PMID-sentid	Pub_year	Sent_text	compound_name	comp_offset	prot_official_name	organism	prot_offset
15562002-6	2004	The interaction of distamycin, a minor groove binder with high affinity for homopolymeric oligo(dA).oligo(dT) tracts, abolishes preferential binding of the C-terminal domain of histone H1 and protamine to the SAR, suggesting the involvement of the DNA minor groove in the interaction.	stallimycin	19-29	sarcosine dehydrogenase	Homo sapiens	209-212
12771220-4	2003	These results demonstrate the utility of distamycin as a probe of G4 DNA-protein interactions and show that there are (at least) two distinct modes of protein-G4 DNA recognition which can be distinguished by sensitivity to distamycin.	stallimycin	223-233	chromosome 6 open reading frame 47	Homo sapiens	151-161
15220334-4	2004	Treatment with a DNA-intercalating drug distamycin A (DST) at 75 microg/ml resulted in a size reduction of the enhanced S/MAR domain at the neocentromere of two-thirds to 1.2 Mb, and that of the CENP-A-binding domain of 40%, from 330 to 196 kb, with no significant shift in the position of the latter domain.	stallimycin	40-52	centromere protein A	Homo sapiens	195-201
15220334-4	2004	Treatment with a DNA-intercalating drug distamycin A (DST) at 75 microg/ml resulted in a size reduction of the enhanced S/MAR domain at the neocentromere of two-thirds to 1.2 Mb, and that of the CENP-A-binding domain of 40%, from 330 to 196 kb, with no significant shift in the position of the latter domain.	stallimycin	54-57	centromere protein A	Homo sapiens	195-201
11880377-0	2002	Human fragile site FRA16B DNA excludes nucleosomes in the presence of distamycin.	stallimycin	70-80	fragile site, distamycin A type, rare, fra(16)(q22.1)	Homo sapiens	19-25
12027447-8	2002	Taken together, the synergistic induction of the genes may be explained not only by opening of condensed chromatin by distamycin A but also by increase in the binding of 5-bromouracil-containing S/MAR sequences to the nuclear scaffolds.	stallimycin	118-130	interferon regulatory factor 1	Homo sapiens	197-200
12023812-6	2002	Related biochemical studies on the effect of polyamides on DNA gyrase activity in vitro show that the C7 dimers most effectively inhibit the enzyme activity compared with the monomers and the natural reference minor groove binder distamycin.	stallimycin	230-240	DNA topoisomerase II alpha	Homo sapiens	59-69
11880377-4	2002	The FRA16B DNA fragments strongly exclude nucleosome assembly only in the presence of distamycin, and increasing the number of 33-bp repeats increases the effect of distamycin in the destabilization of the nucleosome formation, suggesting a common mechanism for the formation of fragile sites.	stallimycin	86-96	fragile site, distamycin A type, rare, fra(16)(q22.1)	Homo sapiens	4-10
11870918-0	2002	Distamycin A affects the stability of NF-kappaB p50-DNA complexes in a sequence-dependent manner.	stallimycin	0-12	nuclear factor kappa B subunit 1	Homo sapiens	38-51
11870918-1	2002	The effect of two different DNA minor groove binding molecules, Hoechst 33258 and distamycin A, on the binding kinetics of NF-kappaB p50 to three different specific DNA sequences was studied at various salt concentrations.	stallimycin	82-94	nuclear factor kappa B subunit 1	Homo sapiens	123-136
11870918-2	2002	Distamycin A was shown to significantly increase the dissociation rate constant of p50 from the sequences PRDII (5"-GGGAAATTCC-3") and Ig-kappa B (5"-GGGACTTTCC-3") but had a negligible effect on the dissociation from the palindromic target-kappaB binding site (5"-GGGAATTCCC-3").	stallimycin	0-12	nuclear factor kappa B subunit 1	Homo sapiens	83-86
11601987-3	2001	Minor groove binding ligands, such as distamycin, netropsin, and GLX, an indole-linked dimer of netropsin, can effectively disrupt the UL9-DNA complex only when their DNA binding sites are coincident with the right side of the DNA binding site of the protein and overlap with the protein binding site by two (TT) base pairs.	stallimycin	38-48	DNA replication origin-binding helicase	Human alphaherpesvirus 1	135-138
10871376-8	2000	The results demonstrate that BLM and WRN proteins exhibit similar sensitivity profiles to these DNA-binding ligands and are most potently inhibited by the structurally related minor groove binders distamycin A and netropsin (K(i) </=1 microM).	stallimycin	197-209	BLM RecQ like helicase	Homo sapiens	29-32
11308031-5	2001	The DNA binding drugs mithramycin and distamycin bind to one of these regions as determined by DNase I protection assay.	stallimycin	38-48	deoxyribonuclease I	Mus musculus	95-102
11425313-2	2001	We have characterized the association of the HMGA protein, five different HMGB proteins, and the structure-specific recognition protein 1 (SSRP1) with maize chromatin by extraction experiments using NaCl, ethidium bromide, spermine, and distamycin A.	stallimycin	237-249	LOC100856902	Zea mays	139-144
10871376-8	2000	The results demonstrate that BLM and WRN proteins exhibit similar sensitivity profiles to these DNA-binding ligands and are most potently inhibited by the structurally related minor groove binders distamycin A and netropsin (K(i) </=1 microM).	stallimycin	197-209	WRN RecQ like helicase	Homo sapiens	37-40
10204311-6	1999	Recently, it was shown that two expanded minisatellite sequences are also involved in both progressive myoclonus epilepsy type 1 and distamycin A-sensitive fragile site, FRA16B.	stallimycin	133-145	fragile site, distamycin A type, rare, fra(16)(q22.1)	Homo sapiens	170-176
10815772-2	2000	Sulfonated distamycin (Suradista) derivatives exhibit anti-HIV-1 activity by inhibiting the binding of the viral envelope glycoprotein gp120 to its receptor (CD4).	stallimycin	11-21	inter-alpha-trypsin inhibitor heavy chain 4	Homo sapiens	135-140
10815772-2	2000	Sulfonated distamycin (Suradista) derivatives exhibit anti-HIV-1 activity by inhibiting the binding of the viral envelope glycoprotein gp120 to its receptor (CD4).	stallimycin	11-21	CD4 molecule	Homo sapiens	158-161
10524202-2	1999	Distamycin A inhibits transcription both in vitro and in vivo and can displace from DNA the transcription activator TATA binding protein promoter binding factor (TPBF).	stallimycin	0-12	TATA-box binding protein	Homo sapiens	116-136
10082546-8	1999	Transfection with a plasmid carrying scaffold attachment regions as well as incubation with distamycin led to the derepression of the IFN-beta promoter stably integrated into chromatin.	stallimycin	92-102	interferon beta 1, fibroblast	Mus musculus	134-142
10984839-1	2000	Previously, the allelic expansion of a 33-bp AT-rich minisatellite repeat has been reported to cause FRA16B, a distamycin A-inducible fragile site.	stallimycin	111-123	fragile site, distamycin A type, rare, fra(16)(q22.1)	Homo sapiens	101-107
9698360-1	1998	DNA binding modes of distamycin (DST) were investigated via comparative binding studies with oligomeric duplexes of the form d(GCG-X-GCG).d(CGC-Y-CGC), where Y is complementary to X and X = 4- or 5-base binding site.	stallimycin	21-31	glucagon	Homo sapiens	127-130
9840289-0	1998	Characterization of the effects of two polysulfonated distamycin A derivatives, PNU145156E and PNU153429, on HIV type 1 Tat protein.	stallimycin	54-66	tyrosine aminotransferase	Homo sapiens	120-123
9840289-1	1998	We examined whether two sulfonated distamycin A derivatives, PNU145156E and PNU153529, inhibit the trans-activating and angiogenic effects of HIV-1 Tat protein.	stallimycin	35-47	Tat	Human immunodeficiency virus 1	148-151
9729384-3	1998	The molecular structures of some of these regions have now been determined, most notably the folate-sensitive fragile sites and FRA16B-a distamycin A-sensitive fragile site.	stallimycin	137-149	fragile site, distamycin A type, rare, fra(16)(q22.1)	Homo sapiens	128-134
9698360-1	1998	DNA binding modes of distamycin (DST) were investigated via comparative binding studies with oligomeric duplexes of the form d(GCG-X-GCG).d(CGC-Y-CGC), where Y is complementary to X and X = 4- or 5-base binding site.	stallimycin	21-31	glucagon	Homo sapiens	133-136
9660961-4	1998	Here, we report that bromodeoxyuridine-inducible, distamycin A-insensitive fragile site FRA10B is composed of expanded approximately 42 bp repeats.	stallimycin	50-62	fragile site, BrdU type, rare, fra(10)(q25.2)	Homo sapiens	88-94
9632350-0	1998	Inhibition of in vitro and in vivo HIV replication by a distamycin analogue that interferes with chemokine receptor function: a candidate for chemotherapeutic and microbicidal application.	stallimycin	56-66	C-X-C motif chemokine receptor 4	Homo sapiens	97-115
9311598-1	1997	The cytotoxic activities of 2 novel distamycin-A derivatives, FCE 24517 and FCE 25450A, alone and in combination with tumor-necrosis factor-alpha (TNF), were studied.	stallimycin	36-48	tumor necrosis factor	Homo sapiens	147-150
9430660-8	1998	Instead, we found that the GST-Cdc6 can compete with distamycin A for binding to the DNA molecule.	stallimycin	53-65	AAA family ATPase CDC6	Saccharomyces cerevisiae S288C	31-35
9430660-9	1998	As distamycin A is a specific reagent that binds noncovalently to DNA at (A + T)-rich tracks, the stimulation of Abf1 DNA binding activity may be mediated by the Cdc6/DNA interaction.	stallimycin	3-15	DNA-binding protein ABF1	Saccharomyces cerevisiae S288C	113-117
9430660-9	1998	As distamycin A is a specific reagent that binds noncovalently to DNA at (A + T)-rich tracks, the stimulation of Abf1 DNA binding activity may be mediated by the Cdc6/DNA interaction.	stallimycin	3-15	AAA family ATPase CDC6	Saccharomyces cerevisiae S288C	162-166
9660961-3	1998	Distamycin A or bromodeoxyuridine-inducible fragile site FRA16B is an expanded AT-rich approximately 33 bp repeat; however, the relationship between normal and fragile site alleles is not known.	stallimycin	0-12	fragile site, distamycin A type, rare, fra(16)(q22.1)	Homo sapiens	57-63
9460496-0	1998	A distamycin A-inducible fragile site, FRA8E, located in the region of the hereditary multiple exostoses gene, is not involved in HPV16 DNA integration and amplification.	stallimycin	2-14	fragile site, distamycin A type, rare, fra(8)(q24.1)	Homo sapiens	39-44
9460496-4	1998	A distamycin A-inducible fragile site, FRA8E, is mapped to 8q24.1 in which various loci implicated in genomic instability are located.	stallimycin	2-14	fragile site, distamycin A type, rare, fra(8)(q24.1)	Homo sapiens	39-44
9311598-10	1997	These findings suggest that, beyond their cytotoxic effects as single agents, the distamycin derivatives increase the sensitivity of cells to TNF.	stallimycin	82-92	tumor necrosis factor	Homo sapiens	142-145
9031761-0	1997	Anti-insulin-like growth factor-I activity of a novel polysulphonated distamycin A derivative in human lung cancer cell lines.	stallimycin	70-82	insulin like growth factor 1	Homo sapiens	5-33
9096302-2	1997	The most active of these drugs, MGT-6a, was three orders of magnitude more effective than distamycin and inhibited complexes between E2F1 and the dihydrofolate reductase promoter by 50% at 0.00085 microM.	stallimycin	90-100	E2F transcription factor 1	Homo sapiens	133-137
9089632-6	1997	Using the mobility shift assay distamycin A selectively inhibited binding of two important transcription factors, SRF and MEF2, to their respective A/T-rich elements.	stallimycin	31-43	myocyte enhancer factor 2C	Mus musculus	122-126
9089632-10	1997	Additionally, SRF and MEF2 dependent promoters were selectively down regulated by distamycin A.	stallimycin	82-94	myocyte enhancer factor 2C	Mus musculus	22-26
9031761-2	1997	The purpose of this study was to investigate the antiproliferative effect and the modulation of the mitogenic insulin-like growth factor-I (IGF-I) system by FCE 26644 and FCE 27784, two polyanionic sulphonated distamycin A derivative compounds, on two human non-small cell lung cancer (N-SCLC) cell lines.	stallimycin	210-222	insulin like growth factor 1	Homo sapiens	110-138
9031761-2	1997	The purpose of this study was to investigate the antiproliferative effect and the modulation of the mitogenic insulin-like growth factor-I (IGF-I) system by FCE 26644 and FCE 27784, two polyanionic sulphonated distamycin A derivative compounds, on two human non-small cell lung cancer (N-SCLC) cell lines.	stallimycin	210-222	insulin like growth factor 1	Homo sapiens	140-145
9039263-4	1997	To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATA TTATATATTATATCTAATAATATATC/ATA)n (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression).	stallimycin	34-46	fragile site, distamycin A type, rare, fra(16)(q22.1)	Homo sapiens	70-76
8798634-8	1996	An AT minor groove-binding drug, distamycin A, disrupted the TBP.TFIIA.DNA complex and restored the EGR1.DNA complex.	stallimycin	33-45	TATA-box binding protein	Homo sapiens	61-64
9016563-0	1997	Distamycin prolongs E-selectin expression by interacting with a specific NF-kappaB-HMG-I(Y) binding site in the promoter.	stallimycin	0-10	selectin E	Homo sapiens	20-30
9016563-0	1997	Distamycin prolongs E-selectin expression by interacting with a specific NF-kappaB-HMG-I(Y) binding site in the promoter.	stallimycin	0-10	high mobility group AT-hook 1	Homo sapiens	83-90
9016563-4	1997	Distamycin is an antibiotic that also binds A/T-rich DNA and inhibits HMG-I(Y) DNA binding.	stallimycin	0-10	high mobility group AT-hook 1	Homo sapiens	70-77
9016563-5	1997	To study the role of HMG-I(Y) in E-selectin expression, we have examined the effect of distamycin on the cytokine-induced E-selectin expression cycle.	stallimycin	87-97	selectin E	Homo sapiens	122-132
9016563-6	1997	We found that distamycin prolonged E-selectin expression, both by sustaining mRNA transcription and by extending the transcript"s half-life.	stallimycin	14-24	selectin E	Homo sapiens	35-45
9016563-7	1997	The distamycin effect on transcription was mediated through one of the three NF-kappaB-HMG-I(Y) binding sites (NF-kappaBII) within the promoter.	stallimycin	4-14	high mobility group AT-hook 1	Homo sapiens	87-94
8798634-8	1996	An AT minor groove-binding drug, distamycin A, disrupted the TBP.TFIIA.DNA complex and restored the EGR1.DNA complex.	stallimycin	33-45	early growth response 1	Homo sapiens	100-104
8573565-1	1996	We have used DNase I footprinting and gel shift assays to characterize the interaction of DNA binding drugs mithramycin, distamycin, and berenil with an intermolecular triplex formed by the human c-Ki-ras promoter.	stallimycin	121-131	KRAS proto-oncogene, GTPase	Homo sapiens	196-204
8573565-7	1996	Five prominent distamycin binding sites are noted within the c-Ki-ras promoter including the triplex-forming site as well as A-T-rich regions upstream and downstream of the triplex site.	stallimycin	15-25	choline kinase alpha	Homo sapiens	61-65
7784168-0	1995	Distamycin A and tallimustine inhibit TBP binding and basal in vitro transcription.	stallimycin	0-12	TATA-box binding protein	Homo sapiens	38-41
7577702-0	1995	Alteration of the expression of human estrogen receptor gene by distamycin.	stallimycin	64-74	estrogen receptor 1	Homo sapiens	38-55
7577702-1	1995	The effects of distamycin on the expression of the estrogen receptor gene were determined in the MCF7 human breast cancer cell line.	stallimycin	15-25	estrogen receptor 1	Homo sapiens	51-68
7577702-3	1995	After ex vivo distamycin treatment of the cells the expression of the canonical ER mRNA isoform of 6.3 kb is strongly inhibited, without appreciable alteration of the accumulation of 5" upstream ER mRNA isoforms.	stallimycin	14-24	estrogen receptor 1	Homo sapiens	80-82
7577702-4	1995	These results suggest that distamycin alters the transcriptional activity of the ER gene causing a change in the ratio between the canonical transcript and other isoforms containing 5" upstream regions.	stallimycin	27-37	estrogen receptor 1	Homo sapiens	81-83
7516181-3	1994	Our results demonstrate that reversible MGBs (DAPI, distamycin A, Hoechst 33258, and netropsin) are effective inhibitors of the formation of DNA/TBP complex and that distamycin A is the most potent (0.16 microM inhibits TBP complex formation by 50%).	stallimycin	166-178	TATA-box binding protein	Homo sapiens	145-148
7880838-8	1995	Competitive electrophoretic mobility shift assays were used to show that berenil, distamycin, and mithramycin, all of which bind in the minor groove, compete with MBP-1 for binding to the MPB-1 binding site.	stallimycin	82-92	mannose binding lectin 2	Homo sapiens	163-168
7880838-8	1995	Competitive electrophoretic mobility shift assays were used to show that berenil, distamycin, and mithramycin, all of which bind in the minor groove, compete with MBP-1 for binding to the MPB-1 binding site.	stallimycin	82-92	enolase 1	Homo sapiens	188-193
7699207-6	1994	Distamycin inhibits indeed PCR mediated amplification of AT-rich regions of the human estrogen receptor gene, displaying no inhibitory effects on PCR-mediated amplification of GC-rich sequences of Ha-ras oncogene.	stallimycin	0-10	estrogen receptor 1	Homo sapiens	86-103
7516181-3	1994	Our results demonstrate that reversible MGBs (DAPI, distamycin A, Hoechst 33258, and netropsin) are effective inhibitors of the formation of DNA/TBP complex and that distamycin A is the most potent (0.16 microM inhibits TBP complex formation by 50%).	stallimycin	52-64	TATA-box binding protein	Homo sapiens	145-148
8041627-6	1994	The minor groove specific drugs chromomycin A3, distamycin A and actinomycin D competed against UBF for enhancer binding, suggesting that UBF, like other HMG-box proteins, probably interacts with the minor groove.	stallimycin	48-60	upstream binding transcription factor L homeolog	Xenopus laevis	96-99
8041627-6	1994	The minor groove specific drugs chromomycin A3, distamycin A and actinomycin D competed against UBF for enhancer binding, suggesting that UBF, like other HMG-box proteins, probably interacts with the minor groove.	stallimycin	48-60	upstream binding transcription factor L homeolog	Xenopus laevis	138-141
7516181-3	1994	Our results demonstrate that reversible MGBs (DAPI, distamycin A, Hoechst 33258, and netropsin) are effective inhibitors of the formation of DNA/TBP complex and that distamycin A is the most potent (0.16 microM inhibits TBP complex formation by 50%).	stallimycin	166-178	TATA-box binding protein	Homo sapiens	220-223
7516181-4	1994	CC-1065, a drug that covalently binds to DNA in the minor groove, is even more active than distamycin A (0.00085 microM inhibits TBP complex formation by 50%).	stallimycin	91-103	TATA-box binding protein	Homo sapiens	129-132
7516181-7	1994	In the presence of TFIIA, a factor that enhances TBP association with DNA, greater drug concentrations (distamycin A and CC-1065, respectively) are needed to disrupt a preformed complex of DNA/TBP/TFIIA.	stallimycin	104-116	general transcription factor IIA subunit 1	Homo sapiens	19-24
7516181-7	1994	In the presence of TFIIA, a factor that enhances TBP association with DNA, greater drug concentrations (distamycin A and CC-1065, respectively) are needed to disrupt a preformed complex of DNA/TBP/TFIIA.	stallimycin	104-116	TATA-box binding protein	Homo sapiens	49-52
7516181-7	1994	In the presence of TFIIA, a factor that enhances TBP association with DNA, greater drug concentrations (distamycin A and CC-1065, respectively) are needed to disrupt a preformed complex of DNA/TBP/TFIIA.	stallimycin	104-116	TATA-box binding protein	Homo sapiens	193-196
7516181-7	1994	In the presence of TFIIA, a factor that enhances TBP association with DNA, greater drug concentrations (distamycin A and CC-1065, respectively) are needed to disrupt a preformed complex of DNA/TBP/TFIIA.	stallimycin	104-116	general transcription factor IIA subunit 1	Homo sapiens	197-202
7694277-3	1993	No 1:1 and 3:1 complexes were seen, implying a preferential dimeric binding mode of Dm to oligo-12.	stallimycin	84-86	NBL1, DAN family BMP antagonist	Homo sapiens	0-12
7508230-0	1994	New sulfonated distamycin A derivatives with bFGF complexing activity.	stallimycin	15-27	fibroblast growth factor 2	Homo sapiens	45-49
7508230-4	1994	A series of sulfonated distamycin A derivatives have been synthesized with the objective of identifying novel compounds able to complex basic fibroblastic growth factor (bFGF) and other factors involved in tumour angiogenesis, and consequently to block the angiogenic process.	stallimycin	23-35	fibroblast growth factor 2	Homo sapiens	170-174
8471077-1	1993	We have measured the effects of eight distamycin and two anthracycline derivatives on polynucleotide joining and self-adenylating activities of human DNA ligase I and rat DNA ligases I and III.	stallimycin	38-48	DNA ligase 1	Rattus norvegicus	150-162
8471077-1	1993	We have measured the effects of eight distamycin and two anthracycline derivatives on polynucleotide joining and self-adenylating activities of human DNA ligase I and rat DNA ligases I and III.	stallimycin	38-48	DNA ligase 1	Rattus norvegicus	171-192
1447220-2	1992	The path of cooperative polymerization of recA protein was deduced by its ability to cause quantitative displacement of distamycin from the narrow groove of duplex DNA.	stallimycin	120-130	RAD51 recombinase	Homo sapiens	42-46
1447220-6	1992	Intriguingly, distamycin interfered with the production of coaggregates between nucleoprotein filaments of recA protein-M13 ssDNA and naked linear M13 duplex DNA, but not with linear phi X174 duplex DNA.	stallimycin	14-24	RAD51 recombinase	Homo sapiens	107-111
1329842-2	1992	We have found that three minor groove-binding antibiotics, distamycin A, netropsin and sibiromycin, compete effectively with the cro for binding to the operator OR3.	stallimycin	59-71	cro	Escherichia virus Lambda	129-132
1487398-1	1992	FCE 24517, a derivative of distamycin A, exhibits an unusual antitumor profile in experimental models.	stallimycin	27-39	ferrochelatase	Homo sapiens	0-3
1385053-3	1992	Gel mobility shift assays show that HMG-I forms specific complexes with satellite DNA and that the formation of these complexes is competed for by both Hoechst and distamycin.	stallimycin	164-174	high mobility group AT-hook 1	Mus musculus	36-41
1329842-5	1992	Both the CD spectral profiles and the results of the gel retardation experiments indicate that distamycin A and netropsin can displace cro repressor from the operator OR3.	stallimycin	95-107	cro	Escherichia virus Lambda	135-138
1329842-8	1992	The CD spectral profile of the cro-OR3 mixture in the presence of distamycin A can be represented as a sum of the CD spectrum of the repressor-operator complex and spectrum of distamycin-DNA complex at the appropriate molar ratio of the bound antibiotic to the operator DNA (r).	stallimycin	66-78	cro	Escherichia virus Lambda	31-34
1329842-8	1992	The CD spectral profile of the cro-OR3 mixture in the presence of distamycin A can be represented as a sum of the CD spectrum of the repressor-operator complex and spectrum of distamycin-DNA complex at the appropriate molar ratio of the bound antibiotic to the operator DNA (r).	stallimycin	66-76	cro	Escherichia virus Lambda	31-34
1329842-10	1992	This suggests that simultaneous binding of cro repressor and distamycin A to the same DNA oligomer is not possible and that distamycin A and netropsin can be used to determine the equilibrium affinity constant of cro repressor to the synthetic operator from competition-type experiments.	stallimycin	61-73	cro	Escherichia virus Lambda	213-216
1329842-10	1992	This suggests that simultaneous binding of cro repressor and distamycin A to the same DNA oligomer is not possible and that distamycin A and netropsin can be used to determine the equilibrium affinity constant of cro repressor to the synthetic operator from competition-type experiments.	stallimycin	124-136	cro	Escherichia virus Lambda	213-216
2714776-7	1989	In addition, FRA17A, classified as a distamycin A-inducible fragile site, was found with a frequency of 1 in 206.	stallimycin	37-49	fragile site, distamycin A type, rare, fra(17)(p12)	Homo sapiens	13-19
1764367-0	1991	Biological profile of FCE 24517, a novel benzoyl mustard analogue of distamycin A.	stallimycin	69-81	ferrochelatase	Homo sapiens	22-25
1864598-1	1991	Expression of distamycin A-inducible rare fragile sites by AT-specific DNA-ligands was examined in lymphoblastoid cell lines derived from heterozygous carriers for the fra(8)(q24), fra(16)(p12), and fra(16)(q22) sites.	stallimycin	14-26	DNA polymerase epsilon 4, accessory subunit	Homo sapiens	189-192
1997000-0	1991	Distamycin inhibits the binding of a nuclear factor to the -278/-256 upstream sequence of the human HLA-DR alpha gene.	stallimycin	0-10	major histocompatibility complex, class II, DR alpha	Homo sapiens	100-112
1997000-1	1991	In this study we analyse the effects of the anti-tumor compound distamycin on the binding of nuclear factor(s) to a synthetic oligonucleotide (GTATA/IFN-gamma) mimicking a putative regulatory region of the human HLA-DR alpha gene.	stallimycin	64-74	interferon gamma	Homo sapiens	149-158
1997000-1	1991	In this study we analyse the effects of the anti-tumor compound distamycin on the binding of nuclear factor(s) to a synthetic oligonucleotide (GTATA/IFN-gamma) mimicking a putative regulatory region of the human HLA-DR alpha gene.	stallimycin	64-74	major histocompatibility complex, class II, DR alpha	Homo sapiens	212-224
2556260-8	1989	Distamycin, which is known to interact highly selectively with runs of A.T base pairs, abolishes the specific interaction of SARs with topoisomerase II, and the homopolymer oligo(dA).oligo(dT) is, above a critical length of 240 bp, a highly specific artificial SAR.	stallimycin	0-10	sarcosine dehydrogenase	Homo sapiens	125-128
1311255-7	1992	Treatment of cells with distamycin selectively enhances cleavage at nucleosome linker sites of the SAR and satellite regions, suggesting that AT-rich sequences flanking cleavage sites may be involved in determining topoisomerase II activity in the cell.	stallimycin	24-34	Topoisomerase 2	Drosophila melanogaster	215-231
1377571-4	1992	A number of sulphonated derivatives of distamycin A were found active in inhibiting the binding of bFGF and PDGF beta on Swiss 3T3 cells with ID50 values ranging between 142-587 microM for bFGF and 28-79 microM for PDGF beta.	stallimycin	39-51	fibroblast growth factor 2	Mus musculus	99-103
1377571-4	1992	A number of sulphonated derivatives of distamycin A were found active in inhibiting the binding of bFGF and PDGF beta on Swiss 3T3 cells with ID50 values ranging between 142-587 microM for bFGF and 28-79 microM for PDGF beta.	stallimycin	39-51	platelet derived growth factor, B polypeptide	Mus musculus	108-117
1377571-4	1992	A number of sulphonated derivatives of distamycin A were found active in inhibiting the binding of bFGF and PDGF beta on Swiss 3T3 cells with ID50 values ranging between 142-587 microM for bFGF and 28-79 microM for PDGF beta.	stallimycin	39-51	fibroblast growth factor 2	Mus musculus	189-193
1377571-4	1992	A number of sulphonated derivatives of distamycin A were found active in inhibiting the binding of bFGF and PDGF beta on Swiss 3T3 cells with ID50 values ranging between 142-587 microM for bFGF and 28-79 microM for PDGF beta.	stallimycin	39-51	platelet derived growth factor, B polypeptide	Mus musculus	215-224
3165691-1	1988	Five rare distamycin A-inducible fragile sites have been identified on human chromosomes: fra(8)(q24.1), fra(11)(p15.1), fra(16)(p12.1), fra(16)(q22), and fra(17)(p12).	stallimycin	10-22	cyclin dependent kinase inhibitor 2B	Homo sapiens	113-116
3169734-0	1988	A new rare distamycin A-inducible fragile site, fra(11) (p15.1), found in two acute nonlymphocytic leukemia (ANLL) patients with t(7;11)(p15-p13;p15).	stallimycin	11-23	cyclin dependent kinase inhibitor 2B	Homo sapiens	57-60
3169734-0	1988	A new rare distamycin A-inducible fragile site, fra(11) (p15.1), found in two acute nonlymphocytic leukemia (ANLL) patients with t(7;11)(p15-p13;p15).	stallimycin	11-23	cyclin dependent kinase inhibitor 2B	Homo sapiens	137-140
3169734-0	1988	A new rare distamycin A-inducible fragile site, fra(11) (p15.1), found in two acute nonlymphocytic leukemia (ANLL) patients with t(7;11)(p15-p13;p15).	stallimycin	11-23	H3 histone pseudogene 6	Homo sapiens	141-144
3169734-0	1988	A new rare distamycin A-inducible fragile site, fra(11) (p15.1), found in two acute nonlymphocytic leukemia (ANLL) patients with t(7;11)(p15-p13;p15).	stallimycin	11-23	cyclin dependent kinase inhibitor 2B	Homo sapiens	137-140
3169734-5	1988	From these results, fra(11)(p15.1) can now be classified as a rare distamycin A-inducible fragile site.	stallimycin	67-79	cyclin dependent kinase inhibitor 2B	Homo sapiens	28-31
3165691-1	1988	Five rare distamycin A-inducible fragile sites have been identified on human chromosomes: fra(8)(q24.1), fra(11)(p15.1), fra(16)(p12.1), fra(16)(q22), and fra(17)(p12).	stallimycin	10-22	DNA polymerase epsilon 4, accessory subunit	Homo sapiens	129-132
3165691-1	1988	Five rare distamycin A-inducible fragile sites have been identified on human chromosomes: fra(8)(q24.1), fra(11)(p15.1), fra(16)(p12.1), fra(16)(q22), and fra(17)(p12).	stallimycin	10-22	DNA polymerase epsilon 4, accessory subunit	Homo sapiens	163-166
3817162-2	1987	Interaction of two synthetic analogs of distamycin (Dst), PPA and PAP, containing a saturated beta-alanine moiety replacing one N-methylpyrrole ring, with different polynucleotides and natural DNAs were studied using UV and CD spectroscopy.	stallimycin	40-50	regenerating family member 3 alpha	Homo sapiens	66-69
2840956-4	1988	The analogue, mPD derivative, has the requisite charged end groups and a number of potential hydrogen-bonding loci equal to those of distamycin.	stallimycin	133-143	mevalonate (diphospho) decarboxylase	Mus musculus	14-17
6273824-1	1981	The endonucleolytic action of the EcoRI restriction enzyme on the double-stranded oligonucleotide d(GGAATTCC) and the supercoiled plasmid DNA pBR 233 is inhibited by actinomycin D, ethidium bromide, proflavin, distamycin A and netropsin.	stallimycin	210-222	translocator protein	Homo sapiens	142-145
6198907-6	1984	Distamycin A, netropsin, and Hoechst 33258 induced high levels of expression of fra(16)(q22) and fra(17)(p12) but did not enhance expression of fra(10)(q25).	stallimycin	0-12	DNA polymerase epsilon 4, accessory subunit	Homo sapiens	105-108
4332843-0	1970	The inhibitory activity of distamycin A on X14, H-1 and polyoma viruses multiplication.	stallimycin	27-39	H1.5 linker histone, cluster member	Homo sapiens	43-51
7197598-1	1981	Pretreatment of PHA-stimulated lymphocyte cultures from normal males with 100 micrograms/ml Distamycin A for the final 24 h of incubation led to a striking decondensation of the heterochromatic portion of the long arm of the Y chromosome.	stallimycin	92-104	lamin B receptor	Homo sapiens	16-19
27186601-1	2016	Minor groove binding distamycin like moieties were conjugated with core salens and the corresponding Fe(iii) and Co(ii) complexes were synthesized.	stallimycin	21-31	mitochondrially encoded cytochrome c oxidase II	Homo sapiens	113-119
25694263-0	2015	Probing the interaction of distamycin A with S100beta: the "unexpected" ability of S100beta to bind to DNA-binding ligands.	stallimycin	27-39	S100 calcium binding protein B	Homo sapiens	45-53
25694263-0	2015	Probing the interaction of distamycin A with S100beta: the "unexpected" ability of S100beta to bind to DNA-binding ligands.	stallimycin	27-39	S100 calcium binding protein B	Homo sapiens	83-91
25694263-4	2015	Here, we show that distamycin A binds S100beta, a protein involved in the regulation of several cellular processes.	stallimycin	19-31	S100 calcium binding protein B	Homo sapiens	38-46
25694263-5	2015	The reported affinity of distamycin A for the calcium(II)-loaded S100beta reinforces the idea that some biological activities of the DNA-minor-groove-binding ligands arise from the binding to cellular proteins.	stallimycin	25-37	S100 calcium binding protein B	Homo sapiens	65-73
20395035-1	2010	Distamycin A (Dst) is an antibiotic which binds to the minor groove of double-stranded DNA at A/T-rich regions.	stallimycin	0-12	dystonin	Homo sapiens	14-17
21814787-7	2012	The optimal interaction of distamycin A with DNA may account for the down-regulation of both dihydrofolate reductase (DHFR) and thymidylate synthase (TS) and the up-regulation of spermidine/spermine N1-acetyltransferase (SSAT) caused by this compound.	stallimycin	27-39	dihydrofolate reductase	Homo sapiens	93-116
21814787-7	2012	The optimal interaction of distamycin A with DNA may account for the down-regulation of both dihydrofolate reductase (DHFR) and thymidylate synthase (TS) and the up-regulation of spermidine/spermine N1-acetyltransferase (SSAT) caused by this compound.	stallimycin	27-39	dihydrofolate reductase	Homo sapiens	118-122
21814787-7	2012	The optimal interaction of distamycin A with DNA may account for the down-regulation of both dihydrofolate reductase (DHFR) and thymidylate synthase (TS) and the up-regulation of spermidine/spermine N1-acetyltransferase (SSAT) caused by this compound.	stallimycin	27-39	thymidylate synthetase	Homo sapiens	128-148
21814787-7	2012	The optimal interaction of distamycin A with DNA may account for the down-regulation of both dihydrofolate reductase (DHFR) and thymidylate synthase (TS) and the up-regulation of spermidine/spermine N1-acetyltransferase (SSAT) caused by this compound.	stallimycin	27-39	spermidine/spermine N1-acetyltransferase 1	Homo sapiens	179-219
21814787-7	2012	The optimal interaction of distamycin A with DNA may account for the down-regulation of both dihydrofolate reductase (DHFR) and thymidylate synthase (TS) and the up-regulation of spermidine/spermine N1-acetyltransferase (SSAT) caused by this compound.	stallimycin	27-39	spermidine/spermine N1-acetyltransferase 1	Homo sapiens	221-225
21854010-0	2011	Molecular basis for the inhibition of HMGA1 proteins by distamycin A.	stallimycin	56-68	high mobility group AT-hook 1	Homo sapiens	38-43
21854010-2	2011	Chemical shift and NOESY NMR experiments provide structural evidence for the displacement of an AT hook peptide (DNA binding motif of HMGA1 proteins) by both monomeric and dimeric distamycin.	stallimycin	180-190	high mobility group AT-hook 1	Homo sapiens	134-139
21854010-5	2011	HMGA1a was effectively displaced by distamycin, but the cooperative binding exhibited by distamycin was eliminated by displaced HMGA1a.	stallimycin	36-46	high mobility group AT-hook 1	Homo sapiens	0-6
21854010-5	2011	HMGA1a was effectively displaced by distamycin, but the cooperative binding exhibited by distamycin was eliminated by displaced HMGA1a.	stallimycin	89-99	high mobility group AT-hook 1	Homo sapiens	128-134
21854010-6	2011	Additionally, these studies indicate that HMGA1a is displaced from the DNA by 1 equiv of distamycin, suggesting the ability to develop therapeutics that take advantage of the positively cooperative nature of HMGA1a binding.	stallimycin	89-99	high mobility group AT-hook 1	Homo sapiens	42-48
21854010-6	2011	Additionally, these studies indicate that HMGA1a is displaced from the DNA by 1 equiv of distamycin, suggesting the ability to develop therapeutics that take advantage of the positively cooperative nature of HMGA1a binding.	stallimycin	89-99	high mobility group AT-hook 1	Homo sapiens	208-214
21799846-6	2011	Therefore, in an attempt to promote the DNA binding of the isolated peptide, we have designed a conjugate compound of the E2 alpha-helix peptide and a derivative of the antibiotic distamycin, which involves simultaneous minor- and major-groove interactions.	stallimycin	180-190	transcription factor 3	Homo sapiens	122-130
21799846-7	2011	METHODOLOGY/PRINCIPAL FINDINGS: An E2 alpha-helix peptide-distamycin conjugate was designed and synthesized.	stallimycin	58-68	transcription factor 3	Homo sapiens	35-43
21314600-0	2010	Influence of distamycin, chromomycin, and UV-irradiation on extraction of histone H1 from rat liver nuclei by polyglutamic acid.	stallimycin	13-23	H1.0 linker histone	Rattus norvegicus	74-84
25761689-0	2015	Extraction of histone H1 and decondensation of nuclear chromatin with various Mg-dependent organization levels under treatment with polyglutamic acid and distamycin.	stallimycin	154-164	H1.0 linker histone	Rattus norvegicus	14-24
20699642-3	2010	This phenomenon was accompanied by elevation of PML transcripts after treatment with BrdU, TMD, DMA and CPT.	stallimycin	96-99	PML nuclear body scaffold	Homo sapiens	48-51
17950611-1	2008	We previously reported that distamycin A, a natural antibiotic known as a minor groove binder, could bind to DNA duplexes containing the (6-4) photoproduct formed at its target site, whereas the binding was not observed for duplexes containing the cis-syn cyclobutane pyrimidine dimer in the same sequence context.	stallimycin	28-40	synemin	Homo sapiens	252-255
20498830-0	2010	Distamycin A inhibits HMGA1-binding to the P-selectin promoter and attenuates lung and liver inflammation during murine endotoxemia.	stallimycin	0-12	high mobility group AT-hook 1	Mus musculus	22-27
20498830-0	2010	Distamycin A inhibits HMGA1-binding to the P-selectin promoter and attenuates lung and liver inflammation during murine endotoxemia.	stallimycin	0-12	selectin, platelet	Mus musculus	43-53