sapiens	129-133
34229754-9	2021	Moreover, inhibiting autophagy by chloroquine (CQ) enhanced the apatinib-induced apoptosis of ESCC cells through the IRE-1alpha-AKT-mTOR pathway.	Chloroquine	34-45	endoplasmic reticulum to nucleus signaling 1	Homo sapiens	117-127
34229754-9	2021	Moreover, inhibiting autophagy by chloroquine (CQ) enhanced the apatinib-induced apoptosis of ESCC cells through the IRE-1alpha-AKT-mTOR pathway.	Chloroquine	34-45	AKT serine/threonine kinase 1	Homo sapiens	128-131
34229754-9	2021	Moreover, inhibiting autophagy by chloroquine (CQ) enhanced the apatinib-induced apoptosis of ESCC cells through the IRE-1alpha-AKT-mTOR pathway.	Chloroquine	34-45	mechanistic target of rapamycin kinase	Homo sapiens	132-136
34229754-9	2021	Moreover, inhibiting autophagy by chloroquine (CQ) enhanced the apatinib-induced apoptosis of ESCC cells through the IRE-1alpha-AKT-mTOR pathway.	Chloroquine	47-49	endoplasmic reticulum to nucleus signaling 1	Homo sapiens	117-127
34229754-9	2021	Moreover, inhibiting autophagy by chloroquine (CQ) enhanced the apatinib-induced apoptosis of ESCC cells through the IRE-1alpha-AKT-mTOR pathway.	Chloroquine	47-49	AKT serine/threonine kinase 1	Homo sapiens	128-131
34229754-9	2021	Moreover, inhibiting autophagy by chloroquine (CQ) enhanced the apatinib-induced apoptosis of ESCC cells through the IRE-1alpha-AKT-mTOR pathway.	Chloroquine	47-49	mechanistic target of rapamycin kinase	Homo sapiens	132-136
34229754-10	2021	In addition, we showed, for the first time, the paclitaxel combined with apatinib and CQ exhibited the best antitumor effect on ESCC both in vivo and in vitro via the IRE-1alpha-AKT-mTOR pathway.	Chloroquine	86-88	endoplasmic reticulum to nucleus signaling 1	Homo sapiens	167-177
34229754-10	2021	In addition, we showed, for the first time, the paclitaxel combined with apatinib and CQ exhibited the best antitumor effect on ESCC both in vivo and in vitro via the IRE-1alpha-AKT-mTOR pathway.	Chloroquine	86-88	AKT serine/threonine kinase 1	Homo sapiens	178-181
34229754-10	2021	In addition, we showed, for the first time, the paclitaxel combined with apatinib and CQ exhibited the best antitumor effect on ESCC both in vivo and in vitro via the IRE-1alpha-AKT-mTOR pathway.	Chloroquine	86-88	mechanistic target of rapamycin kinase	Homo sapiens	182-186
34229754-13	2021	The combination of apatinib and CQ sensitized ESCC cells to paclitaxel to induce apoptosis through the IRE-1alpha-AKT-mTOR signaling pathway, thus providing the basis for its use in innovative anticancer therapeutic strategies.	Chloroquine	32-34	endoplasmic reticulum to nucleus signaling 1	Homo sapiens	103-113
34229754-13	2021	The combination of apatinib and CQ sensitized ESCC cells to paclitaxel to induce apoptosis through the IRE-1alpha-AKT-mTOR signaling pathway, thus providing the basis for its use in innovative anticancer therapeutic strategies.	Chloroquine	32-34	AKT serine/threonine kinase 1	Homo sapiens	114-117
34229754-13	2021	The combination of apatinib and CQ sensitized ESCC cells to paclitaxel to induce apoptosis through the IRE-1alpha-AKT-mTOR signaling pathway, thus providing the basis for its use in innovative anticancer therapeutic strategies.	Chloroquine	32-34	mechanistic target of rapamycin kinase	Homo sapiens	118-122
34295341-6	2021	The results of in vivo experiments show that chloroquine can increase the expression of PD-1 in tumor tissues.	Chloroquine	45-56	programmed cell death 1	Homo sapiens	88-92
34295341-8	2021	The mechanism underlying this phenomenon is the occurrence of chloroquine-induced apoptosis and the effective immune response caused by the attenuated Salmonella carrying PD-1 siRNA.	Chloroquine	62-73	programmed cell death 1	Homo sapiens	171-175
34356312-8	2021	Interestingly, using autophagy inhibitors such as 3-methyladenine (3-MA) and chloroquine (CQ) both showed an increase in cleaved-PARP protein level, indicating apoptosis induction.	Chloroquine	90-92	poly(ADP-ribose) polymerase 1	Homo sapiens	129-133
34194041-5	2021	At the higher dose, PfSPZ-CVac(CQ) protected six out of six (100%) participants against heterologous CHMI three months after immunization.	Chloroquine	31-33	chondromodulin	Homo sapiens	101-105
34759472-4	2021	Methods: EMBASE, COCHRANE, and PubMed databases were searched for studies on the use of hydroxychloroquine or chloroquine in the treatment of COVID-19.	Chloroquine	110-121	cochlin	Homo sapiens	17-25
34267496-5	2021	MG132 and chloroquine were used to inhibit the degradation of the WT and mutated EPHA2.	Chloroquine	10-21	EPH receptor A2	Homo sapiens	81-86
34268312-6	2021	Additionally, an accumulation of amphisomes greater than 10 mum2 in area were observed in aging oocytes, and this accumulation was mimicked in oocytes treated with lysosomal inhibitor chloroquine.	Chloroquine	184-195	trafficking protein particle complex 1	Mus musculus	60-64
34080659-8	2021	Blocking autophagy flux with the final stage autophagy inhibitor chloroquine (CQ) also upregulated DR4 and DR5 expression.	Chloroquine	65-76	TNF receptor superfamily member 10a	Homo sapiens	99-102
34080659-8	2021	Blocking autophagy flux with the final stage autophagy inhibitor chloroquine (CQ) also upregulated DR4 and DR5 expression.	Chloroquine	65-76	TNF receptor superfamily member 10b	Homo sapiens	107-110
34080659-8	2021	Blocking autophagy flux with the final stage autophagy inhibitor chloroquine (CQ) also upregulated DR4 and DR5 expression.	Chloroquine	78-80	TNF receptor superfamily member 10a	Homo sapiens	99-102
34080659-8	2021	Blocking autophagy flux with the final stage autophagy inhibitor chloroquine (CQ) also upregulated DR4 and DR5 expression.	Chloroquine	78-80	TNF receptor superfamily member 10b	Homo sapiens	107-110
34080659-9	2021	TRAIL in combination with amitriptyline or CQ significantly increased the expression of apoptosis-indicator proteins cleaved caspase-8 and caspase-3.	Chloroquine	43-45	TNF superfamily member 10	Homo sapiens	0-5
34080659-9	2021	TRAIL in combination with amitriptyline or CQ significantly increased the expression of apoptosis-indicator proteins cleaved caspase-8 and caspase-3.	Chloroquine	43-45	caspase 8	Homo sapiens	125-134
34080659-9	2021	TRAIL in combination with amitriptyline or CQ significantly increased the expression of apoptosis-indicator proteins cleaved caspase-8 and caspase-3.	Chloroquine	43-45	caspase 3	Homo sapiens	139-148
34145219-7	2021	The administration of lysosome inhibitor chloroquine (CQ) intraperitoneally or mitophagy inhibitor (Mdivi-1) intracerebroventricularly abrogated HPC-induced mitochondrial turnover and neuroprotection in CA1 after tGCI.	Chloroquine	41-52	carbonic anhydrase 1	Rattus norvegicus	203-206
34203341-6	2021	Lysosome inhibitor, chloroquine, but not proteasome inhibitor MG132, can rescue TGF-beta1-induced downregulation of TAp63alpha protein.	Chloroquine	20-31	transforming growth factor beta 1	Homo sapiens	80-89
34170850-0	2021	Chloroquine suppresses proliferation and invasion and induces apoptosis of osteosarcoma cells associated with inhibition of phosphorylation of STAT3.	Chloroquine	0-11	signal transducer and activator of transcription 3	Homo sapiens	143-148
34220184-5	2021	MG132 and chloroquine were used to inhibit the degradation of the WT and mutated EPHA2.	Chloroquine	10-21	EPH receptor A2	Homo sapiens	81-86
34145219-7	2021	The administration of lysosome inhibitor chloroquine (CQ) intraperitoneally or mitophagy inhibitor (Mdivi-1) intracerebroventricularly abrogated HPC-induced mitochondrial turnover and neuroprotection in CA1 after tGCI.	Chloroquine	54-56	carbonic anhydrase 1	Rattus norvegicus	203-206
34130375-3	2021	Thus, in this current computational study we carried out molecular docking experiments to assess the bridging potentials of some commercial drugs such as chloroquine, hydroxychloroquine, lopinavir, ritonavir, nafamostat, camostat, famotidine, umifenovir, nitazoxanide, ivermectin, and fluvoxamine at the interface between human ACE2 and the coronavirus spike glycoprotein complex.	Chloroquine	154-165	angiotensin converting enzyme 2	Homo sapiens	328-332
34163366-13	2021	Chloroquine and compound C were employed to block autophagic flux and AMPK, respectively.	Chloroquine	0-11	protein kinase AMP-activated non-catalytic subunit beta 1	Homo sapiens	70-74
34118944-0	2021	Effect of the lysosomotropic agent chloroquine on mTORC1 activation and protein synthesis in human skeletal muscle.	Chloroquine	35-46	CREB regulated transcription coactivator 1	Mus musculus	50-56
34118944-7	2021	In contrast, in C2C12 cells, 1 mM leucine increased mTORC1 and S6K1 phosphorylation (P < 0.05), which was inhibited by 2 mg/ml chloroquine.	Chloroquine	127-138	CREB regulated transcription coactivator 1	Mus musculus	52-58
34118944-7	2021	In contrast, in C2C12 cells, 1 mM leucine increased mTORC1 and S6K1 phosphorylation (P < 0.05), which was inhibited by 2 mg/ml chloroquine.	Chloroquine	127-138	ribosomal protein S6 kinase, polypeptide 1	Mus musculus	63-67
34118944-8	2021	Chloroquine (2 mg/ml) was sufficient to disrupt mTORC1 signaling, and MyPS.	Chloroquine	0-11	CREB regulated transcription coactivator 1	Mus musculus	48-54
34177879-7	2021	The use of chloroquine did not significantly influence the patients" antibody titer but reduced C-reaction protein (CRP) level.	Chloroquine	11-22	C-reactive protein	Homo sapiens	116-119
34102996-8	2022	Moreover, ZST93 induced suppressive autophagic flux and caspase-3-dependent cell death, which were further strengthened by the blocking of the autophagy process using chloroquine (CQ).	Chloroquine	167-178	caspase 3	Homo sapiens	56-65
34102996-8	2022	Moreover, ZST93 induced suppressive autophagic flux and caspase-3-dependent cell death, which were further strengthened by the blocking of the autophagy process using chloroquine (CQ).	Chloroquine	180-182	caspase 3	Homo sapiens	56-65
34071730-9	2021	Chloroquine and several of its derivatives, which were previously identified as toxin pore blockers, inhibited intoxication of Vero, HCT116, and CaCo-2 cells by CDTb and CDTb pores in vitro.	Chloroquine	0-11	corneal dystrophy of Bowman's layer type II (Thiel-Behnke)	Homo sapiens	161-165
34071730-9	2021	Chloroquine and several of its derivatives, which were previously identified as toxin pore blockers, inhibited intoxication of Vero, HCT116, and CaCo-2 cells by CDTb and CDTb pores in vitro.	Chloroquine	0-11	corneal dystrophy of Bowman's layer type II (Thiel-Behnke)	Homo sapiens	170-174
34069550-0	2021	A Phase Ib Clinical Trial of Metformin and Chloroquine in Patients with IDH1-Mutated Solid Tumors.	Chloroquine	43-54	isocitrate dehydrogenase (NADP(+)) 1	Homo sapiens	72-76
34069550-12	2021	CONCLUSION: Treatment of advanced IDH1-mutated solid tumors with metformin and chloroquine was well tolerated but did not induce a clinical response in this phase Ib clinical trial.	Chloroquine	79-90	isocitrate dehydrogenase (NADP(+)) 1	Homo sapiens	34-38
34079802-6	2021	Inhibition of autophagy by inhibitors like leupeptin, chloroquine (CQ), and Bafilomycin A1 (Baf-A1) blocks the degradation of B7H3 in glioma cells.	Chloroquine	54-65	CD276 antigen	Mus musculus	126-130
34079452-6	2021	Our study shows for the first time that Wnt5A induces the gene expression of CYP1A1 and CYP1B1 enzymes involved in phase I metabolism of a broad spectrum of drugs including chloroquine (the controversial drug for COVID-19) that is known to cause toxicity in myocardium.	Chloroquine	173-184	Wnt family member 5A	Homo sapiens	40-45
34079802-6	2021	Inhibition of autophagy by inhibitors like leupeptin, chloroquine (CQ), and Bafilomycin A1 (Baf-A1) blocks the degradation of B7H3 in glioma cells.	Chloroquine	67-69	CD276 antigen	Mus musculus	126-130
34079452-6	2021	Our study shows for the first time that Wnt5A induces the gene expression of CYP1A1 and CYP1B1 enzymes involved in phase I metabolism of a broad spectrum of drugs including chloroquine (the controversial drug for COVID-19) that is known to cause toxicity in myocardium.	Chloroquine	173-184	cytochrome P450 family 1 subfamily A member 1	Homo sapiens	77-83
34079802-9	2021	Moreover, B7H3 interacts with p62 and CQ treatment significantly enhances this interaction.	Chloroquine	38-40	CD276 antigen	Mus musculus	10-14
34079452-6	2021	Our study shows for the first time that Wnt5A induces the gene expression of CYP1A1 and CYP1B1 enzymes involved in phase I metabolism of a broad spectrum of drugs including chloroquine (the controversial drug for COVID-19) that is known to cause toxicity in myocardium.	Chloroquine	173-184	cytochrome P450 family 1 subfamily B member 1	Homo sapiens	88-94
34079802-9	2021	Moreover, B7H3 interacts with p62 and CQ treatment significantly enhances this interaction.	Chloroquine	38-40	nucleoporin 62	Mus musculus	30-33
34150011-6	2021	Autophagy inhibitor chloroquine (CQ) inhibited the osteogenic activity induced by BMP9 in MSCs.	Chloroquine	20-31	growth differentiation factor 2	Homo sapiens	82-86
34104100-3	2021	The anti-hyperglycaemic, anti-hyperlipidaemic, cardioprotective, anti-hypertensive, and anti-obesity effects of CQ and HCQ might be elicited through reduction of inflammatory response and oxidative stress, improvement of endothelial function, activation of insulin signalling pathway, inhibition of lipogenesis and autophagy, as well as regulation of adipokines and apoptosis.	Chloroquine	112-114	insulin	Homo sapiens	257-264
34522714-6	2021	Finally, the effect of sulfuretin on BACE1 and im-APP was selectively attenuated by the translation inhibitor cycloheximide and by lysosomal inhibitor chloroquine, respectively.	Chloroquine	151-162	beta-secretase 1	Homo sapiens	37-42
34522714-6	2021	Finally, the effect of sulfuretin on BACE1 and im-APP was selectively attenuated by the translation inhibitor cycloheximide and by lysosomal inhibitor chloroquine, respectively.	Chloroquine	151-162	amyloid beta precursor protein	Homo sapiens	47-53
35618033-11	2022	Nevertheless, unlike HCQ, CQ is more likely to exaggerate intracellular prooxidant processes in activated starved microglia, which are inefficiently buffered by Nrf2/HO-1 signaling pathway activation.	Chloroquine	26-28	heme oxygenase 1	Homo sapiens	166-170
35633614-8	2022	Furthermore, we found that the autophagy inhibitor chloroquine, not the proteasome inhibitor MG132, could counteract the promoting effect of tCQA on NLRP3 degradation and the inhibitory effect on cell death.	Chloroquine	51-62	NLR family pyrin domain containing 3	Homo sapiens	149-154
35489420-11	2022	Overexpression of miR-199a-3p promoted autophagy in HUVECs and inhibiting autophagy by chloroquine attenuated the effect of miR-199a-3p on ICAM-1 and VCAM-1 expression.	Chloroquine	87-98	microRNA 199a-1	Homo sapiens	18-29
35489420-11	2022	Overexpression of miR-199a-3p promoted autophagy in HUVECs and inhibiting autophagy by chloroquine attenuated the effect of miR-199a-3p on ICAM-1 and VCAM-1 expression.	Chloroquine	87-98	microRNA 199a-1	Homo sapiens	124-135
35489420-11	2022	Overexpression of miR-199a-3p promoted autophagy in HUVECs and inhibiting autophagy by chloroquine attenuated the effect of miR-199a-3p on ICAM-1 and VCAM-1 expression.	Chloroquine	87-98	intercellular adhesion molecule 1	Homo sapiens	139-145
35489420-11	2022	Overexpression of miR-199a-3p promoted autophagy in HUVECs and inhibiting autophagy by chloroquine attenuated the effect of miR-199a-3p on ICAM-1 and VCAM-1 expression.	Chloroquine	87-98	vascular cell adhesion molecule 1	Homo sapiens	150-156
34094672-4	2021	Inhibiting autophagy by using chloroquine suppressed the stimulating effect of GOLPH3 on glioma malignant development both in vitro and in vivo.	Chloroquine	30-41	golgi phosphoprotein 3	Homo sapiens	79-85
34094831-6	2021	We, therefore, investigated effects of autophagy inhibition on sensitivity of ESCC cells to SFN and found that chloroquine (CQ) could neutralize the activation of SFN on NRF2 and enhance the activation of SFN on caspase pathway, thus improved the anti-tumor efficiency of SFN on ESCC in vitro and in vivo.	Chloroquine	111-122	NFE2 like bZIP transcription factor 2	Homo sapiens	170-174
34094831-6	2021	We, therefore, investigated effects of autophagy inhibition on sensitivity of ESCC cells to SFN and found that chloroquine (CQ) could neutralize the activation of SFN on NRF2 and enhance the activation of SFN on caspase pathway, thus improved the anti-tumor efficiency of SFN on ESCC in vitro and in vivo.	Chloroquine	124-126	NFE2 like bZIP transcription factor 2	Homo sapiens	170-174
34791996-2	2021	Recently, several studies reported the important role of palmitoyl-protein thioesterase 1 (PPT1), a lysosomal enzyme, as the molecular target of chloroquine and its derivates in cancer.	Chloroquine	145-156	palmitoyl-protein thioesterase 1	Homo sapiens	57-89
34791996-2	2021	Recently, several studies reported the important role of palmitoyl-protein thioesterase 1 (PPT1), a lysosomal enzyme, as the molecular target of chloroquine and its derivates in cancer.	Chloroquine	145-156	palmitoyl-protein thioesterase 1	Homo sapiens	91-95
34791996-5	2021	Here, we describe the importance of autophagy and lysosomal inhibitors in tumorigenesis and hypothesize that other antimalarial agents besides chloroquine could also interact with PPT1 and inhibit the mechanistic target of rapamycin (mTOR) signalling, an important pathway in cancer progression.	Chloroquine	143-154	palmitoyl-protein thioesterase 1	Homo sapiens	180-184
34791996-5	2021	Here, we describe the importance of autophagy and lysosomal inhibitors in tumorigenesis and hypothesize that other antimalarial agents besides chloroquine could also interact with PPT1 and inhibit the mechanistic target of rapamycin (mTOR) signalling, an important pathway in cancer progression.	Chloroquine	143-154	mechanistic target of rapamycin kinase	Homo sapiens	201-232
34791996-5	2021	Here, we describe the importance of autophagy and lysosomal inhibitors in tumorigenesis and hypothesize that other antimalarial agents besides chloroquine could also interact with PPT1 and inhibit the mechanistic target of rapamycin (mTOR) signalling, an important pathway in cancer progression.	Chloroquine	143-154	mechanistic target of rapamycin kinase	Homo sapiens	234-238
34195056-7	2021	Materials and Methods: Parasite inhibition assay based on schizont maturation inhibition following WHO protocol on P. falciparum chloroquine-sensitive strain (MRC-2) was employed to determine IC50 value and drug interaction pattern was shown through fractional inhibitory concentration index.	Chloroquine	129-140	mannose receptor C type 2	Homo sapiens	159-164
34150011-6	2021	Autophagy inhibitor chloroquine (CQ) inhibited the osteogenic activity induced by BMP9 in MSCs.	Chloroquine	33-35	growth differentiation factor 2	Homo sapiens	82-86
35609021-9	2022	We propose that inhibition of proteasome activity in conjunction with an increased number of autophagosomes and decreased levels of IGFBP3 might play a central role in lifespan extension by chloroquine in male NMRI mice.	Chloroquine	190-201	insulin-like growth factor binding protein 3	Mus musculus	132-138
35610713-19	2022	The in silico docking simulation against P. falciparum dihydrofolate reductase-thymidylate synthase revealed that pinocembrin (7a) and its chloro analogs 7a-l showed better binding affinity compared with chloroquine that was used as a standard drug.	Chloroquine	204-215	thymidylate synthetase	Homo sapiens	79-99
35551547-6	2022	Lowest cell proliferation was achieved with the concomitant use of genomic DNA, HGFR inhibitor, and chloroquine, when the proliferation stimulating effect of STAT3 overexpression could be outweighed by the inhibitory effect of LC3B, indicating the putative involvement of HGFR-mTOR-ULK1 molecular cascade in HGFR inhibitor-mediated autophagy.	Chloroquine	100-111	signal transducer and activator of transcription 3	Homo sapiens	158-163
35507519-6	2022	The released CQ further inhibits the starvation-induced pro-survival autophagy and cuts off the protective pathway of cancer cells, enhancing the anticancer efficiency of GOx-based starvation therapy.	Chloroquine	13-15	hydroxyacid oxidase 1	Homo sapiens	171-174
35551547-6	2022	Lowest cell proliferation was achieved with the concomitant use of genomic DNA, HGFR inhibitor, and chloroquine, when the proliferation stimulating effect of STAT3 overexpression could be outweighed by the inhibitory effect of LC3B, indicating the putative involvement of HGFR-mTOR-ULK1 molecular cascade in HGFR inhibitor-mediated autophagy.	Chloroquine	100-111	microtubule associated protein 1 light chain 3 beta	Homo sapiens	227-231
35551547-6	2022	Lowest cell proliferation was achieved with the concomitant use of genomic DNA, HGFR inhibitor, and chloroquine, when the proliferation stimulating effect of STAT3 overexpression could be outweighed by the inhibitory effect of LC3B, indicating the putative involvement of HGFR-mTOR-ULK1 molecular cascade in HGFR inhibitor-mediated autophagy.	Chloroquine	100-111	MET proto-oncogene, receptor tyrosine kinase	Homo sapiens	272-276
35551547-6	2022	Lowest cell proliferation was achieved with the concomitant use of genomic DNA, HGFR inhibitor, and chloroquine, when the proliferation stimulating effect of STAT3 overexpression could be outweighed by the inhibitory effect of LC3B, indicating the putative involvement of HGFR-mTOR-ULK1 molecular cascade in HGFR inhibitor-mediated autophagy.	Chloroquine	100-111	mechanistic target of rapamycin kinase	Homo sapiens	277-281
35551547-6	2022	Lowest cell proliferation was achieved with the concomitant use of genomic DNA, HGFR inhibitor, and chloroquine, when the proliferation stimulating effect of STAT3 overexpression could be outweighed by the inhibitory effect of LC3B, indicating the putative involvement of HGFR-mTOR-ULK1 molecular cascade in HGFR inhibitor-mediated autophagy.	Chloroquine	100-111	unc-51 like autophagy activating kinase 1	Homo sapiens	282-286
35551547-6	2022	Lowest cell proliferation was achieved with the concomitant use of genomic DNA, HGFR inhibitor, and chloroquine, when the proliferation stimulating effect of STAT3 overexpression could be outweighed by the inhibitory effect of LC3B, indicating the putative involvement of HGFR-mTOR-ULK1 molecular cascade in HGFR inhibitor-mediated autophagy.	Chloroquine	100-111	MET proto-oncogene, receptor tyrosine kinase	Homo sapiens	308-312
35511795-3	2022	In this study, we report on the prevalence of mutations in the K13, pfmdr-2 (P. falciparum multidrug resistance protein 2), fd (ferredoxin), pfcrt (P. falciparum chloroquine resistance transporter), and arps10 (apicoplast ribosomal protein S10) genes in Plasmodium falciparum parasites prior to (2005) and after (2013) introduction of artemisinin combination therapies for malaria treatment in Uganda.	Chloroquine	162-173	keratin 13	Homo sapiens	63-66
35219693-8	2022	Furthermore, CQ trapped Beclin 1 with Bcl-2, disturbing autophagy initiation and autolysosome formation.	Chloroquine	13-15	beclin 1	Homo sapiens	24-32
35179568-4	2022	Inhibition of autophagic flux by chloroquine or bafilomycin A1 were sufficient to induce eNOS monomerization and lowers nitric oxide bioavailability through raising mitochondrial reactive oxygen species (mtROS).	Chloroquine	33-44	nitric oxide synthase 3	Homo sapiens	89-93
35378205-7	2022	Inhibition of autophagy or Akt pathways by chloroquine (CQ), 3-Methyladenine (3-MA) or LY294002 promoted colistin-induced mitochondrial damage, and caspase-dependent cellular apoptosis.	Chloroquine	43-54	thymoma viral proto-oncogene 1	Mus musculus	27-30
35378205-7	2022	Inhibition of autophagy or Akt pathways by chloroquine (CQ), 3-Methyladenine (3-MA) or LY294002 promoted colistin-induced mitochondrial damage, and caspase-dependent cellular apoptosis.	Chloroquine	56-58	thymoma viral proto-oncogene 1	Mus musculus	27-30
35571705-13	2022	Ursolic acid activated the autophagic flow in 786-O cells, as evidenced by the accumulation of autophagic fluorescent spots and enhanced fluorescence intensity of autophagosomes, and the combined use of the autophagy inhibitor CQ increased the expression level of LC3II compared to ursolic acid alone; ursolic acid decreased the expression levels of PTCH1, GLI1, SMO, SHH, and c-Myc and increased the expression level of Sufu in the hedgehog signaling pathway.	Chloroquine	227-229	patched 1	Homo sapiens	350-355
35571705-13	2022	Ursolic acid activated the autophagic flow in 786-O cells, as evidenced by the accumulation of autophagic fluorescent spots and enhanced fluorescence intensity of autophagosomes, and the combined use of the autophagy inhibitor CQ increased the expression level of LC3II compared to ursolic acid alone; ursolic acid decreased the expression levels of PTCH1, GLI1, SMO, SHH, and c-Myc and increased the expression level of Sufu in the hedgehog signaling pathway.	Chloroquine	227-229	GLI family zinc finger 1	Homo sapiens	357-361
35571705-13	2022	Ursolic acid activated the autophagic flow in 786-O cells, as evidenced by the accumulation of autophagic fluorescent spots and enhanced fluorescence intensity of autophagosomes, and the combined use of the autophagy inhibitor CQ increased the expression level of LC3II compared to ursolic acid alone; ursolic acid decreased the expression levels of PTCH1, GLI1, SMO, SHH, and c-Myc and increased the expression level of Sufu in the hedgehog signaling pathway.	Chloroquine	227-229	smoothened, frizzled class receptor	Homo sapiens	363-366
35571705-13	2022	Ursolic acid activated the autophagic flow in 786-O cells, as evidenced by the accumulation of autophagic fluorescent spots and enhanced fluorescence intensity of autophagosomes, and the combined use of the autophagy inhibitor CQ increased the expression level of LC3II compared to ursolic acid alone; ursolic acid decreased the expression levels of PTCH1, GLI1, SMO, SHH, and c-Myc and increased the expression level of Sufu in the hedgehog signaling pathway.	Chloroquine	227-229	sonic hedgehog signaling molecule	Homo sapiens	368-371
35571705-13	2022	Ursolic acid activated the autophagic flow in 786-O cells, as evidenced by the accumulation of autophagic fluorescent spots and enhanced fluorescence intensity of autophagosomes, and the combined use of the autophagy inhibitor CQ increased the expression level of LC3II compared to ursolic acid alone; ursolic acid decreased the expression levels of PTCH1, GLI1, SMO, SHH, and c-Myc and increased the expression level of Sufu in the hedgehog signaling pathway.	Chloroquine	227-229	MYC proto-oncogene, bHLH transcription factor	Homo sapiens	377-382
35571705-13	2022	Ursolic acid activated the autophagic flow in 786-O cells, as evidenced by the accumulation of autophagic fluorescent spots and enhanced fluorescence intensity of autophagosomes, and the combined use of the autophagy inhibitor CQ increased the expression level of LC3II compared to ursolic acid alone; ursolic acid decreased the expression levels of PTCH1, GLI1, SMO, SHH, and c-Myc and increased the expression level of Sufu in the hedgehog signaling pathway.	Chloroquine	227-229	SUFU negative regulator of hedgehog signaling	Homo sapiens	421-425
35438806-6	2022	Moreover, poly(I:C) significantly promoted cell survival by restoring autophagy flux and then regulating it to an adequate level Increased autophagy protein Beclin1 and LC3II together with p62 degradation after additional chloroquine.	Chloroquine	222-233	beclin 1	Rattus norvegicus	157-164
35438806-6	2022	Moreover, poly(I:C) significantly promoted cell survival by restoring autophagy flux and then regulating it to an adequate level Increased autophagy protein Beclin1 and LC3II together with p62 degradation after additional chloroquine.	Chloroquine	222-233	microtubule-associated protein 1 light chain 3 alpha	Rattus norvegicus	169-174
35219693-8	2022	Furthermore, CQ trapped Beclin 1 with Bcl-2, disturbing autophagy initiation and autolysosome formation.	Chloroquine	13-15	BCL2 apoptosis regulator	Homo sapiens	38-43
35438806-6	2022	Moreover, poly(I:C) significantly promoted cell survival by restoring autophagy flux and then regulating it to an adequate level Increased autophagy protein Beclin1 and LC3II together with p62 degradation after additional chloroquine.	Chloroquine	222-233	KH RNA binding domain containing, signal transduction associated 1	Rattus norvegicus	189-192
35219693-9	2022	However, D4476 alleviated CQ-induced effects by rescuing ARPE-19 cells from CQ-induced toxicity by modulating the association between Beclin 1 and Bcl-2.	Chloroquine	76-78	beclin 1	Homo sapiens	134-142
35219693-9	2022	However, D4476 alleviated CQ-induced effects by rescuing ARPE-19 cells from CQ-induced toxicity by modulating the association between Beclin 1 and Bcl-2.	Chloroquine	76-78	BCL2 apoptosis regulator	Homo sapiens	147-152
35192123-12	2022	The lysosome inhibitor chloroquine increases the localization of BMPR2 to the plasma membrane enhancing JL5-induced downregulation of ID1 and cell death in SD2 cells.	Chloroquine	23-34	bone morphogenetic protein receptor type 2	Homo sapiens	65-70
35192123-12	2022	The lysosome inhibitor chloroquine increases the localization of BMPR2 to the plasma membrane enhancing JL5-induced downregulation of ID1 and cell death in SD2 cells.	Chloroquine	23-34	inhibitor of DNA binding 1, HLH protein	Homo sapiens	134-137
35195807-9	2022	The results revealed that insufficient autophagy in CQ-induced foam cells could lead to foam cell death in atherosclerotic plaques, and the cause of cell death was that insufficient autophagy in foam cells turned off the positive effect of Nfr2 antioxidant, initiated the negative effect of Nrf2 to promote intracellular reactive oxygen species production, and this negative effect promoted ferroptosis in foam cells.	Chloroquine	52-54	NFE2 like bZIP transcription factor 2	Homo sapiens	291-295
35493297-9	2022	Chloroquine influenced cell proliferation and apoptosis in cells targeted with SIRT2 siRNA.	Chloroquine	0-11	sirtuin 2	Mus musculus	79-84
35459209-4	2022	The efficacy of chloroquine (CQ) in combination with lorlatinib in ALK-positive NSCLC cells in vitro and in vivo was assessed using CCK-8, colony formation, immunofluorescence staining, flow cytometry analysis, western blot analysis, and xenograft implantation.	Chloroquine	16-27	ALK receptor tyrosine kinase	Homo sapiens	67-70
35459209-4	2022	The efficacy of chloroquine (CQ) in combination with lorlatinib in ALK-positive NSCLC cells in vitro and in vivo was assessed using CCK-8, colony formation, immunofluorescence staining, flow cytometry analysis, western blot analysis, and xenograft implantation.	Chloroquine	29-31	ALK receptor tyrosine kinase	Homo sapiens	67-70
35547752-0	2022	Erratum: Autophagy-lysosome inhibitor chloroquine prevents CTLA-4 degradation of T cells and attenuates acute rejection in murine skin and heart transplantation: Erratum.	Chloroquine	38-49	cytotoxic T-lymphocyte-associated protein 4	Mus musculus	59-65
35446871-8	2022	Data analysis revealed 693 long intergenic non-coding RNAS (lincRNAs), 480 pseudogenes, and 642 antisense RNAs that were differentially regulated with IFNgamma, IFNgamma+TX and IFNgamma+CQ treatments.	Chloroquine	186-188	interferon gamma	Homo sapiens	177-185
35459209-7	2022	Meanwhile, we found that the combination of lorlatinib and CQ, an inhibitor of autophagy, inhibited autophagy and promoted apoptosis both in vitro and in vivo, which sensitized cells to lorlatinib through the dephosphorylation of Foxo3a and promoted nuclear translocation, then activation of Foxo3a/Bim axis.	Chloroquine	59-61	forkhead box O3	Homo sapiens	230-236
35459209-7	2022	Meanwhile, we found that the combination of lorlatinib and CQ, an inhibitor of autophagy, inhibited autophagy and promoted apoptosis both in vitro and in vivo, which sensitized cells to lorlatinib through the dephosphorylation of Foxo3a and promoted nuclear translocation, then activation of Foxo3a/Bim axis.	Chloroquine	59-61	forkhead box O3	Homo sapiens	292-298
35459209-7	2022	Meanwhile, we found that the combination of lorlatinib and CQ, an inhibitor of autophagy, inhibited autophagy and promoted apoptosis both in vitro and in vivo, which sensitized cells to lorlatinib through the dephosphorylation of Foxo3a and promoted nuclear translocation, then activation of Foxo3a/Bim axis.	Chloroquine	59-61	BCL2 like 11	Homo sapiens	299-302
35601684-1	2022	A series of chloroquine analogs were designed to search for a less toxic chloroquine derivative as a potential SARS-CoV-2 Mpro inhibitor.	Chloroquine	73-84	NEWENTRY	Severe acute respiratory syndrome-related coronavirus	122-126
35443746-6	2022	Moreover, increased autophagic flux was observed in RPV-exposed HSC as revealed by tandem fluorescence-tagged LC3 and p62 and analysis of LC3-II accumulation in cells exposed to the lysosomal inhibitor chloroquine.	Chloroquine	202-213	microtubule-associated protein 1 light chain 3 alpha	Mus musculus	138-141
35429395-7	2022	The mdr1-YY haplotype, associated with chloroquine and amodiaquine resistance, decreased over time, while the NY (wildtype) and the NF (modulates response to lumefantrine) haplotypes increased.	Chloroquine	39-50	ATP binding cassette subfamily B member 1	Homo sapiens	4-8
35182971-12	2022	Compared with those of model group, LC3 A/B and P62 were significantly downregulated in chloroquine group and MITO-Tempol group, and upregulated in resveratrol group (P < 0.05).	Chloroquine	88-99	KH RNA binding domain containing, signal transduction associated 1	Rattus norvegicus	48-51
35354793-10	2022	Adding the autophagy inhibitor 3-methyladenine or chloroquine attenuated the inhibitory effect of Irisin on beta-GP-induced ROS production, NLRP3 inflammasome activation, pyroptosis, and calcification in VSMCs.	Chloroquine	50-61	NLR family, pyrin domain containing 3	Mus musculus	140-145
35066892-5	2022	Among 12 Mrgprs deleted in Mrgpr-clusterDelta-/- mice, the expression of MrgprC11 and MrgprA3 are significantly increased in ACD model, which also innervate the skin and spinal cord at higher-than-normal densities, the proportions of dorsal root ganglia neurons responding to bovine adrenal medulla peptide 8-22 and chloroquine are also remarkably increased in ACD model and result in enhancing itch behavior.	Chloroquine	316-327	MAS-related GPR, member X1	Mus musculus	73-81
35066892-5	2022	Among 12 Mrgprs deleted in Mrgpr-clusterDelta-/- mice, the expression of MrgprC11 and MrgprA3 are significantly increased in ACD model, which also innervate the skin and spinal cord at higher-than-normal densities, the proportions of dorsal root ganglia neurons responding to bovine adrenal medulla peptide 8-22 and chloroquine are also remarkably increased in ACD model and result in enhancing itch behavior.	Chloroquine	316-327	MAS-related GPR, member A3	Mus musculus	86-93
35421957-0	2022	Proteomics analysis: inhibiting the expression of P62 protein by chloroquine combined with dacarbazine can reduce the malignant progression of uveal melanoma.	Chloroquine	65-76	sequestosome 1	Mus musculus	50-53
35421957-10	2022	Besides this malignancy, the key protein p62 (SQSTM1), selected from 5267 quantifiable differential proteomics databases, was a multifunctional autophagy linker protein, and its expression could be suppressed by chloroquine and dacarbazine.	Chloroquine	212-223	sequestosome 1	Mus musculus	41-44
35421957-10	2022	Besides this malignancy, the key protein p62 (SQSTM1), selected from 5267 quantifiable differential proteomics databases, was a multifunctional autophagy linker protein, and its expression could be suppressed by chloroquine and dacarbazine.	Chloroquine	212-223	sequestosome 1	Mus musculus	46-52
35373707-3	2022	We found that cisplatin-resistant I-10 testicular cancer cell lines (I-10/CDDP) autophagy-associated proteins (p62, p-mTOR, mTOR and LC3) exhibited high levels of autophagy in their expression, while LC3-II expression was more significantly in the presence of lysosomal degradation blocked by chloroquine (CQ).	Chloroquine	293-304	nucleoporin 62	Mus musculus	111-114
35373707-3	2022	We found that cisplatin-resistant I-10 testicular cancer cell lines (I-10/CDDP) autophagy-associated proteins (p62, p-mTOR, mTOR and LC3) exhibited high levels of autophagy in their expression, while LC3-II expression was more significantly in the presence of lysosomal degradation blocked by chloroquine (CQ).	Chloroquine	293-304	mechanistic target of rapamycin kinase	Mus musculus	124-128
35373707-3	2022	We found that cisplatin-resistant I-10 testicular cancer cell lines (I-10/CDDP) autophagy-associated proteins (p62, p-mTOR, mTOR and LC3) exhibited high levels of autophagy in their expression, while LC3-II expression was more significantly in the presence of lysosomal degradation blocked by chloroquine (CQ).	Chloroquine	293-304	microtubule-associated protein 1 light chain 3 alpha	Mus musculus	133-136
35373707-3	2022	We found that cisplatin-resistant I-10 testicular cancer cell lines (I-10/CDDP) autophagy-associated proteins (p62, p-mTOR, mTOR and LC3) exhibited high levels of autophagy in their expression, while LC3-II expression was more significantly in the presence of lysosomal degradation blocked by chloroquine (CQ).	Chloroquine	306-308	nucleoporin 62	Mus musculus	111-114
35373707-3	2022	We found that cisplatin-resistant I-10 testicular cancer cell lines (I-10/CDDP) autophagy-associated proteins (p62, p-mTOR, mTOR and LC3) exhibited high levels of autophagy in their expression, while LC3-II expression was more significantly in the presence of lysosomal degradation blocked by chloroquine (CQ).	Chloroquine	306-308	mechanistic target of rapamycin kinase	Mus musculus	124-128
35373707-3	2022	We found that cisplatin-resistant I-10 testicular cancer cell lines (I-10/CDDP) autophagy-associated proteins (p62, p-mTOR, mTOR and LC3) exhibited high levels of autophagy in their expression, while LC3-II expression was more significantly in the presence of lysosomal degradation blocked by chloroquine (CQ).	Chloroquine	306-308	microtubule-associated protein 1 light chain 3 alpha	Mus musculus	133-136
35348729-8	2022	The increased efficacy of mTOR inhibition plus T-DM1 was abrogated by lysosome inhibitors (chloroquine and bafilomycin A1).	Chloroquine	91-102	mechanistic target of rapamycin kinase	Homo sapiens	26-30
35337173-7	2022	The four compounds exhibited potent inhibitory activity ranging from 40.23 +- 0.09 to 44.90 +- 0.08 nM and 40.27 +- 0.17 to 44.83 +- 0.16 nM, respectively, when compared with chloroquine as a reference standard, which showed 45 +- 0.02 and 45 +- 0.06 nM against RdRp and spike glycoprotein, respectively.	Chloroquine	175-186	ORF1a polyprotein;ORF1ab polyprotein	Severe acute respiratory syndrome coronavirus 2	262-266
35240890-7	2022	We found decreased levels of iNOS and eNOS in the groups that received 1.5 mg/kg DXR alone and in combination with 25 mg/kg and 50 mg/kg CQ.	Chloroquine	137-139	nitric oxide synthase 2, inducible	Mus musculus	29-33
35305662-7	2022	Furthermore, we found that mitochondrial fission led to the activation of PINK1-mediated mitophagy, and pharmacological inhibition with wortmannin, chloroquine or genetical inhibition with siRNA-mediated knockdown of PINK1 profoundly repressed mitophagy, suggesting that the protective role of mitochondrial fission and PINK1-mediated mitophagy in CuONPs-induced toxicity.	Chloroquine	148-159	PTEN induced kinase 1	Homo sapiens	74-79
35305662-7	2022	Furthermore, we found that mitochondrial fission led to the activation of PINK1-mediated mitophagy, and pharmacological inhibition with wortmannin, chloroquine or genetical inhibition with siRNA-mediated knockdown of PINK1 profoundly repressed mitophagy, suggesting that the protective role of mitochondrial fission and PINK1-mediated mitophagy in CuONPs-induced toxicity.	Chloroquine	148-159	PTEN induced kinase 1	Homo sapiens	320-325
35326559-7	2022	Conversely, chloroquine treatment impaired autolysosomal flux and exacerbated malignance, showing jeopardization of p62/ Sqxtm1 turnover, leading to Yap accumulation, which is also consistent with overexpression of cystatin A (CSTA) in situ with pancreatic cancer cells and metastatic tumor.	Chloroquine	12-23	nucleoporin 62	Mus musculus	116-119
35326559-7	2022	Conversely, chloroquine treatment impaired autolysosomal flux and exacerbated malignance, showing jeopardization of p62/ Sqxtm1 turnover, leading to Yap accumulation, which is also consistent with overexpression of cystatin A (CSTA) in situ with pancreatic cancer cells and metastatic tumor.	Chloroquine	12-23	yes-associated protein 1	Mus musculus	149-152
35326559-7	2022	Conversely, chloroquine treatment impaired autolysosomal flux and exacerbated malignance, showing jeopardization of p62/ Sqxtm1 turnover, leading to Yap accumulation, which is also consistent with overexpression of cystatin A (CSTA) in situ with pancreatic cancer cells and metastatic tumor.	Chloroquine	12-23	cystatin A1	Mus musculus	215-225
35326559-7	2022	Conversely, chloroquine treatment impaired autolysosomal flux and exacerbated malignance, showing jeopardization of p62/ Sqxtm1 turnover, leading to Yap accumulation, which is also consistent with overexpression of cystatin A (CSTA) in situ with pancreatic cancer cells and metastatic tumor.	Chloroquine	12-23	cystatin A1	Mus musculus	227-231
35285161-7	2022	Competitive binding assays using CaM sensors with different Ca2+ dependencies showed that chloroquine directly binds CaM in a Ca2+ -dependent fashion.	Chloroquine	90-101	calmodulin 1	Homo sapiens	33-36
35285161-7	2022	Competitive binding assays using CaM sensors with different Ca2+ dependencies showed that chloroquine directly binds CaM in a Ca2+ -dependent fashion.	Chloroquine	90-101	calmodulin 1	Homo sapiens	117-120
35240890-7	2022	We found decreased levels of iNOS and eNOS in the groups that received 1.5 mg/kg DXR alone and in combination with 25 mg/kg and 50 mg/kg CQ.	Chloroquine	137-139	nitric oxide synthase 3, endothelial cell	Mus musculus	38-42
35091169-3	2022	Screening of a set of compounds with drug/natural product-based sub-structural motifs led to the identification of spirocyclic chroman-4-one 1 with promising antimalarial activity against the chloroquine-resistant Dd2 and chloroquine-sensitive 3D7 strains of the parasite.	Chloroquine	192-203	aldo-keto reductase family 1 member C2	Homo sapiens	214-217
35000547-3	2022	In our recent study, we uncovered a new role for RABEP1/Rabaptin5, a long-established regulator of early endosome function, in targeting the autophagy machinery to early endosomes damaged by chloroquine or by internalized Salmonella via interaction with RB1CC1/FIP200 and ATG16L1.	Chloroquine	191-202	rabaptin, RAB GTPase binding effector protein 1	Homo sapiens	49-55
35000547-3	2022	In our recent study, we uncovered a new role for RABEP1/Rabaptin5, a long-established regulator of early endosome function, in targeting the autophagy machinery to early endosomes damaged by chloroquine or by internalized Salmonella via interaction with RB1CC1/FIP200 and ATG16L1.	Chloroquine	191-202	rabaptin, RAB GTPase binding effector protein 1	Homo sapiens	56-65
35000547-3	2022	In our recent study, we uncovered a new role for RABEP1/Rabaptin5, a long-established regulator of early endosome function, in targeting the autophagy machinery to early endosomes damaged by chloroquine or by internalized Salmonella via interaction with RB1CC1/FIP200 and ATG16L1.	Chloroquine	191-202	RB1 inducible coiled-coil 1	Homo sapiens	254-260
35000547-3	2022	In our recent study, we uncovered a new role for RABEP1/Rabaptin5, a long-established regulator of early endosome function, in targeting the autophagy machinery to early endosomes damaged by chloroquine or by internalized Salmonella via interaction with RB1CC1/FIP200 and ATG16L1.	Chloroquine	191-202	RB1 inducible coiled-coil 1	Homo sapiens	261-267
35000547-3	2022	In our recent study, we uncovered a new role for RABEP1/Rabaptin5, a long-established regulator of early endosome function, in targeting the autophagy machinery to early endosomes damaged by chloroquine or by internalized Salmonella via interaction with RB1CC1/FIP200 and ATG16L1.	Chloroquine	191-202	autophagy related 16 like 1	Homo sapiens	272-279
35113458-7	2022	The weak base chloroquine promoted the release of HIV-1 Tat from endolysosomes and induced HIV-1 LTR transactivation.	Chloroquine	14-25	tyrosine aminotransferase	Homo sapiens	56-59
35106915-10	2022	The cleavage of the apoptosis-related markers caspase-3 and caspase-9 and the activity of caspase-3 induced by ASK were markedly reduced by inhibitor of AMPK (compound C), an autophagy inhibitor 3-methyladenine (3-MA) and another autophagy inhibitor chloroquine (CQ).	Chloroquine	250-261	caspase 3	Homo sapiens	90-99
35299695-5	2022	Morphological data showed that both histamine and chloroquine stimuli induced FOS expression in ZI PV neurons.	Chloroquine	50-61	FBJ osteosarcoma oncogene	Mus musculus	78-81
35120923-6	2022	Furthermore, Cx50 levels as detected by immunoblotting were lower in Cx50S258F and Cx50S259Y mutants than in the wild type or the aspartate substitution mutants, and chloroquine or ammonium chloride treatment significantly increased Cx50S258F and Cx50S259Y protein levels, implying participation of the lysosome in their increased degradation.	Chloroquine	166-177	gap junction protein alpha 8	Homo sapiens	13-17
35106915-10	2022	The cleavage of the apoptosis-related markers caspase-3 and caspase-9 and the activity of caspase-3 induced by ASK were markedly reduced by inhibitor of AMPK (compound C), an autophagy inhibitor 3-methyladenine (3-MA) and another autophagy inhibitor chloroquine (CQ).	Chloroquine	263-265	caspase 3	Homo sapiens	90-99
35308042-8	2022	Compared with any single drug, Chloroquine/Tamoxifen combination together with IFN-gamma pronouncedly up-regulated the transcription of several MSC immune regulators such as COX-2, PD-L1, HO-1 especially iNOS/IDO.	Chloroquine	31-42	cytochrome c oxidase II, mitochondrial	Mus musculus	174-179
35220892-0	2022	Chloroquine treatment induces secretion of autophagy-related proteins and inclusion of Atg8-family proteins in distinct extracellular vesicle populations.	Chloroquine	0-11	GABA type A receptor associated protein like 2	Homo sapiens	87-91
35220892-3	2022	We showed that lysosomal and autophagy inhibition by CQ altered the secretome, and induced the release of Atg8 orthologs and autophagy receptors.	Chloroquine	53-55	GABA type A receptor associated protein like 2	Homo sapiens	106-110
35220892-5	2022	CQ treatment enhanced the release of Atg8-family proteins inside sEVs.	Chloroquine	0-2	GABA type A receptor associated protein like 2	Homo sapiens	37-41
35308042-8	2022	Compared with any single drug, Chloroquine/Tamoxifen combination together with IFN-gamma pronouncedly up-regulated the transcription of several MSC immune regulators such as COX-2, PD-L1, HO-1 especially iNOS/IDO.	Chloroquine	31-42	CD274 antigen	Mus musculus	181-186
35308042-8	2022	Compared with any single drug, Chloroquine/Tamoxifen combination together with IFN-gamma pronouncedly up-regulated the transcription of several MSC immune regulators such as COX-2, PD-L1, HO-1 especially iNOS/IDO.	Chloroquine	31-42	heme oxygenase 1	Mus musculus	188-192
35308042-8	2022	Compared with any single drug, Chloroquine/Tamoxifen combination together with IFN-gamma pronouncedly up-regulated the transcription of several MSC immune regulators such as COX-2, PD-L1, HO-1 especially iNOS/IDO.	Chloroquine	31-42	nitric oxide synthase 2, inducible	Mus musculus	204-208
35308042-8	2022	Compared with any single drug, Chloroquine/Tamoxifen combination together with IFN-gamma pronouncedly up-regulated the transcription of several MSC immune regulators such as COX-2, PD-L1, HO-1 especially iNOS/IDO.	Chloroquine	31-42	indoleamine 2,3-dioxygenase 1	Mus musculus	209-212
35201948-3	2022	To identify targets that sensitize PDAC cells to autophagy inhibition, we performed a CRISPR-Cas9 genetic loss-of-function screen in cells treated with the lysosomal inhibitor chloroquine (CQ) and identified IGF1R as a sensitizer.	Chloroquine	176-187	insulin like growth factor 1 receptor	Homo sapiens	208-213
35201948-3	2022	To identify targets that sensitize PDAC cells to autophagy inhibition, we performed a CRISPR-Cas9 genetic loss-of-function screen in cells treated with the lysosomal inhibitor chloroquine (CQ) and identified IGF1R as a sensitizer.	Chloroquine	189-191	insulin like growth factor 1 receptor	Homo sapiens	208-213
35201948-4	2022	IGF1R inhibition increases autophagic flux and sensitivity to CQ-mediated growth suppression both in vitro and in vivo.	Chloroquine	62-64	insulin like growth factor 1 receptor	Homo sapiens	0-5
35201948-7	2022	In summary, IGF1R and MAPK/ERK signaling promotes resistance to CQ/HCQ in PDAC, and their dual inhibition increases sensitivity to autophagy inhibitors.	Chloroquine	64-67	insulin like growth factor 1 receptor	Homo sapiens	12-17
35201948-7	2022	In summary, IGF1R and MAPK/ERK signaling promotes resistance to CQ/HCQ in PDAC, and their dual inhibition increases sensitivity to autophagy inhibitors.	Chloroquine	64-67	mitogen-activated protein kinase 3	Homo sapiens	22-26
35201948-7	2022	In summary, IGF1R and MAPK/ERK signaling promotes resistance to CQ/HCQ in PDAC, and their dual inhibition increases sensitivity to autophagy inhibitors.	Chloroquine	64-67	mitogen-activated protein kinase 1	Homo sapiens	27-30
35164848-4	2022	METHODS: The intracellular level of NOTCH1 intracellular domain (NICD) in several cancer cells was studied under starvation, treatment with chloroquine or ATG7-knockdown.	Chloroquine	140-151	notch receptor 1	Homo sapiens	36-42
35156370-5	2022	Meanwhile, chloroquine (CQ) released from nanoparticles (NPs) minimizes protective autophagy caused by cisplatin in tumor cells and reprograms the metabolism of TAMs to enhance the proportion of proinflammatory macrophages, achieving a superior synergistic effect of chemoimmunotherapy combined with Pt(IV) and anti-PD-L1 peptide (DPPA-1).	Chloroquine	11-22	CD274 molecule	Homo sapiens	316-321
35156370-5	2022	Meanwhile, chloroquine (CQ) released from nanoparticles (NPs) minimizes protective autophagy caused by cisplatin in tumor cells and reprograms the metabolism of TAMs to enhance the proportion of proinflammatory macrophages, achieving a superior synergistic effect of chemoimmunotherapy combined with Pt(IV) and anti-PD-L1 peptide (DPPA-1).	Chloroquine	24-26	CD274 molecule	Homo sapiens	316-321
35203701-5	2022	The LL-37/poly I:C-induced upregulation of TLR3 mRNA expression was prevented by the endosomal acidification inhibitor chloroquine, indicating involvement of downstream TLR3 signaling.	Chloroquine	119-130	cathelicidin antimicrobial peptide	Homo sapiens	4-9
35203701-5	2022	The LL-37/poly I:C-induced upregulation of TLR3 mRNA expression was prevented by the endosomal acidification inhibitor chloroquine, indicating involvement of downstream TLR3 signaling.	Chloroquine	119-130	toll like receptor 3	Homo sapiens	43-47
35203701-5	2022	The LL-37/poly I:C-induced upregulation of TLR3 mRNA expression was prevented by the endosomal acidification inhibitor chloroquine, indicating involvement of downstream TLR3 signaling.	Chloroquine	119-130	toll like receptor 3	Homo sapiens	169-173
35151662-7	2022	While the mechanism of protection is still unknown, we propose that it could be mediated by increased autophagy, as chloroquine treatment re-sensitized nCDase-/- mice to AKI development.	Chloroquine	116-127	N-acylsphingosine amidohydrolase 2	Mus musculus	152-158
35145060-5	2022	Pharmacological inhibition of XBP1 using pre-treatment with STF-083010 (STF, 75 mg/kg) and autophagy induction with Rapamycin (RAPA, 8 mg/kg) or blockade with Chloroquine (CQ, 60 mg/kg) was also undertaken in vivo.	Chloroquine	172-174	X-box binding protein 1	Mus musculus	30-34
35007347-5	2022	In contrast, the inhibitors of endosomal acidification bafilomycin A1 and chloroquine increased levels of LC3-II, due to reduced degradation in acidic lysosomes.	Chloroquine	74-85	microtubule associated protein 1 light chain 3 alpha	Homo sapiens	106-112
35211119-7	2022	Results: CQ suppressed Toll-Like-Receptor (TLR)-9 induced B-cell proliferation in a dose-dependent manner.	Chloroquine	9-11	toll like receptor 9	Homo sapiens	23-49
35211119-8	2022	IL-10pos regulatory B-cells were suppressed by CQ already at low concentrations whereas anti-IgG/IgM-induced GrB secreting regulatory B-cells were less susceptible.	Chloroquine	47-49	interleukin 10	Homo sapiens	0-5
35211119-11	2022	Conclusion: In conclusion, CQ had a suppressive effect on IL-10 regulatory B-cells whereas GrB secreting regulatory B-cells were less affected.	Chloroquine	27-29	interleukin 10	Homo sapiens	58-63
35135993-7	2022	In-vivo Ca2+ imaging and electrophysiological recording revealed that chloroquine and other agonists of Mrgpr receptors excited DRG neurons via ANO1.	Chloroquine	70-81	anoctamin 1, calcium activated chloride channel	Mus musculus	144-148
35059394-4	2021	Overexpression of PINK1 activated autophagy, and chloroquine but not MG132 reversed the PINK1-induced decrease in human Tau levels and cognitive improvement in hTau mice.	Chloroquine	49-60	PTEN induced kinase 1	Homo sapiens	18-23
35163553-9	2022	As the autophagy was suppressed through the autophagy inhibitor chloroquine, hinokitiol-induced senescence in U-2 OS cells was significantly enhanced accompanying more abundant p53 expression.	Chloroquine	64-75	tumor protein p53	Homo sapiens	177-180
35140705-9	2021	However, the inhibition of EVR on TNF-alpha-induced EMT was partly reversed following the addition of autophagy inhibitor chloroquine.	Chloroquine	122-133	tumor necrosis factor	Homo sapiens	34-43
35249871-5	2022	Western blotting was performed to observe the effect of 27-P-CAUA and chloroquine pretreatment on the expressions of LC3I/II, P62 and HER2 signaling pathway proteins in the cells.	Chloroquine	70-81	nucleoporin 62	Homo sapiens	126-129
35249871-5	2022	Western blotting was performed to observe the effect of 27-P-CAUA and chloroquine pretreatment on the expressions of LC3I/II, P62 and HER2 signaling pathway proteins in the cells.	Chloroquine	70-81	erb-b2 receptor tyrosine kinase 2	Homo sapiens	134-138
34996966-3	2022	Here we scrutinize this approach and show that bafilomycin A1 (BafA) but not chloroquine is suitable for flux quantification due to the stimulating effect of chloroquine on non-canonical LC3B-lipidation.	Chloroquine	158-169	microtubule associated protein 1 light chain 3 beta	Homo sapiens	187-191
35082401-10	2022	Blocking autophagy with 3-MA, chloroquine or siSQSTM1 prevented CRHBP degradation in HCC cells.	Chloroquine	30-41	corticotropin releasing hormone binding protein	Homo sapiens	64-69
35145427-13	2021	Chloroquine (10 muM, 24 h) was used to impair KIR2.1 breakdown.	Chloroquine	0-11	potassium inwardly rectifying channel subfamily J member 2	Homo sapiens	46-52
35145427-17	2021	Chloroquine treatment (10 muM, 24 h) induced intracellular aggregation of KIR2.1 channels and enhanced interaction with the actin/intermediate filament system (103 +- 90 fold; p < 0.05 vs. control).	Chloroquine	0-11	potassium inwardly rectifying channel subfamily J member 2	Homo sapiens	74-80
35096586-8	2021	In PC3 cells, the HeyL-aromatase axis promoted the PCSC phenotype by upregulating autophagy-related genes, while the autophagy inhibitor chloroquine (CQ) suppressed the aromatase-induced PCSC phenotype.	Chloroquine	137-148	hes related family bHLH transcription factor with YRPW motif like	Homo sapiens	18-22
35096586-8	2021	In PC3 cells, the HeyL-aromatase axis promoted the PCSC phenotype by upregulating autophagy-related genes, while the autophagy inhibitor chloroquine (CQ) suppressed the aromatase-induced PCSC phenotype.	Chloroquine	150-152	hes related family bHLH transcription factor with YRPW motif like	Homo sapiens	18-22
35096638-7	2021	We found that overexpression of Egr-1 inhibited the phagocytic activity of macrophages, and the autophagy activator rapamycin and inhibitor chloroquine could reverse the effects of Egr-1 knockdown and Egr-1 overexpression on phagocytosis of P. aeruginosa, respectively.	Chloroquine	140-151	early growth response 1	Mus musculus	181-186
35096638-7	2021	We found that overexpression of Egr-1 inhibited the phagocytic activity of macrophages, and the autophagy activator rapamycin and inhibitor chloroquine could reverse the effects of Egr-1 knockdown and Egr-1 overexpression on phagocytosis of P. aeruginosa, respectively.	Chloroquine	140-151	early growth response 1	Mus musculus	201-206
35059394-4	2021	Overexpression of PINK1 activated autophagy, and chloroquine but not MG132 reversed the PINK1-induced decrease in human Tau levels and cognitive improvement in hTau mice.	Chloroquine	49-60	microtubule associated protein tau	Homo sapiens	120-123
35499056-10	2022	The autophagy inhibitors 3-MA, bafilomycin and chloroquine reversed the protective effects of LRRK2 deficiency.	Chloroquine	47-58	leucine-rich repeat kinase 2	Mus musculus	94-99
35288479-12	2021	After treatment with rapamycin or chloroquine, the effect of VDR activation or VDR silencing in ER stress was partially reversed.	Chloroquine	34-45	vitamin D (1,25-dihydroxyvitamin D3) receptor	Mus musculus	61-64
35288479-12	2021	After treatment with rapamycin or chloroquine, the effect of VDR activation or VDR silencing in ER stress was partially reversed.	Chloroquine	34-45	vitamin D (1,25-dihydroxyvitamin D3) receptor	Mus musculus	79-82