PMID-sentid Pub_year Sent_text compound_name comp_offset prot_official_name organism prot_offset 11509127-2 2001 METHODS: SMMC-7721 cells transfected with pBK-HCV using lipofectin transfection protocal were treated with oxymatrine. 1,2-dielaidoylphosphatidylethanolamine 56-66 PDZ binding kinase Homo sapiens 42-45 11230938-9 2001 However, following incubation with lipofectin, the inactivated bacteria as well as pcDNA3 became efficient inducers of IFN-alpha in whole blood cultures. 1,2-dielaidoylphosphatidylethanolamine 35-45 interferon-alpha-14 Sus scrofa 119-128 21044459-2 2001 METHODS: Antisense VEGF121 cDNA was transfected into PG cells(PG-AS-VEGF) by lipofectin. 1,2-dielaidoylphosphatidylethanolamine 77-87 vascular endothelial growth factor A Mus musculus 19-23 11436651-3 2001 The HBsAg expressing cell line was set up by transfection of plasmid pCI-dhfr-S into dhfr gene negative CHO cell line in the way of lipofectin. 1,2-dielaidoylphosphatidylethanolamine 132-142 dihydrofolate reductase Cricetulus griseus 73-77 11436651-3 2001 The HBsAg expressing cell line was set up by transfection of plasmid pCI-dhfr-S into dhfr gene negative CHO cell line in the way of lipofectin. 1,2-dielaidoylphosphatidylethanolamine 132-142 dihydrofolate reductase Cricetulus griseus 85-89 11866926-2 2000 METHODS: Lipofectin method was used to transfect antisense-TGF-beta1 vector into MsC, Western blot and Northern blot analysis for detecting TGF-beta1 peptides and antisense TGF-beta1 RNA level. 1,2-dielaidoylphosphatidylethanolamine 9-19 transforming growth factor, beta 1 Rattus norvegicus 59-68 11474253-4 2001 Murine Meth-A fibrosarcoma cells were transfected with the hIL-17 gene using the lipofectin method. 1,2-dielaidoylphosphatidylethanolamine 81-91 interleukin 17A Homo sapiens 59-65 11235562-2 2000 METHODS: The mdr1 gene was transfected into murine and human bone marrow cells by Lipofectin. 1,2-dielaidoylphosphatidylethanolamine 82-92 ATP-binding cassette, sub-family B (MDR/TAP), member 1B Mus musculus 13-17 11374170-5 2000 About 56% of HL-60 cells exposed to c-myc AS-ODN/lipofectin complex were NBT-positive and showed morphological changes with differentiated phenotype compared with 29% of untreated cells. 1,2-dielaidoylphosphatidylethanolamine 49-59 MYC proto-oncogene, bHLH transcription factor Homo sapiens 36-41 10922227-2 2000 DESIGN: Squamous cell carcinoma of the head and neck (SCCHN) cells were stably transfected with an antisense cyclin D1 using lipofectin-mediated transfection. 1,2-dielaidoylphosphatidylethanolamine 125-135 cyclin D1 Homo sapiens 109-118 11341998-5 2001 The results of these experiments indicate that tumor necrosis factor (TNF)-alpha dramatically inhibits Lipofectin-mediated transfection efficiency of H441 cells. 1,2-dielaidoylphosphatidylethanolamine 103-113 tumor necrosis factor Homo sapiens 47-80 11182147-4 2001 The plasmid, as well as poly(I):poly(C), required lipofectin to induce IFN-alpha production whereas both preparations induced IL-6 irrespective of preincubation with lipofectin. 1,2-dielaidoylphosphatidylethanolamine 50-60 interferon alpha 1 Homo sapiens 71-80 11182147-7 2001 Interestingly, also A. pleuropneumoniae induced a substantial production of IFN-alpha when preincubated with lipofectin. 1,2-dielaidoylphosphatidylethanolamine 109-119 interferon alpha 1 Homo sapiens 76-85 11941412-2 2000 Following transfection of the synthetic antisense c-src oligodeoxynucleotides (ODNs) wrapped in lipofectin into cultured rat VSMCs, pp60c-src content markedly decreased, pp60c-src kinase activity was only 14.4% of control, while MAPK activity was not significantly changed (P>0.05). 1,2-dielaidoylphosphatidylethanolamine 97-107 SRC proto-oncogene, non-receptor tyrosine kinase Rattus norvegicus 50-55 11941412-2 2000 Following transfection of the synthetic antisense c-src oligodeoxynucleotides (ODNs) wrapped in lipofectin into cultured rat VSMCs, pp60c-src content markedly decreased, pp60c-src kinase activity was only 14.4% of control, while MAPK activity was not significantly changed (P>0.05). 1,2-dielaidoylphosphatidylethanolamine 97-107 SRC proto-oncogene, non-receptor tyrosine kinase Rattus norvegicus 133-142 11866926-2 2000 METHODS: Lipofectin method was used to transfect antisense-TGF-beta1 vector into MsC, Western blot and Northern blot analysis for detecting TGF-beta1 peptides and antisense TGF-beta1 RNA level. 1,2-dielaidoylphosphatidylethanolamine 9-19 transforming growth factor, beta 1 Rattus norvegicus 140-149 11866926-2 2000 METHODS: Lipofectin method was used to transfect antisense-TGF-beta1 vector into MsC, Western blot and Northern blot analysis for detecting TGF-beta1 peptides and antisense TGF-beta1 RNA level. 1,2-dielaidoylphosphatidylethanolamine 9-19 transforming growth factor, beta 1 Rattus norvegicus 140-149 10905556-6 2000 Only two treatments produced a significant reduction in target mRNA: insulin-like growth factor-1 receptor (IGF-1R)-ODN 64 complexed with Cytofectin GSV (27.1% +/- 3.5% of IGF-1R mRNA in untreated cells,p < 0.01) and ODN 64 complexed with 10 microg/ml Lipofectin (62.2% +/- 3.4% of IGF-1R mRNA in untreated cells, p < 0.05). 1,2-dielaidoylphosphatidylethanolamine 255-265 insulin like growth factor 1 receptor Homo sapiens 69-106 10905556-6 2000 Only two treatments produced a significant reduction in target mRNA: insulin-like growth factor-1 receptor (IGF-1R)-ODN 64 complexed with Cytofectin GSV (27.1% +/- 3.5% of IGF-1R mRNA in untreated cells,p < 0.01) and ODN 64 complexed with 10 microg/ml Lipofectin (62.2% +/- 3.4% of IGF-1R mRNA in untreated cells, p < 0.05). 1,2-dielaidoylphosphatidylethanolamine 255-265 insulin like growth factor 1 receptor Homo sapiens 108-114 10905556-6 2000 Only two treatments produced a significant reduction in target mRNA: insulin-like growth factor-1 receptor (IGF-1R)-ODN 64 complexed with Cytofectin GSV (27.1% +/- 3.5% of IGF-1R mRNA in untreated cells,p < 0.01) and ODN 64 complexed with 10 microg/ml Lipofectin (62.2% +/- 3.4% of IGF-1R mRNA in untreated cells, p < 0.05). 1,2-dielaidoylphosphatidylethanolamine 255-265 insulin like growth factor 1 receptor Homo sapiens 172-178 10905556-6 2000 Only two treatments produced a significant reduction in target mRNA: insulin-like growth factor-1 receptor (IGF-1R)-ODN 64 complexed with Cytofectin GSV (27.1% +/- 3.5% of IGF-1R mRNA in untreated cells,p < 0.01) and ODN 64 complexed with 10 microg/ml Lipofectin (62.2% +/- 3.4% of IGF-1R mRNA in untreated cells, p < 0.05). 1,2-dielaidoylphosphatidylethanolamine 255-265 insulin like growth factor 1 receptor Homo sapiens 172-178 11778227-2 2000 METHODS: With GUC at 880 site of mdr1 mRNA selected as target point, plasmid expressing mdr1 ribozyme (pH beta Apr-1 neo/mdr1-Rb) was transduced to A549/R by lipofectin. 1,2-dielaidoylphosphatidylethanolamine 158-168 ATP binding cassette subfamily B member 1 Homo sapiens 88-92 11778227-2 2000 METHODS: With GUC at 880 site of mdr1 mRNA selected as target point, plasmid expressing mdr1 ribozyme (pH beta Apr-1 neo/mdr1-Rb) was transduced to A549/R by lipofectin. 1,2-dielaidoylphosphatidylethanolamine 158-168 ATP binding cassette subfamily B member 1 Homo sapiens 88-92 11778228-2 2000 METHODS: Exogenous p16 gene was transfected into CNE-2 cells by lipofectin. 1,2-dielaidoylphosphatidylethanolamine 64-74 cyclin dependent kinase inhibitor 2A Homo sapiens 19-22 10831277-7 2000 In contrast, the antisense PPS undecamer, when delivered to RS485 cells with Lipofectin reagent, inhibits human Ras p21 synthesis by more than 90% at a concentration of 3.2 microM, while the effect of controls with inverted, mismatched or scrambled sequence was minimal (5% or less) on p21 synthesis and RS485 cell growth. 1,2-dielaidoylphosphatidylethanolamine 77-87 H3 histone pseudogene 16 Homo sapiens 116-119 11324458-2 2000 METHODS: Antisense IRAK-2 ODN was delivered by lipofectin encapsulation into human embryonic kidney 293 cells (HEK 293 cells). 1,2-dielaidoylphosphatidylethanolamine 47-57 interleukin 1 receptor associated kinase 2 Homo sapiens 19-25 10716927-1 2000 It has recently been reported that N-ethylmaleimide-sensitive fusion ATPase (NSF) can fuse protein-free liposomes containing substantial amounts of 1,2-dioleoylphosphatidylserine (DOPS) and 1, 2-dioleoyl-phosphatidyl-ethanolamine (DOPE) (Otter-Nilsson et al., 1999). 1,2-dielaidoylphosphatidylethanolamine 190-229 N-ethylmaleimide sensitive factor, vesicle fusing ATPase Homo sapiens 35-75 10716927-1 2000 It has recently been reported that N-ethylmaleimide-sensitive fusion ATPase (NSF) can fuse protein-free liposomes containing substantial amounts of 1,2-dioleoylphosphatidylserine (DOPS) and 1, 2-dioleoyl-phosphatidyl-ethanolamine (DOPE) (Otter-Nilsson et al., 1999). 1,2-dielaidoylphosphatidylethanolamine 190-229 N-ethylmaleimide sensitive factor, vesicle fusing ATPase Homo sapiens 77-80 10716927-1 2000 It has recently been reported that N-ethylmaleimide-sensitive fusion ATPase (NSF) can fuse protein-free liposomes containing substantial amounts of 1,2-dioleoylphosphatidylserine (DOPS) and 1, 2-dioleoyl-phosphatidyl-ethanolamine (DOPE) (Otter-Nilsson et al., 1999). 1,2-dielaidoylphosphatidylethanolamine 231-235 N-ethylmaleimide sensitive factor, vesicle fusing ATPase Homo sapiens 35-75 10716927-1 2000 It has recently been reported that N-ethylmaleimide-sensitive fusion ATPase (NSF) can fuse protein-free liposomes containing substantial amounts of 1,2-dioleoylphosphatidylserine (DOPS) and 1, 2-dioleoyl-phosphatidyl-ethanolamine (DOPE) (Otter-Nilsson et al., 1999). 1,2-dielaidoylphosphatidylethanolamine 231-235 N-ethylmaleimide sensitive factor, vesicle fusing ATPase Homo sapiens 77-80 10678357-2 2000 We showed previously that addition of transferrin (TF) to Lipofectin enhanced the expression of a reporter gene in HeLa cells by 120-fold and achieved close to 100% transfection efficiency. 1,2-dielaidoylphosphatidylethanolamine 58-68 transferrin Homo sapiens 38-49 10678357-2 2000 We showed previously that addition of transferrin (TF) to Lipofectin enhanced the expression of a reporter gene in HeLa cells by 120-fold and achieved close to 100% transfection efficiency. 1,2-dielaidoylphosphatidylethanolamine 58-68 transferrin Homo sapiens 51-53 10678357-6 2000 Lipofectin supplemented with epidermal growth factor yielded the largest enhancement of lipofection efficiency (< or =23-fold over that by Lipofectin alone) in all three cell lines. 1,2-dielaidoylphosphatidylethanolamine 0-10 epidermal growth factor Homo sapiens 29-52 10678357-6 2000 Lipofectin supplemented with epidermal growth factor yielded the largest enhancement of lipofection efficiency (< or =23-fold over that by Lipofectin alone) in all three cell lines. 1,2-dielaidoylphosphatidylethanolamine 142-152 epidermal growth factor Homo sapiens 29-52 10572922-3 1999 A549, Calu3, and H292 cells grown to 90% confluence were transfected for 18 h with a plasmid DNA containing a beta-galactosidase reporter gene (pCMVlacZ) using lipofectin plus a lectin as the vector. 1,2-dielaidoylphosphatidylethanolamine 160-170 galactosidase beta 1 Homo sapiens 110-128 10565567-2 1999 Antisense IRAK-2 ODN was delivered by lipofectin encapsulation into cultured endothelial cells. 1,2-dielaidoylphosphatidylethanolamine 38-48 interleukin 1 receptor associated kinase 2 Homo sapiens 10-16 10715795-3 1999 After encapsulating the MMP-1 recombinant plasmid by lipofectin, we transferred it to the rat"s fibrotic liver in vivo intraperitoneally, then observed the effects of the plasmid on the fibrotic liver by RT-PCR, immunohistochemistry and the observation of pathology. 1,2-dielaidoylphosphatidylethanolamine 53-63 matrix metallopeptidase 1 Rattus norvegicus 24-29 10022881-11 1999 The elimination of mRNA, protein, and JNK activities lasted 48 and 72 h following a single Lipofectin treatment with antisense JNK1 and JNK2, respectively, indicating sufficient duration for examining the impact of specific elimination on the phenotype. 1,2-dielaidoylphosphatidylethanolamine 91-101 mitogen-activated protein kinase 8 Homo sapiens 38-41 10547162-5 1999 For both bacterial DNA and plasmid DNA, the presence of lipofectin led to a marked increase in the production of IFN-gamma under conditions in which increases in IL-12 production were limited. 1,2-dielaidoylphosphatidylethanolamine 56-66 interferon gamma Mus musculus 113-122 10445813-3 1999 Delivery of HIV-1 Gag, Pol, and Env proteins to DCs by lipofectin stimulated greater anti-HIV-1 memory CTL responses in cells from HIV-1-infected subjects than those induced by DCs loaded with protein alone. 1,2-dielaidoylphosphatidylethanolamine 55-65 Envelope surface glycoprotein gp160, precursor Human immunodeficiency virus 1 32-35 11775854-2 1999 METHODS: ASMC transfected with the antisense oligonucleodides of ECE vectored with lipofectin were established. 1,2-dielaidoylphosphatidylethanolamine 83-93 endothelin converting enzyme 1 Homo sapiens 65-68 10022881-11 1999 The elimination of mRNA, protein, and JNK activities lasted 48 and 72 h following a single Lipofectin treatment with antisense JNK1 and JNK2, respectively, indicating sufficient duration for examining the impact of specific elimination on the phenotype. 1,2-dielaidoylphosphatidylethanolamine 91-101 mitogen-activated protein kinase 8 Homo sapiens 127-131 10022881-11 1999 The elimination of mRNA, protein, and JNK activities lasted 48 and 72 h following a single Lipofectin treatment with antisense JNK1 and JNK2, respectively, indicating sufficient duration for examining the impact of specific elimination on the phenotype. 1,2-dielaidoylphosphatidylethanolamine 91-101 mitogen-activated protein kinase 9 Homo sapiens 136-140 9814985-6 1998 Pretreatment of cell monolayers with Lipofectin plus antisense oligonucleotide to PKC-epsilon for 48 h prevented stimulation of CFTR with (-)-epinephrine, reduced PKC-epsilon activity in unstimulated cells by 52.1%, and decreased PKC-epsilon mass by 76.1% but did not affect hormone-activated protein kinase A activity. 1,2-dielaidoylphosphatidylethanolamine 37-47 protein kinase C epsilon Homo sapiens 82-93 9924975-0 1998 Effect of polyisobutylcyanoacrylate nanoparticles and lipofectin loaded with oligonucleotides on cell viability and PKC alpha neosynthesis in HepG2 cells. 1,2-dielaidoylphosphatidylethanolamine 54-64 protein kinase C alpha Homo sapiens 116-125 9924975-8 1998 It was observed that both mismatch and antisense oligonucleotides induced an inhibition of PKC alpha neosynthesis when loaded onto cationic or anionic nanoparticles as well as when complexed to cationic liposomes (Lipofectin). 1,2-dielaidoylphosphatidylethanolamine 214-224 protein kinase C alpha Homo sapiens 91-100 10509736-6 1999 The cultures treated for 24 h with antisense oligos (CaB+PV) showed a significant decrease in [3H]-GABA uptake as compared with the cultures treated with lipofectin alone or with lipofectin + mismatched antisense oligos to CaB and PV mRNA. 1,2-dielaidoylphosphatidylethanolamine 154-164 calbindin 1 Mus musculus 53-56 10509736-6 1999 The cultures treated for 24 h with antisense oligos (CaB+PV) showed a significant decrease in [3H]-GABA uptake as compared with the cultures treated with lipofectin alone or with lipofectin + mismatched antisense oligos to CaB and PV mRNA. 1,2-dielaidoylphosphatidylethanolamine 154-164 parvalbumin Mus musculus 57-59 10509736-6 1999 The cultures treated for 24 h with antisense oligos (CaB+PV) showed a significant decrease in [3H]-GABA uptake as compared with the cultures treated with lipofectin alone or with lipofectin + mismatched antisense oligos to CaB and PV mRNA. 1,2-dielaidoylphosphatidylethanolamine 179-189 calbindin 1 Mus musculus 53-56 10509736-6 1999 The cultures treated for 24 h with antisense oligos (CaB+PV) showed a significant decrease in [3H]-GABA uptake as compared with the cultures treated with lipofectin alone or with lipofectin + mismatched antisense oligos to CaB and PV mRNA. 1,2-dielaidoylphosphatidylethanolamine 179-189 parvalbumin Mus musculus 57-59 9850083-13 1998 In separate experiments, the NFkappaB dominant negative genetic construct was cotransfected with the promoter-reporter constructs by means of Lipofectin reagent. 1,2-dielaidoylphosphatidylethanolamine 142-152 nuclear factor kappa B subunit 1 Homo sapiens 29-37 9814985-6 1998 Pretreatment of cell monolayers with Lipofectin plus antisense oligonucleotide to PKC-epsilon for 48 h prevented stimulation of CFTR with (-)-epinephrine, reduced PKC-epsilon activity in unstimulated cells by 52.1%, and decreased PKC-epsilon mass by 76.1% but did not affect hormone-activated protein kinase A activity. 1,2-dielaidoylphosphatidylethanolamine 37-47 protein kinase C epsilon Homo sapiens 163-174 9814985-6 1998 Pretreatment of cell monolayers with Lipofectin plus antisense oligonucleotide to PKC-epsilon for 48 h prevented stimulation of CFTR with (-)-epinephrine, reduced PKC-epsilon activity in unstimulated cells by 52.1%, and decreased PKC-epsilon mass by 76.1% but did not affect hormone-activated protein kinase A activity. 1,2-dielaidoylphosphatidylethanolamine 37-47 protein kinase C epsilon Homo sapiens 163-174 11877223-2 1998 METHODS: Plasmid DNA with beta-galactosidase gene carried by lipofectin was applied to primary cultured human lens epithelial cells. 1,2-dielaidoylphosphatidylethanolamine 61-71 galactosidase beta 1 Homo sapiens 26-44 9821109-0 1998 An antisense EGFR oligodeoxynucleotide enveloped in Lipofectin induces growth inhibition in human malignant gliomas in vitro. 1,2-dielaidoylphosphatidylethanolamine 52-62 epidermal growth factor receptor Homo sapiens 13-17 9821109-3 1998 At a concentration of 5 microM of the antisense EGFR oligodeoxynucleotide enveloped with Lipofectin, the proliferation of three malignant glioma cell lines was significantly inhibited (p < 0.05) compared with that of the cells exposed to 5 microM sense EGFR oligodeoxynucleotide. 1,2-dielaidoylphosphatidylethanolamine 89-99 epidermal growth factor receptor Homo sapiens 48-52 9821109-3 1998 At a concentration of 5 microM of the antisense EGFR oligodeoxynucleotide enveloped with Lipofectin, the proliferation of three malignant glioma cell lines was significantly inhibited (p < 0.05) compared with that of the cells exposed to 5 microM sense EGFR oligodeoxynucleotide. 1,2-dielaidoylphosphatidylethanolamine 89-99 epidermal growth factor receptor Homo sapiens 256-260 9821109-5 1998 These findings show that the antisense EGFR oligodeoxynucleotide enveloped with Lipofectin has a possibility to become a useful gene therapy against malignant gliomas. 1,2-dielaidoylphosphatidylethanolamine 80-90 epidermal growth factor receptor Homo sapiens 39-43 9756612-3 1998 In this work, we examined the IFN-inducibility of poly I:poly C complexed with several cationic reagents in mouse fibroblast L cells and found that Lipofectin and LipofectACE can induce the production of a substantial amount of type I IFNs (mostly beta-type) even at a two-order lower dose compared with poly I:poly C alone. 1,2-dielaidoylphosphatidylethanolamine 148-158 interferon alpha 1 Homo sapiens 30-33 11245009-4 1998 We then constructed the antisense cyclin D1 vector and transfected the PC-7 cell line with lipofectin. 1,2-dielaidoylphosphatidylethanolamine 91-101 cyclin D1 Homo sapiens 34-43 9271272-3 1997 Heterologous Chinese hamster ovary (CHO-K1) and human embryonic kidney 293 (HEK) cells were transfected with SSTR2 cDNA using lipofectin. 1,2-dielaidoylphosphatidylethanolamine 126-136 somatostatin receptor 2 Homo sapiens 109-114 9651480-7 1998 A 24-h exposure of THP-1/HIV-1IIIB cells to 5 microM Lipofectin or DOTAP:DOPE (1:1) complexed with either the functional or a modified control ribozyme reduced virus production by approximately 30%. 1,2-dielaidoylphosphatidylethanolamine 53-63 GLI family zinc finger 2 Homo sapiens 19-24 10923448-2 1998 METHODS: Antisense c-myc ODN was applied to the adventitia of injured abdominal aortae in rat introduced by pluronic gel releasing system and lipofectin delivery system. 1,2-dielaidoylphosphatidylethanolamine 142-152 MYC proto-oncogene, bHLH transcription factor Rattus norvegicus 19-24 10374398-2 1998 METHODS: A recombinant retroviral vector expressing antisense TGF alpha was constructed, and transfected the ecotropic packaging cell line psi-2 with lipofectin. 1,2-dielaidoylphosphatidylethanolamine 150-160 transforming growth factor alpha Homo sapiens 62-71 11819225-1 1998 AIM:To determine whether antisense insulin-like growth factor-I(IGF-I) gene can modulate CEA and AFP expression in human hepatoma cells (HepG2).METHODS: Transfection of HepG2 cells was accomplished using Lipofectin reagent. 1,2-dielaidoylphosphatidylethanolamine 204-214 insulin like growth factor 1 Homo sapiens 35-69 18982480-2 1997 Hepa 1 cells, which are known to contain a functional arylhydrocarbon receptor" were transfected with troutCYP1A-CAT using lipofectin. 1,2-dielaidoylphosphatidylethanolamine 123-133 catalase Mus musculus 113-116 9284894-6 1997 MIN6, a glucose-responsive pancreatic beta-cell line, was transfected with human IAPP cDNA by a lipofectin method. 1,2-dielaidoylphosphatidylethanolamine 96-106 islet amyloid polypeptide Homo sapiens 81-85 9149844-8 1997 A 10-fold lower concentration of the AS 1 oligonucleotide could be used to inhibit NGF synthesis if the cellular uptake was facilitated using lipofectin compared with addition of oligonucleotide directly to the culture medium. 1,2-dielaidoylphosphatidylethanolamine 142-152 nerve growth factor Gallus gallus 83-86 9181623-5 1997 At optimal lipid:DNA ratios, commercially available liposomes, Transfectam, Lipofectamine, and Lipofectin, produced luciferase activities that were 1.39, 1.03, and 0.47-fold those of DCC-liposomes. 1,2-dielaidoylphosphatidylethanolamine 95-105 DCC netrin 1 receptor Rattus norvegicus 183-186 9220401-4 1997 In this study we report that the block to cellular uptake could be overcome by mixing S-Tat with a cationic liposome, Lipofectin. 1,2-dielaidoylphosphatidylethanolamine 118-128 tyrosine aminotransferase Homo sapiens 88-91 9220401-5 1997 When mixed with Lipofectin, S-Tat effected a specific, concentration-dependent transactivation of HIV-1 LTR-directed reporter gene activity in Hela Cells. 1,2-dielaidoylphosphatidylethanolamine 16-26 Tat Human immunodeficiency virus 1 30-33 10374281-2 1997 The plasmid vector (BMGNeo-IL-2) carrying the human IL-2 gene was used to transduce the SGC-7901 GCC line by the lipofectin reagent. 1,2-dielaidoylphosphatidylethanolamine 113-123 interleukin 2 Homo sapiens 27-31 10374281-2 1997 The plasmid vector (BMGNeo-IL-2) carrying the human IL-2 gene was used to transduce the SGC-7901 GCC line by the lipofectin reagent. 1,2-dielaidoylphosphatidylethanolamine 113-123 interleukin 2 Homo sapiens 52-56 9044370-0 1997 Lipofectin-facilitated transfer of cholecystokinin gene corrects behavioral abnormalities of rats with audiogenic seizures. 1,2-dielaidoylphosphatidylethanolamine 0-10 cholecystokinin Rattus norvegicus 35-50 9044370-1 1997 To evaluate the potential for lipofectin-mediated central nervous system gene transfer, the plasmid coding for cholecystokinin was administered intracerebroventricularly to rats, which have congenital audiogenic seizures and high responses to peripheral electric stimulation-induced analgesia. 1,2-dielaidoylphosphatidylethanolamine 30-40 cholecystokinin Rattus norvegicus 111-126 8806615-6 1996 (iii) Mediated by Lipofectin, a cationic liposome, the incorporation of purified PAcP protein into DU145 cells resulted in the decreased phosphorylation of pp185. 1,2-dielaidoylphosphatidylethanolamine 18-28 acid phosphatase 3 Homo sapiens 81-85 9772679-2 1996 A designed hammerhead ribozyme, with high efficiency to cleave the PCNA mRNA site-specificly in vitro, was constructed into a self-trimming expression plasmid, and then was introduced into HeLa cells by lipofectin reagent. 1,2-dielaidoylphosphatidylethanolamine 203-213 proliferating cell nuclear antigen Homo sapiens 67-71 8818648-2 1996 A bicistronic mammalian expression vector containing a reporter gene (beta-galactosidase) and human IL-2 cDNA was complexed with either lipofectin or DC-cholesterol liposomes and transferred to tumor xenografts by direct intratumoral injection. 1,2-dielaidoylphosphatidylethanolamine 136-146 interleukin 2 Homo sapiens 100-104 8874819-8 1996 Western blot analysis showed the continuous expression of hSOD protein for at least 45 d in skin fibroblasts transfected with the expression plasmid for hSOD by Lipofectin under the optimal conditions, and the cellular SOD activity fluctuated in parallel with the expression of hSOD protein. 1,2-dielaidoylphosphatidylethanolamine 161-171 superoxide dismutase 1 Homo sapiens 58-62 8874819-8 1996 Western blot analysis showed the continuous expression of hSOD protein for at least 45 d in skin fibroblasts transfected with the expression plasmid for hSOD by Lipofectin under the optimal conditions, and the cellular SOD activity fluctuated in parallel with the expression of hSOD protein. 1,2-dielaidoylphosphatidylethanolamine 161-171 superoxide dismutase 1 Homo sapiens 153-157 8874819-8 1996 Western blot analysis showed the continuous expression of hSOD protein for at least 45 d in skin fibroblasts transfected with the expression plasmid for hSOD by Lipofectin under the optimal conditions, and the cellular SOD activity fluctuated in parallel with the expression of hSOD protein. 1,2-dielaidoylphosphatidylethanolamine 161-171 superoxide dismutase 1 Homo sapiens 59-62 8874819-8 1996 Western blot analysis showed the continuous expression of hSOD protein for at least 45 d in skin fibroblasts transfected with the expression plasmid for hSOD by Lipofectin under the optimal conditions, and the cellular SOD activity fluctuated in parallel with the expression of hSOD protein. 1,2-dielaidoylphosphatidylethanolamine 161-171 superoxide dismutase 1 Homo sapiens 153-157 8840275-2 1996 We tested the utility of an ICAM-1 antisense oligodeoxyribonucleotide (ODN) with lipofectin, six hours prior to 30 minutes of bilateral renal ischemia in the rat. 1,2-dielaidoylphosphatidylethanolamine 81-91 intercellular adhesion molecule 1 Rattus norvegicus 28-34 8758793-3 1996 pDOR-erbB-neo was introduced into human ovarian cancer cell line SKOV3 by lipofectin. 1,2-dielaidoylphosphatidylethanolamine 74-84 epidermal growth factor receptor Homo sapiens 5-9 7769848-6 1995 By electroporation and lipofectin-mediated transient transfection assays, as well as by in vitro transcription studies, a 594-bp MPO DNA sequence (bp -583 to +11) showed promoter activity in a variety of MPO-expressing and non-MPO-expressing cell lines. 1,2-dielaidoylphosphatidylethanolamine 23-33 myeloperoxidase Homo sapiens 129-132 8835215-2 1996 The delivery of the beta-galactosidase (beta-Gal) gene (pCMVlacZ) by lipofectin plus transferrin can achieve 98-100% transfection of HeLa cells as compared to 3-4% by lipofectin alone. 1,2-dielaidoylphosphatidylethanolamine 69-79 galactosidase beta 1 Homo sapiens 20-38 8835215-2 1996 The delivery of the beta-galactosidase (beta-Gal) gene (pCMVlacZ) by lipofectin plus transferrin can achieve 98-100% transfection of HeLa cells as compared to 3-4% by lipofectin alone. 1,2-dielaidoylphosphatidylethanolamine 69-79 galactosidase beta 1 Homo sapiens 40-48 8835215-2 1996 The delivery of the beta-galactosidase (beta-Gal) gene (pCMVlacZ) by lipofectin plus transferrin can achieve 98-100% transfection of HeLa cells as compared to 3-4% by lipofectin alone. 1,2-dielaidoylphosphatidylethanolamine 167-177 galactosidase beta 1 Homo sapiens 20-38 8835215-2 1996 The delivery of the beta-galactosidase (beta-Gal) gene (pCMVlacZ) by lipofectin plus transferrin can achieve 98-100% transfection of HeLa cells as compared to 3-4% by lipofectin alone. 1,2-dielaidoylphosphatidylethanolamine 167-177 galactosidase beta 1 Homo sapiens 40-48 8835215-5 1996 The amount of DNA delivered to the cells by lipofectin plus transferrin was approximately two times that obtained by lipofectin, which in turn was two times that by transferrin or without lipofectin and transferrin. 1,2-dielaidoylphosphatidylethanolamine 117-127 transferrin Homo sapiens 165-176 8835215-5 1996 The amount of DNA delivered to the cells by lipofectin plus transferrin was approximately two times that obtained by lipofectin, which in turn was two times that by transferrin or without lipofectin and transferrin. 1,2-dielaidoylphosphatidylethanolamine 117-127 transferrin Homo sapiens 165-176 8835215-5 1996 The amount of DNA delivered to the cells by lipofectin plus transferrin was approximately two times that obtained by lipofectin, which in turn was two times that by transferrin or without lipofectin and transferrin. 1,2-dielaidoylphosphatidylethanolamine 117-127 transferrin Homo sapiens 165-176 8835215-5 1996 The amount of DNA delivered to the cells by lipofectin plus transferrin was approximately two times that obtained by lipofectin, which in turn was two times that by transferrin or without lipofectin and transferrin. 1,2-dielaidoylphosphatidylethanolamine 117-127 transferrin Homo sapiens 165-176 8548549-5 1995 beta-Gal expression was significantly enhanced by formulation of the DNA-DC-Chol/DOPE complexes in physiological solution at pH 9.0. 1,2-dielaidoylphosphatidylethanolamine 81-85 galactosidase beta 1 Homo sapiens 0-8 7574713-7 1995 Introduction of an antisense 24-mer oligonucleotide to glycine N-methyltransferase cDNA into rat hepatoma H4IIE cells by lipofectin resulted in a 60% reduction in the benzo(a)pyrene-mediated induction of ethoxyresorufin-O-deethylase activity and protein over the sense and scrambled antisense oligonucleotide controls. 1,2-dielaidoylphosphatidylethanolamine 121-131 glycine N-methyltransferase Rattus norvegicus 55-82 7619064-3 1995 Accordingly, full-length LCAT cDNA was cloned into pVL 1392, a high-level expression derivative of Autographa californica nuclear polyhedrosis virus (AcNPV), and the resultant plasmid was co-transfected into Trichoplusia ni insect cells (High 5 line) with a linearized viral DNA using lipofectin. 1,2-dielaidoylphosphatidylethanolamine 285-295 lecithin cholesterol acyltransferase Rattus norvegicus 25-29 7769848-6 1995 By electroporation and lipofectin-mediated transient transfection assays, as well as by in vitro transcription studies, a 594-bp MPO DNA sequence (bp -583 to +11) showed promoter activity in a variety of MPO-expressing and non-MPO-expressing cell lines. 1,2-dielaidoylphosphatidylethanolamine 23-33 myeloperoxidase Homo sapiens 204-207 7769848-6 1995 By electroporation and lipofectin-mediated transient transfection assays, as well as by in vitro transcription studies, a 594-bp MPO DNA sequence (bp -583 to +11) showed promoter activity in a variety of MPO-expressing and non-MPO-expressing cell lines. 1,2-dielaidoylphosphatidylethanolamine 23-33 myeloperoxidase Homo sapiens 204-207 7915992-8 1994 However, treatment of C8161 with antisense 5-lipoxygenase (5-LO) oligonucleotides inhibits metastases 39% in Lipofectin-treated cells, but does not inhibit TNF-alpha-induced upregulation of experimental metastases. 1,2-dielaidoylphosphatidylethanolamine 109-119 arachidonate 5-lipoxygenase Homo sapiens 43-57 7930684-5 1994 Using flow cytometry, IFN-gamma-inducible ICAM-1 expression was reduced 50% by antisense compounds with lipofectin, and by 30% without lipofectin. 1,2-dielaidoylphosphatidylethanolamine 104-114 interferon gamma Homo sapiens 22-31 7930684-5 1994 Using flow cytometry, IFN-gamma-inducible ICAM-1 expression was reduced 50% by antisense compounds with lipofectin, and by 30% without lipofectin. 1,2-dielaidoylphosphatidylethanolamine 104-114 intercellular adhesion molecule 1 Homo sapiens 42-48 7930684-5 1994 Using flow cytometry, IFN-gamma-inducible ICAM-1 expression was reduced 50% by antisense compounds with lipofectin, and by 30% without lipofectin. 1,2-dielaidoylphosphatidylethanolamine 135-145 interferon gamma Homo sapiens 22-31 7930684-5 1994 Using flow cytometry, IFN-gamma-inducible ICAM-1 expression was reduced 50% by antisense compounds with lipofectin, and by 30% without lipofectin. 1,2-dielaidoylphosphatidylethanolamine 135-145 intercellular adhesion molecule 1 Homo sapiens 42-48 7683459-1 1993 Lipofectin, the commercially available cationic liposome, was used to introduce the purified prostatic acid phosphatase protein into the established human prostate carcinoma cells. 1,2-dielaidoylphosphatidylethanolamine 0-10 acid phosphatase 3 Homo sapiens 93-119 7987710-1 1994 A recombinant plasmid, which contains a full length cDNA of human tissue inhibitor of metalloproteinases-1 (TIMP-1), was constructed by using gene recombinant technique, and introduced into a highly metastatic human giant cell carcinoma (PG) by lipofectin technique. 1,2-dielaidoylphosphatidylethanolamine 245-255 TIMP metallopeptidase inhibitor 1 Homo sapiens 66-106 7987710-1 1994 A recombinant plasmid, which contains a full length cDNA of human tissue inhibitor of metalloproteinases-1 (TIMP-1), was constructed by using gene recombinant technique, and introduced into a highly metastatic human giant cell carcinoma (PG) by lipofectin technique. 1,2-dielaidoylphosphatidylethanolamine 245-255 TIMP metallopeptidase inhibitor 1 Homo sapiens 108-114 8065520-3 1994 Lipofectin-mediated transfection with pJDT95npy (10 micrograms) resulted in pronounced expression of several NPY mRNA species: p5-driven (3.3 kb), p19-driven (2.7 kb) and p40-driven (0.6, 0.8, 1.1, and 1.8 kb). 1,2-dielaidoylphosphatidylethanolamine 0-10 neuropeptide Y Rattus norvegicus 109-112 8065520-3 1994 Lipofectin-mediated transfection with pJDT95npy (10 micrograms) resulted in pronounced expression of several NPY mRNA species: p5-driven (3.3 kb), p19-driven (2.7 kb) and p40-driven (0.6, 0.8, 1.1, and 1.8 kb). 1,2-dielaidoylphosphatidylethanolamine 0-10 septin 3 Rattus norvegicus 171-174 8208361-8 1994 Lipofectin-mediated transfer of CGRP cDNA also resulted in transient expression of CGRP in the HUVEC. 1,2-dielaidoylphosphatidylethanolamine 0-10 calcitonin related polypeptide alpha Homo sapiens 32-36 8208361-8 1994 Lipofectin-mediated transfer of CGRP cDNA also resulted in transient expression of CGRP in the HUVEC. 1,2-dielaidoylphosphatidylethanolamine 0-10 calcitonin related polypeptide alpha Homo sapiens 83-87 8390484-4 1993 Within 35 min or 6 h, the transfection of ACE cDNA into VSMC by hemagglutinating virus of Japan method resulted in a twofold higher ACE activity than control vector, whereas a cationic liposome (Lipofectin)-mediated method failed to show any effect. 1,2-dielaidoylphosphatidylethanolamine 195-205 angiotensin I converting enzyme Homo sapiens 42-45 1520858-4 1992 injection of plasmid pSV2-beta Gal or pSV2-CCK encapsulated with lipofectin. 1,2-dielaidoylphosphatidylethanolamine 65-75 cholecystokinin Rattus norvegicus 43-46 1848013-3 1991 To investigate the role of gap junctions in the tumor characteristics of these cells, we have used Lipofectin-mediated transfection to introduce a full-length cDNA encoding connexin 43. 1,2-dielaidoylphosphatidylethanolamine 99-109 gap junction protein, alpha 1 Rattus norvegicus 173-184 1422086-6 1992 Because the mechanism of growth inhibition could not involve an inhibition of TGF-alpha expression, it was concluded that Lipofectin probably exerts a nonspecific, detergent-like effect upon the cell membrane, producing an enhancement of TGF-alpha processing and release. 1,2-dielaidoylphosphatidylethanolamine 122-132 transforming growth factor alpha Homo sapiens 238-247 35350699-10 2022 In DOPE:DOPC (3:1) bilayers, pH changes from 5 9 to 5 0 (both increasing head group electrostatic repulsion, thereby causing a less negative c 0) both increase tau. 1,2-dielaidoylphosphatidylethanolamine 3-7 microtubule associated protein tau Homo sapiens 160-163 33813269-4 2021 When fluorescent-labeled desmin was observed for 60 min after desmin assembly was initiated by adding 25 mM KCl, desmin accumulated on both the DOPE and DOPS layers; however, it did not accumulate on the DOPC layer of droplets. 1,2-dielaidoylphosphatidylethanolamine 144-148 desmin Homo sapiens 25-31 33813269-7 2021 When liposomes were included in the droplets, desmin was associated with DOPE but not on DOPC liposomes. 1,2-dielaidoylphosphatidylethanolamine 73-77 desmin Homo sapiens 46-52 32645383-5 2020 DOPE-conjugated hyaluronic acid (HA) was coated on the surface of MDMs to shield the exposed positive charge on PAMAM and to increase the cellular association with CD44+ cancer cells. 1,2-dielaidoylphosphatidylethanolamine 0-4 CD44 molecule (Indian blood group) Homo sapiens 164-168 33404020-6 2021 Using QCM-D, it was found that one DOPE-containing LNP formulation (LNP 42) had stronger interactions with ApoE than an identical LNP formulation that substituted DOPE with DSPC (LNP 90). 1,2-dielaidoylphosphatidylethanolamine 35-39 apolipoprotein E Homo sapiens 107-111 32750620-5 2020 The blending of PES/PAN in the spinning dope was optimized. 1,2-dielaidoylphosphatidylethanolamine 40-44 pescadillo ribosomal biogenesis factor 1 Homo sapiens 16-19 33063438-8 2021 RESULTS: Recent wasp dope use was reported by 16.1% of participants. 1,2-dielaidoylphosphatidylethanolamine 21-25 WASP actin nucleation promoting factor Homo sapiens 16-20 33063438-10 2021 While wasp dope use was associated with injection drug use and using opioids and other substances to get high in unadjusted analyses, the factor most strongly associated with wasp dope use was methamphetamine use (PR=17.23 95%CI[2.57, 115.61]), specifically methamphetamine injection (PR=4.47 95%CI[1.56, 12.78]). 1,2-dielaidoylphosphatidylethanolamine 11-15 WASP actin nucleation promoting factor Homo sapiens 6-10 33063438-10 2021 While wasp dope use was associated with injection drug use and using opioids and other substances to get high in unadjusted analyses, the factor most strongly associated with wasp dope use was methamphetamine use (PR=17.23 95%CI[2.57, 115.61]), specifically methamphetamine injection (PR=4.47 95%CI[1.56, 12.78]). 1,2-dielaidoylphosphatidylethanolamine 180-184 WASP actin nucleation promoting factor Homo sapiens 175-179 33063438-12 2021 Wasp dope use was higher among men and strongly associated with homelessness, transportation access, methamphetamine use, and injection drug use. 1,2-dielaidoylphosphatidylethanolamine 5-9 WASP actin nucleation promoting factor Homo sapiens 0-4 31626391-4 2019 Fluorescently labeled desmin, with or without actin, was enclosed in droplets prepared with 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE) using the water-in-oil method. 1,2-dielaidoylphosphatidylethanolamine 92-137 desmin Homo sapiens 22-28 32801705-9 2020 Consequently, the amount of FASN decreased by 80% in SK-BR3 cells treated with non-targeted liposomes and it was 30% and 60% in the MCF-7 cells treated with DSPC/Chol and DOPE/CHEMS liposomes, respectively. 1,2-dielaidoylphosphatidylethanolamine 171-175 fatty acid synthase Homo sapiens 28-32 31609634-6 2019 Here, we use a biocompatible mixture of lipids, consisting on synthetic gemini cationic lipids (GCLs) and the zwitterionic phospholipid (DOPE), to complex, transport, and deliver intact copies of MFN1 gene into MFN1-Knockout mouse embryonic fibroblasts (MFN1-KO MEFs). 1,2-dielaidoylphosphatidylethanolamine 137-141 mitofusin 1 Mus musculus 196-200 31609634-6 2019 Here, we use a biocompatible mixture of lipids, consisting on synthetic gemini cationic lipids (GCLs) and the zwitterionic phospholipid (DOPE), to complex, transport, and deliver intact copies of MFN1 gene into MFN1-Knockout mouse embryonic fibroblasts (MFN1-KO MEFs). 1,2-dielaidoylphosphatidylethanolamine 137-141 mitofusin 1 Mus musculus 211-215 31609634-6 2019 Here, we use a biocompatible mixture of lipids, consisting on synthetic gemini cationic lipids (GCLs) and the zwitterionic phospholipid (DOPE), to complex, transport, and deliver intact copies of MFN1 gene into MFN1-Knockout mouse embryonic fibroblasts (MFN1-KO MEFs). 1,2-dielaidoylphosphatidylethanolamine 137-141 mitofusin 1 Mus musculus 211-215 31626391-4 2019 Fluorescently labeled desmin, with or without actin, was enclosed in droplets prepared with 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE) using the water-in-oil method. 1,2-dielaidoylphosphatidylethanolamine 139-143 desmin Homo sapiens 22-28 31257297-8 2019 We then assessed the efficacy of anti-nuclear factor-kappa B (NF-kappaB) (RelA) siRNA (siRelA)-encapsulated DOPE/CHEMS liposomes with AT1002 in AD model mice. 1,2-dielaidoylphosphatidylethanolamine 108-112 nuclear factor of kappa light polypeptide gene enhancer in B cells 1, p105 Mus musculus 62-72 31129050-0 2019 Systemic delivery of Eg5 shRNA-expressing plasmids using PEGylated DC-Chol/DOPE cationic liposome: Long-term silencing and anticancer effects in vivo. 1,2-dielaidoylphosphatidylethanolamine 75-79 kinesin family member 11 Homo sapiens 21-24 31129050-3 2019 Using PEGylated DC-Chol/DOPE cationic liposomes, we demonstrated that a single systemic administration of Eg5 shRNA-expressing plasmid/liposome lipoplexes induced the long-term Eg5 silencing in the tumor sites of tumor-bearing mice, and ultimately lead to more sustained anticancer effects than standard synthetic siEg5/liposome lipoplexes. 1,2-dielaidoylphosphatidylethanolamine 24-28 kinesin family member 11 Mus musculus 106-109 29688101-5 2019 In this study, we prepared lipid nanoparticles (LNP) composed of original cationic lipid, neutral lipid of DOPE (1,2-dioleoyl-sn-glycero-3-phosphoethanolamine) and PEG2000-DMPE (N-(carbonyl-methoxypolyethyleneglycol 2000)-1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine, sodium salt). 1,2-dielaidoylphosphatidylethanolamine 107-111 lunapark, ER junction formation factor Mus musculus 48-51 31257297-8 2019 We then assessed the efficacy of anti-nuclear factor-kappa B (NF-kappaB) (RelA) siRNA (siRelA)-encapsulated DOPE/CHEMS liposomes with AT1002 in AD model mice. 1,2-dielaidoylphosphatidylethanolamine 108-112 v-rel reticuloendotheliosis viral oncogene homolog A (avian) Mus musculus 74-78 29926674-2 2018 METHODS: Lipofectin method was used to transfect TGF-beta1 vector into MC, and the stably expressed TGF-beta1 cell lines were selected by G418. 1,2-dielaidoylphosphatidylethanolamine 9-19 transforming growth factor beta 1 Homo sapiens 49-58 30526568-3 2018 METHODS: The stable expression of mTOR in HepG2 cells (HepG2/mTOR+) were established by lipofectin transfection of GV238-mTOR recombinant plasmids and further antibiotic selection. 1,2-dielaidoylphosphatidylethanolamine 88-98 mechanistic target of rapamycin kinase Homo sapiens 34-38 30048801-2 2018 Here, we studied the effect of formulation on potency of a 1,2-di-(9Z-octadecenoyl)-sn-glycero-3-phosphoethanolamine (DOPE) conjugated TLR7 agonist (DOPE-TLR7a) alongside assessing physical form using Dynamic Light Scattering (DLS), Nanosight Particle Tracking (NTA) analysis and Small Angle X-ray Scattering (SAXS). 1,2-dielaidoylphosphatidylethanolamine 59-116 toll like receptor 7 Homo sapiens 135-139 30048801-2 2018 Here, we studied the effect of formulation on potency of a 1,2-di-(9Z-octadecenoyl)-sn-glycero-3-phosphoethanolamine (DOPE) conjugated TLR7 agonist (DOPE-TLR7a) alongside assessing physical form using Dynamic Light Scattering (DLS), Nanosight Particle Tracking (NTA) analysis and Small Angle X-ray Scattering (SAXS). 1,2-dielaidoylphosphatidylethanolamine 118-122 toll like receptor 7 Homo sapiens 135-139 30048801-2 2018 Here, we studied the effect of formulation on potency of a 1,2-di-(9Z-octadecenoyl)-sn-glycero-3-phosphoethanolamine (DOPE) conjugated TLR7 agonist (DOPE-TLR7a) alongside assessing physical form using Dynamic Light Scattering (DLS), Nanosight Particle Tracking (NTA) analysis and Small Angle X-ray Scattering (SAXS). 1,2-dielaidoylphosphatidylethanolamine 149-153 toll like receptor 7 Homo sapiens 135-139 30023535-9 2017 In conclusion, C16 and C18 difatty acyl peptide conjugates were found to enhance siRNA delivery and generate silencing of targeted proteins in the presence of DOPE. 1,2-dielaidoylphosphatidylethanolamine 159-163 Bardet-Biedl syndrome 9 Homo sapiens 23-26 29723855-2 2018 The present study investigated the role of 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE) in the trafficking of the glucose transporter GLUT4 and the glucose homeostasis. 1,2-dielaidoylphosphatidylethanolamine 43-88 solute carrier family 2 (facilitated glucose transporter), member 4 Mus musculus 142-147 29723855-2 2018 The present study investigated the role of 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE) in the trafficking of the glucose transporter GLUT4 and the glucose homeostasis. 1,2-dielaidoylphosphatidylethanolamine 90-94 solute carrier family 2 (facilitated glucose transporter), member 4 Mus musculus 142-147 29723855-9 2018 DOPE clearly suppressed phorbol 12-myristate 13-acetate-induced PKCalpha activation in the cell-free and in situ PKC assay. 1,2-dielaidoylphosphatidylethanolamine 0-4 protein kinase C, alpha Mus musculus 64-72 29723855-9 2018 DOPE clearly suppressed phorbol 12-myristate 13-acetate-induced PKCalpha activation in the cell-free and in situ PKC assay. 1,2-dielaidoylphosphatidylethanolamine 0-4 protein kinase C, alpha Mus musculus 64-67 29723855-12 2018 A similar effect was obtained by knocking-down PKCalpha, that occludes the effect of DOPE. 1,2-dielaidoylphosphatidylethanolamine 85-89 protein kinase C, alpha Mus musculus 47-55 23886527-0 2013 Inhibition of vein graft stenosis with a c-jun targeting DNAzyme in a cationic liposomal formulation containing 1,2-dioleoyl-3-trimethylammonium propane (DOTAP)/1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE). 1,2-dielaidoylphosphatidylethanolamine 161-206 transcription factor Jun Oryctolagus cuniculus 41-46 28472749-8 2017 Here we show that the neutral liposomal derived from DOPE (1,2-dioleoyl-sn-glycero-3-phosphoethanolamine) formulation developed is efficient to encapsulate MCL1 siRNA and silencing gene expression in activated human macrophages. 1,2-dielaidoylphosphatidylethanolamine 53-57 MCL1 apoptosis regulator, BCL2 family member Homo sapiens 156-160 28472749-8 2017 Here we show that the neutral liposomal derived from DOPE (1,2-dioleoyl-sn-glycero-3-phosphoethanolamine) formulation developed is efficient to encapsulate MCL1 siRNA and silencing gene expression in activated human macrophages. 1,2-dielaidoylphosphatidylethanolamine 59-104 MCL1 apoptosis regulator, BCL2 family member Homo sapiens 156-160 26433489-7 2016 Results demonstrate the efficient coupling of 19Fc[FUT7(+)] onto both cardiosphere-derived cells (CDCs) and mesenchymal stem cells (MSCs), with coupling being more efficient when using protein G fused to single-tailed palmitic acid rather than double-tailed DOPE (1,2-dioleoyl-sn-glycero-3-phosphoethanolamine). 1,2-dielaidoylphosphatidylethanolamine 258-262 fucosyltransferase 7 Homo sapiens 51-55 26433489-7 2016 Results demonstrate the efficient coupling of 19Fc[FUT7(+)] onto both cardiosphere-derived cells (CDCs) and mesenchymal stem cells (MSCs), with coupling being more efficient when using protein G fused to single-tailed palmitic acid rather than double-tailed DOPE (1,2-dioleoyl-sn-glycero-3-phosphoethanolamine). 1,2-dielaidoylphosphatidylethanolamine 264-309 fucosyltransferase 7 Homo sapiens 51-55 26122224-4 2015 The transfection was performed using miR-373 inhibitor; the concentration of miR-373 was controlled by inhibitor, and it was transfected into MCF-7 cell by lipofectin. 1,2-dielaidoylphosphatidylethanolamine 156-166 microRNA 373 Homo sapiens 77-84 25501280-4 2015 PcDNA3 eukaryotic expression plasmids of LASS2/TMSG1 were constructed and transfected into human breast cancer cell line MCF-7 by lipofectin transfection method. 1,2-dielaidoylphosphatidylethanolamine 130-140 ceramide synthase 2 Homo sapiens 41-46 23886527-0 2013 Inhibition of vein graft stenosis with a c-jun targeting DNAzyme in a cationic liposomal formulation containing 1,2-dioleoyl-3-trimethylammonium propane (DOTAP)/1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE). 1,2-dielaidoylphosphatidylethanolamine 208-212 transcription factor Jun Oryctolagus cuniculus 41-46 22397968-8 2012 Type I IFN, IFN-gamma and TNF-alpha production was readily induced by ODN 1, ODN 2006 and ODN 2395 both in the presence and absence of lipofectin and all three types of ODN induced similar levels of cytokines. 1,2-dielaidoylphosphatidylethanolamine 135-145 interferon gamma Equus caballus 12-21 23295952-3 2013 Our results show that basal expression of manganese superoxide dismutase (MnSOD) and catalase were at low levels in long-term and short-term repopulating HSCs, and administration of a MnSOD plasmid and lipofectin complex (MnSOD-PL) conferred radiation protection on irradiated recipient mice. 1,2-dielaidoylphosphatidylethanolamine 202-212 superoxide dismutase 2, mitochondrial Mus musculus 42-72 23295952-3 2013 Our results show that basal expression of manganese superoxide dismutase (MnSOD) and catalase were at low levels in long-term and short-term repopulating HSCs, and administration of a MnSOD plasmid and lipofectin complex (MnSOD-PL) conferred radiation protection on irradiated recipient mice. 1,2-dielaidoylphosphatidylethanolamine 202-212 superoxide dismutase 2, mitochondrial Mus musculus 74-79 23295952-3 2013 Our results show that basal expression of manganese superoxide dismutase (MnSOD) and catalase were at low levels in long-term and short-term repopulating HSCs, and administration of a MnSOD plasmid and lipofectin complex (MnSOD-PL) conferred radiation protection on irradiated recipient mice. 1,2-dielaidoylphosphatidylethanolamine 202-212 catalase Mus musculus 85-93 23295952-3 2013 Our results show that basal expression of manganese superoxide dismutase (MnSOD) and catalase were at low levels in long-term and short-term repopulating HSCs, and administration of a MnSOD plasmid and lipofectin complex (MnSOD-PL) conferred radiation protection on irradiated recipient mice. 1,2-dielaidoylphosphatidylethanolamine 202-212 superoxide dismutase 2, mitochondrial Mus musculus 184-189 23295952-3 2013 Our results show that basal expression of manganese superoxide dismutase (MnSOD) and catalase were at low levels in long-term and short-term repopulating HSCs, and administration of a MnSOD plasmid and lipofectin complex (MnSOD-PL) conferred radiation protection on irradiated recipient mice. 1,2-dielaidoylphosphatidylethanolamine 202-212 superoxide dismutase 2, mitochondrial Mus musculus 184-189 23856142-2 2013 METHODS: The miRNA recombinant plasmid targeting to human Bcl-2 gene was designed, synthesized and stably transferred into A549 cells by lipofectin technique as the experiment group. 1,2-dielaidoylphosphatidylethanolamine 137-147 BCL2 apoptosis regulator Homo sapiens 58-63 22397968-8 2012 Type I IFN, IFN-gamma and TNF-alpha production was readily induced by ODN 1, ODN 2006 and ODN 2395 both in the presence and absence of lipofectin and all three types of ODN induced similar levels of cytokines. 1,2-dielaidoylphosphatidylethanolamine 135-145 tumor necrosis factor Equus caballus 26-35 22815700-3 2012 A single injection of Dz13 in a lipid formulation containing N-[1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethylammonium methyl-sulfate and 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine inhibited c-Jun expression and reduced retinal microvascular density. 1,2-dielaidoylphosphatidylethanolamine 134-179 jun proto-oncogene Mus musculus 190-195 22221399-5 2012 A fluorescent eukaryotic expression vector, hTERT-internal ribosome entry site 2 (IRES2)-enhanced green fluorescent protein (EGFP), was constructed and transfected into human penile smooth muscle cells using Lipofectin reagent. 1,2-dielaidoylphosphatidylethanolamine 208-218 telomerase reverse transcriptase Homo sapiens 44-49 22937569-7 2012 The recombinant donor plasmid pFastBac-miR-9a was transformed into E.coli DH10Bac/AcNPV forming Bacmid-9a which was transfected into insect cells with cational lipofectin. 1,2-dielaidoylphosphatidylethanolamine 160-170 microRNA 9a Bombyx mori 39-45 19435407-4 2009 The results showed that the nanoparticles were suitable for intracellular uptake, and ATM ASOs inhibited ATM expression when delivered by using nanoparticles or lipofectin, but not in their free form. 1,2-dielaidoylphosphatidylethanolamine 161-171 ataxia telangiectasia mutated Mus musculus 86-89 20695379-2 2010 METHODS: The insulin gene was cloned to lentiviral expression vector with EGFP [pLenti6.3-internal ribosome entry site (IRES)-EGFP] by recombinant DNA technology, the positive clones were screened, and lentiviral packaged systems and target gene plasmid were co-transfected to package virus in 293T cells by lipofectin. 1,2-dielaidoylphosphatidylethanolamine 308-318 insulin Homo sapiens 13-20 20561411-5 2010 Meanwhile, p27 gene was amplified from peripheral blood mononuclear cells by RT-PCR, and was confirmed to be correct by sequencing, then p27-pcDNA3.1 vector was constructed and transfected into K562 cell line by Lipofectin. 1,2-dielaidoylphosphatidylethanolamine 212-222 interferon alpha inducible protein 27 Homo sapiens 11-14 20356455-5 2010 However, dsCpGDNA encapsulated with lipofectin induced IL-8 promoter activation, HLA-DRA expression, and IL-8 expression in a CG sequence- independent manner. 1,2-dielaidoylphosphatidylethanolamine 36-46 C-X-C motif chemokine ligand 8 Homo sapiens 55-59 20356455-5 2010 However, dsCpGDNA encapsulated with lipofectin induced IL-8 promoter activation, HLA-DRA expression, and IL-8 expression in a CG sequence- independent manner. 1,2-dielaidoylphosphatidylethanolamine 36-46 major histocompatibility complex, class II, DR alpha Homo sapiens 81-88 20356455-5 2010 However, dsCpGDNA encapsulated with lipofectin induced IL-8 promoter activation, HLA-DRA expression, and IL-8 expression in a CG sequence- independent manner. 1,2-dielaidoylphosphatidylethanolamine 36-46 C-X-C motif chemokine ligand 8 Homo sapiens 105-109 19435407-4 2009 The results showed that the nanoparticles were suitable for intracellular uptake, and ATM ASOs inhibited ATM expression when delivered by using nanoparticles or lipofectin, but not in their free form. 1,2-dielaidoylphosphatidylethanolamine 161-171 ataxia telangiectasia mutated Mus musculus 105-108 18687212-2 2008 METHODS: Plasmid pIRES2-EGFP-4-1BBL was constructed and tansfected into HepG2 cells by lipofectin-mediated method, and positive cells were screened by G418. 1,2-dielaidoylphosphatidylethanolamine 87-97 TNF superfamily member 9 Homo sapiens 29-35 18930085-3 2009 GSL-liposomes remarkably enhanced the production of IFN-gamma from splenocytes in vitro and this enhancement depended on the content of the pH-sensitive lipid dioleoyl-phosphoethanolamine (DOPE) in the liposomes. 1,2-dielaidoylphosphatidylethanolamine 189-193 cathepsin A Homo sapiens 0-3 18930085-3 2009 GSL-liposomes remarkably enhanced the production of IFN-gamma from splenocytes in vitro and this enhancement depended on the content of the pH-sensitive lipid dioleoyl-phosphoethanolamine (DOPE) in the liposomes. 1,2-dielaidoylphosphatidylethanolamine 189-193 interferon gamma Homo sapiens 52-61 18940210-7 2009 Interestingly, DPL prepared with Lipofectin or 1, 2-Dioleoyl-3-Trimethylammonium-Propane (DOTAP) exhibited enhanced transfection in the presence of serum in MCF-7 and HepG2 cells. 1,2-dielaidoylphosphatidylethanolamine 33-43 prion like protein doppel Homo sapiens 15-18 19068194-2 2008 METHODS: Nest PCR was used to clone LKB1 gene pcDNA-LKB1 and pcDNA3.1 were introduced into A549 cell line by lipofectin transfection, and the A549 cells stably expressing LKB1 gene were established by G418 selection. 1,2-dielaidoylphosphatidylethanolamine 109-119 serine/threonine kinase 11 Homo sapiens 36-40 19068194-2 2008 METHODS: Nest PCR was used to clone LKB1 gene pcDNA-LKB1 and pcDNA3.1 were introduced into A549 cell line by lipofectin transfection, and the A549 cells stably expressing LKB1 gene were established by G418 selection. 1,2-dielaidoylphosphatidylethanolamine 109-119 serine/threonine kinase 11 Homo sapiens 52-56 19068194-2 2008 METHODS: Nest PCR was used to clone LKB1 gene pcDNA-LKB1 and pcDNA3.1 were introduced into A549 cell line by lipofectin transfection, and the A549 cells stably expressing LKB1 gene were established by G418 selection. 1,2-dielaidoylphosphatidylethanolamine 109-119 serine/threonine kinase 11 Homo sapiens 52-56 17897917-5 2007 METHODS: Antisense RhoC cDNA was transfected into QBC939 with lipofectin 2000. 1,2-dielaidoylphosphatidylethanolamine 62-72 ras homolog family member C Homo sapiens 19-23 18550498-8 2008 The swine BCL10 gene was cloned to the GFP-containing eukaryotic expression vector pEGFP-C1 and transfected to PK-15 cell line by lipofectin. 1,2-dielaidoylphosphatidylethanolamine 130-140 BCL10 Sus scrofa 10-15 17881199-8 2008 The transfection efficiency of SLN1 (TC:DC-Chol:DOPE:Tween 80=0.3:0.3:0.3:1), which showed the highest transfection efficiency among the SLN formulations, was higher than that of commercially available Lipofectin. 1,2-dielaidoylphosphatidylethanolamine 202-212 sarcolipin Homo sapiens 31-34 17828497-1 2007 To investigate the role of NF-kappaB in TNF-alpha induced apoptosis in HSC-T6, a mutant IkappaBalpha was transfected into HSC-T6 cells by lipofectin transfection technique and its transient effect was examined 48 h after the transfection. 1,2-dielaidoylphosphatidylethanolamine 138-148 NFKB inhibitor alpha Rattus norvegicus 88-100 17329341-4 2007 When a poly(G) sequence was added to a stimulatory self-complementary ODN, high levels of IFN-alpha were elicited, and the induction was not dependent on pretreatment with the transfecting agent Lipofectin. 1,2-dielaidoylphosphatidylethanolamine 195-205 interferon alpha 1 Homo sapiens 90-99 17122804-3 2007 After optimizing conditions for DNA delivery to the lungs of mice using the combination of polymeric micelles with Lipofectin and LacZ DNA, we used the Lipofectin/polymeric micelle system to deliver the tumor suppressor gene PTEN to the lungs of C57BL/6 mice bearing the B16-F10 melanoma. 1,2-dielaidoylphosphatidylethanolamine 152-162 phosphatase and tensin homolog Mus musculus 225-229 17122804-5 2007 Importantly, lung metastasis, as measured by lung weight, was significantly reduced (P<0.001), as were total tumor foci in the lungs (P<0.001) and size of individual tumor nodules in animals treated with Lipofectin/PTEN/polymeric micelles compared with control animals. 1,2-dielaidoylphosphatidylethanolamine 210-220 phosphatase and tensin homolog Mus musculus 221-225 21162256-6 2006 CONCLUSION: The G418 resistant HEK293 cell line was successfully established with transfection of plasmid pcDNA3-hHCN2 by Lipofectin, which might be useful for studying the relationship between the structure and function of cloned ionic channels. 1,2-dielaidoylphosphatidylethanolamine 122-132 hyperpolarization activated cyclic nucleotide gated potassium and sodium channel 2 Homo sapiens 113-118 17393105-2 2007 Exogenous p16(ink4a) gene was transfected by lipofectin into human lung cell line A549, in which p16(ink4a) gene was homozygously deleted. 1,2-dielaidoylphosphatidylethanolamine 45-55 cyclin dependent kinase inhibitor 2A Homo sapiens 10-13 17393105-2 2007 Exogenous p16(ink4a) gene was transfected by lipofectin into human lung cell line A549, in which p16(ink4a) gene was homozygously deleted. 1,2-dielaidoylphosphatidylethanolamine 45-55 cyclin dependent kinase inhibitor 2A Homo sapiens 14-19 17393112-2 2007 PTEN gene packaged with lipofectin was transferred into breast cancer cell line MDA468 and parental MDA468 cells served as controls. 1,2-dielaidoylphosphatidylethanolamine 24-34 phosphatase and tensin homolog Homo sapiens 0-4 17217722-12 2006 Plasmid pcDNA3-hHCN2 by Lipofectin could be successfully transfected into MSCs with IhHCN2 recorded by whole-cell patch clamp technique, this study provides a basis for future antiarrhythmic gene therapy. 1,2-dielaidoylphosphatidylethanolamine 24-34 hyperpolarization activated cyclic nucleotide gated potassium and sodium channel 2 Homo sapiens 15-20 16688843-3 2006 Recombinant human Ang-1 antisense eukaryotic expression vector was constructed by directional cloning, and transfected by lipofectin method into human gastric cancer line SGC7901 with high Ang-1 expression level. 1,2-dielaidoylphosphatidylethanolamine 122-132 angiopoietin 1 Homo sapiens 18-23 16274295-11 2005 Simultaneous transfer of three growth factor genes (VEGF165, PDGF-B, and bFGF) is deleterious to flap survival, at least for the ratio of lipofectin:transgene employed. 1,2-dielaidoylphosphatidylethanolamine 138-148 myotrophin Rattus norvegicus 31-44 16420757-3 2006 Then it was co-transfected with pCMV/T7-NCRC Delta-luc into Huh7 cell line mediated by lipofectin. 1,2-dielaidoylphosphatidylethanolamine 87-97 MIR7-3 host gene Homo sapiens 60-64 16614705-3 2006 METHODS: HepG2 cells were transfected with constitutively active Akt and dominant negative Akt using lipofectin. 1,2-dielaidoylphosphatidylethanolamine 101-111 AKT serine/threonine kinase 1 Homo sapiens 91-94 16274295-11 2005 Simultaneous transfer of three growth factor genes (VEGF165, PDGF-B, and bFGF) is deleterious to flap survival, at least for the ratio of lipofectin:transgene employed. 1,2-dielaidoylphosphatidylethanolamine 138-148 fibroblast growth factor 2 Rattus norvegicus 73-77 16025556-6 2005 Addition of 0.1 microM GALA to the plasmid/liposome complex significantly increased the transfection efficiency, especially in the case of Lipofectin, but higher concentration of GALA decreased transfection efficiency. 1,2-dielaidoylphosphatidylethanolamine 139-149 galactosidase alpha Homo sapiens 23-27 15840258-2 2005 METHODS: We selected the lowest PTEN gene expressive pancreatic cancer cell line among the four pancreatic cancer cell lines (Miapaca I, Miapaca II, JF305 and ASPC-1) through RT-PCR assay method, and transfected plasmid (Peak8) inserting PTEN or not in vitro into it by lipofectin. 1,2-dielaidoylphosphatidylethanolamine 270-280 phosphatase and tensin homolog Homo sapiens 32-36 16157028-5 2005 A plasmid expressing antisense Bmi-1 mRNA was then constructed by reverse design of PCR primers and cloned to the plasmid pLNCX2; G418 was added to the medium after the plasmid was successfully introduced in K562 cells by lipofectin-mediated DNA transfection. 1,2-dielaidoylphosphatidylethanolamine 222-232 BMI1 proto-oncogene, polycomb ring finger Homo sapiens 31-36 15899130-6 2005 Then the recombinant eukaryotic expression vector pCI-neo/nsp2 was transfected into COS-7 cells using lipofectin reagent to express the nsp2 protein. 1,2-dielaidoylphosphatidylethanolamine 102-112 reticulon 2 Homo sapiens 136-140 15955566-11 2005 All the IFN inducing ODN also induced IL-6 production and the levels of IL-6 induced seemed influenced by addition of lipofectin and presence of poly-G sequences in the same way as was observed for the IFN-production. 1,2-dielaidoylphosphatidylethanolamine 118-128 interleukin 6 Equus caballus 72-76 16342680-3 2005 pGL3-PSA luciferase expression vector, containing 640 bp DNA of PSA gene 5" promoter region was constructed and transfected into LNCap cell with lipofectin. 1,2-dielaidoylphosphatidylethanolamine 145-155 succinate dehydrogenase complex subunit C Homo sapiens 0-4 16342680-3 2005 pGL3-PSA luciferase expression vector, containing 640 bp DNA of PSA gene 5" promoter region was constructed and transfected into LNCap cell with lipofectin. 1,2-dielaidoylphosphatidylethanolamine 145-155 kallikrein related peptidase 3 Homo sapiens 64-67 16008891-0 2005 [Inhibitory effect of endostatin mediated by lipofectin on transplanted ovarian cancer]. 1,2-dielaidoylphosphatidylethanolamine 45-55 collagen type XVIII alpha 1 chain Homo sapiens 22-32 16008891-1 2005 OBJECTIVE: To study the inhibitory effect of endostatin mediated by lipofectin on transplanted ovarian cancer in nude mice. 1,2-dielaidoylphosphatidylethanolamine 68-78 collagen, type XVIII, alpha 1 Mus musculus 45-55 16008891-2 2005 METHODS: Constructed recombinant vector pVAX1-sEn expressing human endostatin protein was transfected into ovarian cancer cell line 3AO by lipofectin. 1,2-dielaidoylphosphatidylethanolamine 139-149 collagen type XVIII alpha 1 chain Homo sapiens 67-77 15730925-5 2005 PKC-alpha antisense oligonucleotides(asODN) of different concentrations with a random sequence as a control were transfected into HepG2 cells by lipofectin(LP). 1,2-dielaidoylphosphatidylethanolamine 145-155 protein kinase C alpha Homo sapiens 0-9 15840334-2 2005 METHODS: RPE was transfected with plasmid encoding anti-sense of VEGF by lipofectin. 1,2-dielaidoylphosphatidylethanolamine 73-83 vascular endothelial growth factor A Homo sapiens 65-69 15634518-2 2004 METHODS: Lipofectin-mediated gene transfection method was used to transfer HER2/neu into MCF7 cells. 1,2-dielaidoylphosphatidylethanolamine 9-19 erb-b2 receptor tyrosine kinase 2 Homo sapiens 75-79 15946543-2 2005 METHODS: Recombinant human Ang1 sense or antisense eukaryotic expression vectors were constructed, and transfected by lipofectin into human gastric cancer line SGC7901. 1,2-dielaidoylphosphatidylethanolamine 118-128 angiopoietin 1 Homo sapiens 27-31 15476281-5 2004 AS bcl-2 in vitro was treated with lipofectin, whereas it was administered intraperitoneally for 6 consecutive days twice every 2 weeks in vivo. 1,2-dielaidoylphosphatidylethanolamine 35-45 BCL2 apoptosis regulator Homo sapiens 3-8 15166006-9 2004 Overnight treatment with the anti-GRK4-6 antibody complexed with Lipofectin was also effective in preventing loss of the effects of SKF-38393 on NHE and AC activities. 1,2-dielaidoylphosphatidylethanolamine 65-75 G protein-coupled receptor kinase 4 Rattus norvegicus 34-38 15634518-2 2004 METHODS: Lipofectin-mediated gene transfection method was used to transfer HER2/neu into MCF7 cells. 1,2-dielaidoylphosphatidylethanolamine 9-19 erb-b2 receptor tyrosine kinase 2 Homo sapiens 80-83 14604462-9 2003 The antisense PS-ODN inhibited VEGF mRNA and protein secretion when delivered using nanoparticles or lipofectin but not in its free form. 1,2-dielaidoylphosphatidylethanolamine 101-111 vascular endothelial growth factor A Homo sapiens 31-35 15261695-4 2004 Several phosphodiester ODNs, such as 5" TTTTCAATTCGAAGATGAAT 3" (ODN H), and the plasmid pcDNA3 all required pre-incubation with lipofectin in order to induce IFN-alpha. 1,2-dielaidoylphosphatidylethanolamine 129-139 interferon alpha 1 Homo sapiens 159-168 15261695-5 2004 Intact unmethylated CpGs were also important, because methylation or substitution of the cytosines and CpG-inversion strongly reduced the IFN-alpha induction by single- or double-stranded forms of ODN H. Certain CpG-ODNs that contained flanking phosphorothioate or phosphodiester poly-G sequences were potent inducers of IFN-alpha without pre-incubation with lipofectin, for instance the ODN 2216 (5" GGGGGACGATCGTCGGGGGG 3"). 1,2-dielaidoylphosphatidylethanolamine 359-369 interferon alpha 1 Homo sapiens 138-147 15301710-3 2004 METHODS: Survivin-ASODN were transfected into COC1/DDP cells mediated by lipofectin. 1,2-dielaidoylphosphatidylethanolamine 73-83 translocase of inner mitochondrial membrane 8A Homo sapiens 51-54 15363324-2 2004 METHODS: Lipofectin method was used to transfer HER2/neu into human breast tumor cell line MCF7. 1,2-dielaidoylphosphatidylethanolamine 9-19 erb-b2 receptor tyrosine kinase 2 Homo sapiens 48-56 14761601-2 2003 METHODS: Lipofectin method was used to transfect Smad 7 vector into MsC. 1,2-dielaidoylphosphatidylethanolamine 9-19 SMAD family member 7 Rattus norvegicus 49-55 14761605-2 2003 METHODS: Breast carcinoma cells were transinfected with several antisense oligonucleotide (ASODN) complementary to mdr-1 by lipofectin. 1,2-dielaidoylphosphatidylethanolamine 124-134 ATP binding cassette subfamily B member 1 Homo sapiens 115-120 15259070-3 2004 Lipofectin mediated p53 or HCV NS5A expression vectors were used to transfect hepatoma cell lines to observe whether HCV NS5A could abrogate the binding ability of p53 to its specific DNA sequence and p53 transactivation on p21 promoter. 1,2-dielaidoylphosphatidylethanolamine 0-10 tumor protein p53 Homo sapiens 20-23 15248919-0 2004 [Inhibitory effect of MUC2 antisense oligodeoxynucleotide with lipofectin on human gastric cancer cell proliferation]. 1,2-dielaidoylphosphatidylethanolamine 63-73 mucin 2, oligomeric mucus/gel-forming Homo sapiens 22-26 15248919-3 2004 METHODS: Phosphorothioate MUC2 ASODN was synthesized and transfected to SGC7901 cells mediated by lipofectin. 1,2-dielaidoylphosphatidylethanolamine 98-108 mucin 2, oligomeric mucus/gel-forming Homo sapiens 26-30 15173074-7 2004 Treatment of PC3 cells with either IFN-beta or -gamma recapitulated some of the aspects of the molecular and phenotypic changes observed after treatment with a G3139/Lipofectin complex. 1,2-dielaidoylphosphatidylethanolamine 166-176 keratin 6A Homo sapiens 13-16 15173074-7 2004 Treatment of PC3 cells with either IFN-beta or -gamma recapitulated some of the aspects of the molecular and phenotypic changes observed after treatment with a G3139/Lipofectin complex. 1,2-dielaidoylphosphatidylethanolamine 166-176 interferon beta 1 Homo sapiens 35-43 15181821-4 2004 Then pcDNA-BLC was transfected into murine tumor cell line colon 26 by LIPOFECTIN. 1,2-dielaidoylphosphatidylethanolamine 71-81 chemokine (C-X-C motif) ligand 13 Mus musculus 11-14 15182621-3 2004 And then the cDNA was cloned into eukaryotic expression plasmid pcDNA3.1 to construct recombinant plasmid pcDNA3.1/mIL-21 which was introduced into Sp2/0 cells by lipofectin. 1,2-dielaidoylphosphatidylethanolamine 163-173 interleukin 21 Mus musculus 115-121 12839678-2 2003 METHODS: An antisense oligodeoxynucleotides (AODN) directed against the human telomerase transcriptase (hTERT), designed and synthesized to serve as a telomerase inhibitor, was transfected into endometrial carcinoma cell line HEC-1A by lipofectin. 1,2-dielaidoylphosphatidylethanolamine 236-246 telomerase reverse transcriptase Homo sapiens 104-109 12935400-2 2003 METHODS: A human pancreatic cancer cell line PC-3 was transfected with lipofectin-mediated recombinant p14ARF gene, and was then administered with 5-Fu. 1,2-dielaidoylphosphatidylethanolamine 71-81 cyclin dependent kinase inhibitor 2A Homo sapiens 103-109 15203934-4 2003 All three gene silencing nucleic acids designed to be complementary to the same array-defined hybridization accessible-site within EGFR mRNA were effective in inhibiting the growth of EGFR over-expressing A431 cancer cells in a dose dependent manner when delivered using the cationic lipid (Lipofectin) delivery system. 1,2-dielaidoylphosphatidylethanolamine 291-301 epidermal growth factor receptor Homo sapiens 131-135 15203934-4 2003 All three gene silencing nucleic acids designed to be complementary to the same array-defined hybridization accessible-site within EGFR mRNA were effective in inhibiting the growth of EGFR over-expressing A431 cancer cells in a dose dependent manner when delivered using the cationic lipid (Lipofectin) delivery system. 1,2-dielaidoylphosphatidylethanolamine 291-301 epidermal growth factor receptor Homo sapiens 184-188 12773241-2 2003 METHODS: Expression vector of anti-PDGFR- beta ribozyme was constructed and transfected into rat-derived HSC-T6 cells with lipofectin. 1,2-dielaidoylphosphatidylethanolamine 123-133 platelet derived growth factor receptor beta Rattus norvegicus 35-46 12435858-9 2002 RESULTS: The optimized folate-liposome-AS HER-2 ODN complex significantly increases the response of breast tumor cell lines to conventional chemotherapeutic agents in vitro as compared to AS HER-2 delivered via an unliganded commercially available reagent, Lipofectin. 1,2-dielaidoylphosphatidylethanolamine 257-267 erb-b2 receptor tyrosine kinase 2 Homo sapiens 42-47 12667960-5 2003 SREBP-2 was overexpressed by transient transfection with lipofectin. 1,2-dielaidoylphosphatidylethanolamine 57-67 sterol regulatory element binding transcription factor 2 Homo sapiens 0-7 12600290-5 2003 METHODS: The plasmid of pcDNA3tyr carried the full-length cDNA of tyrosinase gene was transfected into HepG2 cell by lipofectin, its property of synthesizing melanin was used to produce high signal in T1WI MR image and then to evaluate gene expression. 1,2-dielaidoylphosphatidylethanolamine 117-127 tyrosinase Homo sapiens 66-76 12561432-3 2003 METHODS: To construct an eukaryotic expression vector of PAX3-FKHR gene; the plasmids of MRF4 cDNA and PAX3-FKHR cDNA were transfected into cultured RD cells with lipofectin methods. 1,2-dielaidoylphosphatidylethanolamine 163-173 paired box 3 Homo sapiens 57-61 12412800-5 2002 Wild-type and G1144A mutant-type TNSALP cDNA expression vector pcDNA3 have been constructed and transfected to COS-1 cells by lipofectin technique. 1,2-dielaidoylphosphatidylethanolamine 126-136 alkaline phosphatase, biomineralization associated Homo sapiens 33-39 12778761-3 2003 The recombinant expression plasmid pIRES-bFGF-EGFP was transfected into inner ear of guinea pigs, using lipofectin method. 1,2-dielaidoylphosphatidylethanolamine 104-114 fibroblast growth factor 2 Cavia porcellus 41-45 12561428-0 2003 [Apoptotic effect of bcl-XL antisense oligodeoxynucleotide mediated by lipofectin on cell strain CNE-2Z]. 1,2-dielaidoylphosphatidylethanolamine 71-81 BCL2 like 1 Homo sapiens 21-27 12561428-4 2003 Bcl-XL ASODN was transfected into CNE-2Z cells through lipofectin. 1,2-dielaidoylphosphatidylethanolamine 55-65 BCL2 like 1 Homo sapiens 0-6 12616719-4 2003 Using Lipofectin as the carrier, phosphorothioate-modified antisense ODNs were transferred into prostate cancer cells with high efficiency, effectively inhibiting the expression of endogenous protein kinase C-epsilon and the androgen-independent (AI) proliferation of several independent human prostate cancer cell lines. 1,2-dielaidoylphosphatidylethanolamine 6-16 protein kinase C epsilon Homo sapiens 192-216 11920544-5 2002 METHODS: Transfection of 2"-O-methoxyethyl-modified Hus1 antisense oligoribonucleotides into human H1299 nonsmall lung carcinoma cells was performed using Lipofectin as the carrier. 1,2-dielaidoylphosphatidylethanolamine 155-165 HUS1 checkpoint clamp component Homo sapiens 52-56 12081782-2 2002 MATERIALS AND METHODS: In the cisplatin-resistant bladder tumour cell lines T24R1 and T24R2, the expression of Bcl2 was determined by reverse transcription-polymerase chain reaction and Western blot assay, and antisense oligonucleotide targeting of the Bcl2 coding sequence was administered with lipofectin. 1,2-dielaidoylphosphatidylethanolamine 296-306 BCL2 apoptosis regulator Homo sapiens 111-115 12048684-2 2002 METHODS: FHIT gene packaged with lipofectin was transfected into the cells of a human lung adenocarcinoma cell line (A549), which stably expressed ectogenous FHIT gene. 1,2-dielaidoylphosphatidylethanolamine 33-43 fragile histidine triad diadenosine triphosphatase Homo sapiens 9-13 11810761-2 2001 METHODS: After the plasmid of EGFP-S100A2 had been regrouped and introduced into the hepatocellular carcinoma QGY7701 cells with lipofectin, the expression and location of the products were observed by fluorescent microscopy. 1,2-dielaidoylphosphatidylethanolamine 129-139 S100 calcium binding protein A2 Homo sapiens 35-41 11902329-1 2001 The oligodeoxyribonucleotide (ODN) 5"-TTTTCAATTCGAAGATGAAT-3" (ODN H), identified in systemic lupus erythematosus (SLE) serum, induced the production of interferon (IFN)-alpha in human peripheral blood mononuclear cells (PBMC) when combined with lipofectin. 1,2-dielaidoylphosphatidylethanolamine 246-256 interferon alpha 1 Homo sapiens 153-175 11718035-2 2001 METHODS: p16-pcDNA3 was transfected into lung cancer cell line A549 using lipofectin, in which p16 gene was homozygously deleted. 1,2-dielaidoylphosphatidylethanolamine 74-84 cyclin dependent kinase inhibitor 2A Homo sapiens 9-12 11718035-2 2001 METHODS: p16-pcDNA3 was transfected into lung cancer cell line A549 using lipofectin, in which p16 gene was homozygously deleted. 1,2-dielaidoylphosphatidylethanolamine 74-84 cyclin dependent kinase inhibitor 2A Homo sapiens 95-98